Search

Purpose – To better respond to today’s volatile and changing fashion market, the purpose of this paper is to develop a web-based design support system that enables users to design realistic and interesting skirts in the form of technical sketches over the internet. Design/methodology/approach – The proposed system mainly consists of a sketch representation and composing method (SRCM), a graphic user interface (GUI) and a controller. The SRCM is implemented at the server end that generates technical sketches according to user defined parameters and features via the web-based GUI at the client side. The controller manages the workflows between the server and the clients. Findings – To evaluate the effectiveness of the proposed system, a survey was conducted by inviting 30 subjects (professional designers or undergraduate students studying fashion design) to have trial run of the system in Hong Kong and in the USA. Positive comments and feedbacks were received, and valuable suggestions were also obtained in regard to the prototype system. Originality/value – Compared with traditional computer-aided design (CAD) systems, the proposed system is more effective and easier to operate as users can create technical sketches in accurate proportions with simple computer operations in a few mouse clicks. Besides, the output sketches are fully compatible with most commercial CAD software. The system is developed based on web technologies, thus fashion sketches can be easily designed using any computer connected to the internet; it can be implemented on Android or iOS platform in the future.

Importance Risk of Alzheimer disease (AD) is particularly high for individuals with Down syndrome (DS). The e4 allele of the apolipoprotein E gene (APOE e4) is associated with an additional risk for AD. In typical development, there is evidence that theAPOE e4 genotype is associated with an early cognitive advantage. Here we investigate associations ofAPOE e4 with attention across the life span of individuals with DS. Objective To investigate associations betweenAPOE e4 and attentional abilities in young children and in adults with DS. Design, Settings, and Participants In this cross-sectional study, data were collected from 80 young children with DS (8-62 months of age) and 240 adults with DS (16-71 years of age) during the period from 2013 to 2018 at a research center to examine the association betweenAPOEstatus (e4 carrier vs e4 noncarrier) and attentional abilities. Exposure APOEstatus (e4 carrier vs e4 noncarrier). Main Outcomes and Measures For the children, attentional ability was assessed using an eye-tracking paradigm, the gap-overlap task; the size of the gap effect was the primary outcome. For the adults, attentional ability was assessed using the CANTAB simple reaction time task; the standard deviation of response time latencies was the primary outcome. Cross-sectional developmental trajectories were constructed linking attentional ability with age in e4 carriers and e4 noncarriers for children and adults separately. Results The child sample comprised 23 e4 carriers and 57 e4 noncarriers. The adult sample comprised 61 e4 carriers and 179 e4 noncarriers. For the children, a significant difference between trajectory intercepts (ηp2 = 0.14) indicated that e4 carriers (B = 100.24 [95% CI, 18.52-181.96]) exhibited an attentional advantage over e4 noncarriers (B = 314.78 [95% CI, 252.17-377.39]). There was an interaction betweenAPOEstatus and age (ηp2 = 0.10); while the gap effect decreased with age for e4 noncarriers (B = −4.58 [95% CI, −6.67 to −2.48]), reflecting the development of the attention system, there was no change across age in e4 carriers (B = 0.77 [95% CI, −1.57 to 3.12]). For the adults, there was no main effect of e4 carrier status, but there was an interaction betweenAPOEstatus and age (B = 0.02 [95% CI, 0.004-0.07]), so that e4 carriers had poorer attentional ability than e4 noncarriers at older ages. Conclusions and Relevance APOE e4 is associated with an attentional advantage early in development and a disadvantage later in life for individuals with DS, similar to the pattern reported in typical development. Understanding the differential role ofAPOEacross the life span is an important step toward future interventions.

Importance Large-scale genome-wide association studies in the European population have identified 90 risk variants associated with Parkinson disease (PD); however, there are limited studies in the largest population worldwide (ie, Asian). Objectives To identify novel genome-wide significant loci for PD in Asian individuals and to compare genetic risk between Asian and European cohorts. Design Setting, and Participants Genome-wide association data generated from PD cases and controls in an Asian population (ie, Singapore/Malaysia, Hong Kong, Taiwan, mainland China, and South Korea) were collected from January 1, 2016, to December 31, 2018, as part of an ongoing study. Results were combined with inverse variance meta-analysis, and replication of top loci in European and Japanese samples was performed. Discovery samples of 31 575 individuals passing quality control of 35 994 recruited were used, with a greater than 90% participation rate. A replication cohort of 1 926 361 European-ancestry and 3509 Japanese samples was analyzed. Parkinson disease was diagnosed using UK Parkinson’s Disease Society Brain Bank Criteria. Main Outcomes and Measures Genotypes of common variants, association with disease status, and polygenic risk scores. Results Of 31 575 samples identified, 6724 PD cases (mean [SD] age, 64.3 [10] years; age at onset, 58.8 [10.6] years; 3472 [53.2%] men) and 24 851 controls (age, 59.4 [11.4] years; 11 030 [45.0%] men) were analyzed in the discovery study. Eleven genome-wide significant loci were identified; 2 of these loci were novel (SV2CandWBSCR17) and 9 were previously found in Europeans. Replication in European-ancestry and Japanese samples showed robust association forSV2C(rs246814; odds ratio, 1.16; 95% CI, 1.11-1.21;P = 1.17 × 10−10in meta-analysis of discovery and replication samples) but showed potential genetic heterogeneity atWBSCR17(rs9638616;I2=67.1%;P = 3.40 × 10−3for hetereogeneity). Polygenic risk score models including variants at these 11 loci were associated with a significant improvement in area under the curve over the model based on 78 European loci alone (63.1% vs 60.2%;P = 6.81 × 10−12). Conclusions and Relevance This study identified 2 apparently novel gene loci and found 9 previously identified European loci to be associated with PD in this large, meta–genome-wide association study in a worldwide population of Asian individuals and reports similarities and differences in genetic risk factors between Asian and European individuals in the risk for PD. These findings may lead to improved stratification of Asian patients and controls based on polygenic risk scores. Our findings have potential academic and clinical importance for risk stratification and precision medicine in Asia.

A growing body of evidence has substantiated the significance of quantitative phase imaging (QPI) in enabling cost-effective and label-free cellular assay, which provides useful insights into understanding biophysical properties of cells and their roles in cellular functions. However, available QPI modalities are limited by the loss of imaging resolution at high throughput and thus run short of sufficient statistical power at the single cell precision to define cell identities in a large and heterogeneous population of cells – hindering their utility in mainstream biomedicine and biology. Here we present a new QPI modality, coined multi-ATOM that captures and processes quantitative label-free single-cell images at ultra-high throughput without compromising sub-cellular resolution. We show that multi-ATOM, based upon ultrafast phase-gradient encoding, outperforms state-of-the-art QPI in permitting robust phase retrieval at a QPI throughput of >10,000 cell/sec, bypassing the need for interferometry which inevitably compromises QPI quality under ultrafast operation. We employ multi-ATOM for large-scale, label-free, multi-variate, cell-type classification (e.g. breast cancer sub-types, and leukemic cells versus peripheral blood mononuclear cells) at high accuracy (>94%). Our results suggest that multi-ATOM could empower new strategies in large-scale biophysical single-cell analysis with applications in biology and enriching disease diagnostics.

Key Points Question How does dementia status influence mortality in people with Down syndrome? Findings In a longitudinal study including 211 adults with Down syndrome 36 years and older, 27 people died during follow-up (mean, 28; range, 1-65 months), and dementia was the proximate cause of death in 70% of cases. Crude mortality rates were 5 times higher in those with dementia than those without. Meaning Nearly all older adults with Down syndrome now have dementia when they die, making this a vital population for researching disease progression, modifying factors, and potential treatments., Importance This work quantifies the fatal burden of dementia associated with Alzheimer disease in individuals with Down syndrome (DS). Objective To explore the association of dementia associated with Alzheimer disease with mortality and examine factors associated with dementia in adults with DS. Design, Settings and Participants Prospective longitudinal study in a community setting in England. Data collection began March 29, 2012. Cases were censored on December 13, 2017. The potential sample consisted of all adults 36 years and older from the London Down Syndrome Consortium cohort with 2 data times and dementia status recorded (N = 300); 6 withdrew from study, 28 were lost to follow-up, and 55 had a single data collection point at time of analysis. The final sample consisted of 211 participants, with 503.92 person-years’ follow-up. Exposures Dementia status, age, sex, APOE genotype, level of intellectual disability, health variables, and living situation. Main Outcomes and Measures Crude mortality rates, time to death, and time to dementia diagnosis with proportional hazards of predictors. Results Of the 211 participants, 96 were women (45.5%) and 66 (31.3%) had a clinical dementia diagnosis. Twenty-seven participants (11 female; mean age at death, 56.74 years) died during the study period. Seventy percent had dementia. Crude mortality rates for individuals with dementia (1191.85 deaths per 10 000 person-years; 95% CI, 1168.49-1215.21) were 5 times higher than for those without (232.22 deaths per 10 000 person-years; 95% CI, 227.67-236.77). For those with dementia, APOE ε4 carriers had a 7-fold increased risk of death (hazard ratio [HR], 6.91; 95% CI, 1.756-27.195). For those without dementia, epilepsy with onset after age 36 years was associated with mortality (HR, 9.66; 95% CI, 1.59-58.56). APOE ε4 carriers (HR, 4.91; 95% CI, 2.53-9.56), adults with early-onset epilepsy (HR, 3.61; 95% CI, 1.12-11.60), multiple health comorbidities (HR, 1.956; 95% CI, 1.087-3.519), and those living with family (HR, 2.14; 95% CI, 1.08-4.20) received significantly earlier dementia diagnoses. Conclusions and Relevance Dementia was associated with mortality in 70% of older adults with DS. APOE ε4 carriers and/or people with multiple comorbid health conditions were at increased risk of dementia and death, highlighting the need for good health care. For those who died without a dementia diagnosis, late-onset epilepsy was the only significant factor associated with death, raising questions about potentially undiagnosed dementia cases in this group., This study examines the association of dementia with mortality and examines factors associated with dementia predictors in adults with Down syndrome.

Introduction Recent studies have shown that REM OSA is associated with increased incidence of hypertension and insulin resistance. However, there is a lack of Asian data on REM OSA. Our study aimed to examine the prevalence and characteristics of REM OSA in a multi-ethnic OSA cohort. Methods This was a retrospective observational study of all patients who underwent an overnight diagnostic polysomnography at a Singapore tertiary hospital from 1st August 2017 to 31st August 2018. All patients with a diagnosis of OSA (Apnoea Hypopnea Index (AHI) ≥5) were included in the study. REM OSA is defined as an overall AHI≥5, REM AHI/Non REM (NREM) AHI>2, NREM AHI Results 457 OSA subjects were included in the analysis. 19% (87/457) had REM OSA. Univariate analysis showed that REM OSA was more prevalent among female OSA than male OSA [34/115 (29.6%) versus 53/342 (15.5%) respectively, p Conclusion REM OSA was common in our OSA cohort and had higher prevalence in female and milder disease severity compared to non REM OSA. However, we did not find an increased prevalence of hypertension or diabetes mellitus in REM OSA. Further population-based study on REM OSA is needed to understand this phenotype better. Support NIL

Introduction Down syndrome (DS) is associated with an almost universal development of Alzheimer's disease. Individuals with DS are therefore an important population for randomized controlled trials to prevent or delay cognitive decline, though it is essential to understand the time course of early cognitive changes. Methods We conducted the largest cognitive study to date with 312 adults with DS to assess age-related and Alzheimer's disease–related cognitive changes during progression from preclinical to prodromal dementia, and prodromal to clinical dementia. Results Changes in memory and attention measures were most sensitive to early decline. Resulting sample size calculations for randomized controlled trials to detect significant treatment effects to delay decline were modest. Discussion Our findings address uncertainties around the development of randomized controlled trials to delay cognitive decline in DS. Such trials are essential to reduce the high burden of dementia in people with DS and could serve as proof-of-principle trials for some drug targets., Highlights • Cognitive changes with aging in DS are likely due to the progression of AD. • Memory and attention show the earliest cognitive decline, from the early 40s. • Memory abilities show the greatest sensitivity to dementia development. • Modest sample sizes are sufficient for RCTs to prevent/delay dementia in DS.

Field-reversed configuration (FRC) Amplification via Translation-Collisional Merging (FAT-CM) experiments have recently commenced to study physics phenomena of colliding and merged FRC plasma states. Two independently formed FRCs are translated into the confinement region of the FAT-CM device, collided near the mid-plane of the device with a relative speed of up to ∼400 km/s, and a final merged FRC plasma state is achieved. To measure internal magnetic field profiles of the translated and merged FRC plasmas as well as to understand its collisional-merging process, an internal magnetic probe array, developed by TAE Technologies, has been installed in the mid-plane of the FAT-CM device. Initial magnetic field measurements indicate that both the translated and the merged FRC plasma states exhibit a clear field-reversed structure, which is qualitatively in good agreement with 2D MHD simulation. It is found and verified that a sufficient mirror field in the confinement region is required for colliding FRCs to be fully merged into a single FRC plasma state.

PurposeTo estimate the direct and indirect costs of end-stage renal disease (ESRD) patients in the first and second years of initiating peritoneal dialysis (PD), hospital-based haemodialysis (HD) and nocturnal home HD.MethodsA cost analysis was performed to estimate the annual costs of PD, hospital-based HD and nocturnal home HD for ESRD patients from both the health service provider’s and societal perspectives. Empirical data on healthcare resource use, patients’ out-of-pocket costs, time spent on transportation and dialysis by ESRD patients and time spent by caregivers were analysed. All costs were expressed in Hong Kong year 2017 dollars.ResultsAnalysis was based on 402 ESRD patients on maintenance dialysis (PD: 189; hospital-based HD: 170; and nocturnal home HD: 43). From the perspective of the healthcare provider, hospital-based HD had the highest total annual direct medical costs in the initial year (mean ± SD) (hospital-based HD = $400 057 ± 62 822; PD = $118 467 ± 15 559; nocturnal home HD = $223 358 ± 18 055; P ConclusionsThis study quantified the economic burden of ESRD patients, and assessed the annual healthcare and societal costs in the initial and second years of PD, hospital-based HD and nocturnal home HD in Hong Kong. From both perspectives, PD is cost-saving relative to hospital-based HD and nocturnal home HD, except that nocturnal home HD has the lowest cost in the second year of treatment from the societal perspective. Results from this cost analysis facilitate economic evaluation in Hong Kong for health services and management targeted at ESRD patients.

ObjectiveThe basis for clinical variation related to underlying Progressive Supranuclear Palsy (PSP) pathology is unknown. We performed a genome wide association study (GWAS) to identify genetic determinants of PSP phenotype.MethodsTwo independent pathological and clinically diagnosed PSP cohorts were genotyped and phenotyped to create Richardson’s syndrome (RS) and non-RS groups. We carried out separate logistic regression GWAS to compare RS and non-RS groups and then combined datasets to carry out a whole cohort analysis (RS=367, non-RS=130). We validated our findings in a third cohort by referring to data from 100 deeply phenotyped cases from a recent GWAS. We assessed the expression/co-expression patterns of our identified genes and used our data to carry out gene-based association testing.ResultsOur lead single nucleotide polymorphism (SNP), rs564309, showed an association signal in both cohorts, reaching genome wide significance in our whole cohort analysis – OR 5.5 (3.2-10.0), p-value 1.7×10−9. rs564309 is an intronic variant of the tripartite motif-containing protein 11 (TRIM11) gene, a component of the ubiquitin proteasome system (UPS). In our third cohort, minor allele frequencies of surrogate SNPs in high linkage disequilibrium with rs564309 replicated our findings. Gene based association testing confirmed an association signal at TRIM11. We found that TRIM11 is predominantly expressed neuronally, in the cerebellum and basal ganglia.InterpretationOur study suggests that the TRIM11 locus is a genetic modifier of PSP phenotype and potentially adds further evidence for the UPS having a key role in tau pathology, therefore representing a target for disease modifying therapies.

ObjectiveIndividuals with Down syndrome (DS) have an extremely high genetic risk for Alzheimer’s disease (AD) however the course of cognitive decline associated with progression to dementia is ill-defined. Data-driven methods can estimate long-term trends from cross-sectional data while adjusting for variability in baseline ability, which complicates dementia assessment in those with DS.MethodsWe applied an event-based model to cognitive test data and informant-rated questionnaire data from 283 adults with DS (the largest study of cognitive functioning in DS to date) to estimate the sequence of cognitive decline and individuals’ disease stage.ResultsDecline in tests of memory, sustained attention / motor coordination, and verbal fluency occurred early, demonstrating that AD in DS follows a similar pattern of change to other forms of AD. Later decline was found for informant measures. Using the resulting staging model, we showed that adults with a clinical diagnosis of dementia and those with APOE 3:4 or 4:4 genotype were significantly more likely to be staged later, suggesting the model is valid.InterpretationOur results identify tests of memory and sustained attention may be particularly useful measures to track decline in the preclinical/prodromal stages of AD in DS whereas informant-measures may be useful in later stages (i.e. during conversion to dementia, or post-diagnosis). These results have implications for the selection of outcome measures of treatment trials to delay or prevent cognitive decline due to AD in DS. As clinical diagnoses are generally made late into AD progression, early assessment is essential.

Situated along the coast of southern China and facing the South China Sea, Hong Kong has been experiencing a significant rise in sea level by about 2.9 mm year−1 since the 1950s. For a densely populated coastal city prone to storm surge impacts during the passages of tropical cyclones, accentuated by the threat of sea-level rise as a result of global warming and local vertical land displacement, projection of the sea-level change for Hong Kong is essential for local risk assessment and long-term planning of adaptation measures. This study presented the projection of sea-level change in Hong Kong and its adjacent waters under the Representative Concentration Pathway 4.5 and 8.5 (RCP4.5 and RCP8.5) scenarios in the 21st century based on climate projections by models in phase 5 of Coupled Model Intercomparison Project, in combination with contributions from land ice and land water storage determined from published literatures, and local vertical land displacement as estimated by using continuous high-precision GPS observations in Hong Kong. The results show that the sea level in Hong Kong and its adjacent waters is projected to rise by 0.67 (0.50–0.84) m and 0.84 (0.63–1.07) m in 2081–2100 relative to 1986–2005 under RCP4.5 and RCP8.5, respectively, about 0.2 m higher than the global mean values projected by the Fifth Assessment Report of Intergovernmental Panel on Climate Change. The higher projected sea-level rise in Hong Kong and its adjacent waters as compared with the global mean values is primarily due to local vertical land displacement which contributes around 28% and 23% of the projected sea-level rise in 2081–2100 relative to 1986–2005 in the two respective RCP scenarios.

Objective To describe 5 cases of Parkinson9s disease lacking any detectable histopathology. Background The diagnosis of Parkinson9s disease is supported histologically by the findings of α-synuclein immunopositive Lewy bodies and neurites and severe substantia nigra cell loss. Bradykinesia as defined by slowness of initiation of movement and a progressive reduction in speed and amplitude on finger tapping is a clinical correlate of pars compacta nigral degeneration. There are very few published cases of Parkinson9s disease in which no pathological abnormality was found, and some of these cases were in hindsight thought to have probably been cases of indeterminate senile tremor or dystonic tremor. Methods Retrospective case notes review of the Queen Square Brain Bank archival collection and detailed neuropathological analysis of the selected cases. Results 5 cases considered to have Parkinson9s disease by neurologists throughout the entirety of their illness that lacked any histopathological findings known to be associated with Parkinson9s syndromes were identified out of a total number of 773 brains with a final clinical diagnosis of Parkinson9s disease in the Queen Square Brain Bank. Retrospective case note analysis did not suggest dystonic tremor or indeterminate tremor in any of them. There was a reduction in tyrosine hydroxylase (TH) density in the striatum in these cases when compared with healthy controls, but not in the substantia nigra. Conclusions Striatal dopamine deficiency without nigral cell loss is the most likely explanation for the clinical findings; other possible explanations include slowness due to comorbidities misinterpreted as bradykinesia, a tardive syndrome related to undisclosed previous neuroleptic exposure, or ‘soft age-related’ parkinsonian signs. These cases emphasise the need to regularly review the diagnosis in cases of suspected Parkinson9s disease and highlight the need for precision in the neurological examination particularly of elderly patients. These cases may represent a distinct entity of diagnostic exclusion and may be considered one explanation for the radiological phenomenon of SWEDD (scans without evidence of dopaminergic deficit).

C-2 is a unique, large compact-toroid (CT) device at Tri Alpha Energy that produces field-reversed configuration (FRC) plasmas by colliding and merging oppositely directed CTs. Significant progress has recently been made on C-2, achieving ~5 ms stable plasmas with a dramatic improvement in confinement, far beyond the prediction from the conventional FRC scaling. This stable, long-lived FRC plasma state is called the high-performance FRC (HPF) regime. The key approaches to achieve the HPF regime are as follows: (i) dynamic FRC formation by collision/merging of super-Alfvenic CTs, (ii) effective control of stability and transport by end-on plasma guns and neutral-beam (NB) injection, and (iii) active wall conditioning using titanium and lithium gettering systems. Moreover, further improvement in FRC confinement has been obtained with improved open-field-line plasma properties such as a lower fluctuation level, reduced transport rates in radial/axial directions, and lower background neutral density a...

The International Surface Pressure Databank (ISPD) is the world's largest collection of global surface and sea-level pressure observations. It was developed by extracting observations from established international archives, through international cooperation with data recovery facilitated by the Atmospheric Circulation Reconstructions over the Earth (ACRE) initiative, and directly by contributing universities, organizations, and countries. The dataset period is currently 1768–2012 and consists of three data components: observations from land stations, marine observing systems, and tropical cyclone best track pressure reports. Version 2 of the ISPD (ISPDv2) was created to be observational input for the Twentieth Century Reanalysis Project (20CR) and contains the quality control and assimilation feedback metadata from the 20CR. Since then, it has been used for various general climate and weather studies, and an updated version 3 (ISPDv3) has been used in the ERA-20C reanalysis in connection with the European Reanalysis of Global Climate Observations project (ERA-CLIM). The focus of this paper is on the ISPDv2 and the inclusion of the 20CR feedback metadata. The Research Data Archive at the National Center for Atmospheric Research provides data collection and access for the ISPDv2, and will provide access to future versions.

Background Starting dialysis is an important life event. The prevalence and evolution of psychological symptoms at commencement of long-term dialysis is unclear. We examined the prevalence of and risk factors for depression and anxiety, and the quality of life (QOL) of incident peritoneal dialysis (PD) patients, and also the change of these parameters in the first year of PD in relation to clinical outcomes under the PD-first policy. Methods All patients commencing long-term PD from March 2011 to April 2015 were asked to complete the Hospital Anxiety and Depression Scale (HADS), World Health Organization Quality of Life-BREF and the Kidney Disease Quality of Life Instrument Short Form questionnaire. Patient demographics and the incidence of hospitalization, peritonitis, exit-site infection, and all-cause mortality were studied. The HADS was repeated after 9 – 12 months. Results A high depression score was present in 39.6% of 191 patients at commencement of PD and was more common in diabetes patients (odds ratio [OR] 2.03, 95% confidence interval [CI] 1.09 – 3.81). A high anxiety score was present in 23.6%, and the risk factors included younger age (OR 0.96 per year, 95% CI 0.94 – 0.99) and diabetes (OR 2.59, 95% CI 1.20 – 5.57). Both high depression and anxiety scores were associated with an inferior QOL, overall and across most QOL domains. Depression and anxiety symptoms did not change in the first year of PD and were not associated with short-term clinical outcomes. Conclusions High depression and anxiety scores were prevalent in incident PD patients where PD-first policy is adopted and were associated with inferior QOL. There was no improvement after 1 year of PD. The impact of strategic interventions targeting patient groups at risk such as those with diabetes or of younger age warrants further investigation.

Scaling the number of measurable parameters, which allows for multidimensional data analysis and thus higher-confidence statistical results, has been the main trend in the advanced development of flow cytometry. Notably, adding high-resolution imaging capabilities allows for the complex morphological analysis of cellular/sub-cellular structures. This is not possible with standard flow cytometers. However, it is valuable for advancing our knowledge of cellular functions and can benefit life science research, clinical diagnostics, and environmental monitoring. Incorporating imaging capabilities into flow cytometry compromises the assay throughput, primarily due to the limitations on speed and sensitivity in the camera technologies. To overcome this speed or throughput challenge facing imaging flow cytometry while preserving the image quality, asymmetric-detection time-stretch optical microscopy (ATOM) has been demonstrated to enable high-contrast, single-cell imaging with sub-cellular resolution, at an imaging throughput as high as 100,000 cells/s. Based on the imaging concept of conventional time-stretch imaging, which relies on all-optical image encoding and retrieval through the use of ultrafast broadband laser pulses, ATOM further advances imaging performance by enhancing the image contrast of unlabeled/unstained cells. This is achieved by accessing the phase-gradient information of the cells, which is spectrally encoded into single-shot broadband pulses. Hence, ATOM is particularly advantageous in high-throughput measurements of single-cell morphology and texture – information indicative of cell types, states, and even functions. Ultimately, this could become a powerful imaging flow cytometry platform for the biophysical phenotyping of cells, complementing the current state-of-the-art biochemical-marker-based cellular assay. This work describes a protocol to establish the key modules of an ATOM system (from optical frontend to data processing and visualization backend), as well as the workflow of imaging flow cytometry based on ATOM, using human cells and micro-algae as the examples.

Background Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. Results We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. Conclusions The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.

H2 receptor antagonists are commonly employed to manage gastro-esophageal reflux and peptic ulcer diseases with a very low incidence of side effects. Herein, we report an extremely rare incidence of famotidine-induced acute confusion in a patient with end-stage renal failure. We also discuss the pharmacokinetic properties of famotidine and its interplay with compromised renal function to result in neuropsychiatric manifestations, highlighting the importance of dosage adjustment in individuals with renal insufficiency.

OBJECTIVE Calcineurin inhibitors are effective immunosuppressants. They also reduce proteinuria in glomerular diseases but are potentially nephrotoxic. Short-term data suggest that tacrolimus (TAC) combined with corticosteroids is effective in LN, but long-term data are lacking. This study examined the long-term outcomes and tolerability of TAC for the treatment of LN. METHODS We retrospectively reviewed 29 LN patients who received TAC treatment for 46.9 months (s.d. 37.9). RESULTS In 17 patients with class III/IV or V LN and persistent proteinuria >2 g/day despite induction immunosuppression, response rates after 12 and 24 months of add-on TAC treatment were 66.7% and 80.0%, respectively. In 10 patients with nephrotic syndrome due to class V LN who were given prednisolone and TAC as initial treatment, the response rate was 60.0% and 90.0% after 12 and 24 months, respectively. TAC facilitated steroid minimization in two patients with lupus podocytopathy. As a group, proteinuria decreased from 3.6 g/day (s.d. 2.6) to 1.0 (s.d. 1.1) (P < 0.05). Four patients developed end-stage renal failure, with 3-, 5- and 8-year renal survival rates of 93%, 83% and 83%, respectively. In the remaining patients, serum creatinine and estimated GFR remained stable after 36 months. One patient with pre-existing chronic renal failure developed TAC nephrotoxicity. Four renal flares occurred, all associated with low TAC blood levels. Six patients (20.1%) had deterioration of hypertension and one patient (3.4%) had new-onset diabetes mellitus. Six patients (20.1%) had infections that required hospitalization. Two deaths occurred: one due to pneumonia and one to breast cancer. CONCLUSION The results suggest efficacy of TAC in LN, especially in reducing proteinuria, and its role as a long-term maintenance agent warrants further investigation.

TAE Technologies' research is devoted to producing high temperature, stable, long-lived field-reversed configuration (FRC) plasmas by neutral-beam injection (NBI) and edge biasing/control. The newly constructed C-2W experimental device (also called "Norman") is the world's largest compact-toroid (CT) device, which has several key upgrades from the preceding C-2U device such as higher input power and longer pulse duration of the NBI system as well as installation of inner divertors with upgraded electrode biasing systems. Initial C-2W experiments have successfully demonstrated a robust FRC formation and its translation into the confinement vessel through the newly installed inner divertor with adequate guide magnetic field. They also produced dramatically improved initial FRC states with higher plasma temperatures (Te ~250+ eV; total electron and ion temperature g1.5 keV, based on pressure balance) and more trapped flux (up to ~15 mWb, based on rigid-rotor model) inside the FRC immediately after the merger of collided two CTs in the confinement section. As for effective edge control on FRC stabilization, a number of edge biasing schemes have been tried via open field-lines, in which concentric electrodes located in both inner and outer divertors as well as end-on plasma guns are electrically biased independently. As a result of effective outer-divertor electrode biasing alone, FRC plasma diamagnetism duration has reached up to ~9 ms which is equivalent to C-2U plasma duration. Magnetic field flaring/expansion in both inner and outer divertors plays an important role in creating a thermal insulation on open field-lines to reduce a loss rate of electrons, which leads to improvement of the edge and core FRC confinement properties. Experimental campaign with inner-divertor magnetic-field flaring has just commenced and early result indicates that electron temperature of the merged FRC stays relatively high and increases for a short period of time, presumably by NBI and ExB heating.

Collisional merging formation of field-reversed configurations (FRCs) at super Alfvenic velocity have been successfully initiated in the FAT-CM device at Nihon University. It is experimentally evidenced that the quiescent FRC profile is formed in a self-organizational manner after distructive disturbances by the super Alfvenic collision of two translated magnetized plasmoids. A drastic increase of the excluded flux compared to the field-reversed theta-pinch formation section has also been observed. This formation process has an important role in realizing an FRC based high-beta reactor core to capture high-energy beam ions, and it has been clearly observed by magnetic diagnostics of excluded flux and internal probe array. The experimental results are compared with two-dimensional magnetohydrodynamic (MHD) simulation results computed for the typical conditions of the FAT-CM experiments. Collisional merging of the two separately translated FRCs causes a conversion of the kinetic energy to mostly thermal ion energy, which contrasts with the spheromak merging dominated by magnetic energy in an MHD manner, resulting in an increase of the ion pressure and polodal flux that drastically expands the FRC volume.

The measurement of inhomogeneous conductivity in optically crystallized, amorphous Ge2Sb2Te5 (GST) films is demonstrated via scanning microwave impedance microscopy (MIM). Qualitative consistency with expectations is demonstrated in spots crystallized by focused coherent light at various intensities, exposure times, and film thicknesses. The characterization of process imperfections is demonstrated when a mask is used to optically pattern the nanoscale features of crystalline GST in the amorphous film. These measurements show the ability of MIM to resolve partial crystallization, patterning faults, and other details in optically patterned GST.

Patients with influenza infection most commonly present with upper and occasionally lower respiratory tract symptoms. However, extrapulmonary presentations such as hepatitis are infrequently observed. We report a case of a hemodialysis patient with influenza A infection who presented with severe hepatitis and liver failure, while his respiratory symptoms were mild. It is important to recognize influenza infection as an unexplained cause of hepatitis and liver failure. In our case, liver failure resolved with supportive treatment.

IntroductionMadras motor neuron disease (MMND), MMND variant (MMNDV) and Familial MMND (FMMND) have a unique geographic distribution predominantly reported from Southern India. The characteristic features are onset in young, weakness and wasting of limbs, multiple lower cranial nerve palsies and sensorineural hearing loss. There is a considerable overlap in the phenotype of MMND with Brown–Vialetto–Van Laere syndrome (BVVL) Boltshauser syndrome, Nathalie syndrome and Fazio–Londe syndrome. Recently a number of BVVL cases and families have been described with mutations in two riboflavin transporter genes SLC52A2 and SLC52A3 (solute carrier family 52, riboflavin transporter, member 2 and 3 respectively).Methods and resultsWe describe six families and four sporadic MMND cases that have been clinically characterized in detail with history, examination, imaging and electrophysiological investigations. We sequenced the SLC52A1, SLC52A2 and SLC52A3 in affected probands and sporadic individuals from the MMND series as well as the C9ORF72 expansion. No genetic defects were identified and the C9ORF72 repeats were all less than 10.ConclusionsThese data suggest that MMND is a distinct clinical subgroup of childhood onset MND patients where the known genetic defects are so far negative. The clinico-genetic features of MMND in comparison with the BVVL group of childhood motor neuron diseases suggest that these diseases are likely to share a common defective biological pathway that may be a combination of genetic and environmental factors.

Department of Physics and Astronomy, UCLA, Los Angeles, CA 90095, USAA high temperature, stable, long-lived field-reversed configuration (FRC) plasma state has been produced in the C-2 device by dynamically colliding and merging two oppositely directed compact toroids, with combining effects of biasing edge plasma near the FRC separatrix from an end-plasma-gun with magnetic-mirror-plugs andof neutral-beam (NB) injection. The plasma-gun creates an inward radial electric field which mitigates the n = 2rotational instability. The gun also produces E×B velocity shear in the FRC edge layer, which may explain observations of improved transport properties. The FRCs are nearly axisymmetric which enables fast ion confinement, and increasing NB power input clearly extends the FRC lifetime. The combined effects of the plasma-gun with mirror-plugs and of NB injection yield anew High Performance FRC regime with confinement times improved by factors 2 to 4 and FRC lifetimes extended from 1 to 3 ms.

Background : Obesity is a public health problem affecting 35% of the adult population in the US.A 5-10% weight loss decreases the risk of cardiovascular disease and diabetes mellitus. Diet and exercise have shown to be effective in the treatment of obesity, but adherence is a limitation. Dark chocolate (DC) polyphenols were proven to have beneficial effects on blood pressure, endothelial function, HDL cholesterol, lipoprotein ratios and inflammation markers. Also, it might play a role in improving fat metabolism and satiety; however, its effects on weight loss are still not clear. We propose a protocol to explore the effects of DC associated with hypocaloric diet and exercise on weight loss during a 12-week period in obese adults. Methods and Design: The study is a randomized controlled trial with 2 parallel arms comparing hypocaloric diet + exercise with hypocaloric diet + exercise + 50g dark chocolate/day during a 12 week period. A total of 408 obese adults (18 to 45 years old) with no comorbidities that could compromise the exercise program will be recruited. Primary outcome is proportion of patients who had 5% or more weight loss after 12 weeks. Secondary outcomes are glucose levels and insulin resistance (HOMA-IR), lipid profile, abdominal circumference, body fat mass (estimated by skinfold thickness) and blood pressure, satiety perception and drop-out rates. Primary outcome (percentage of patients achieving 5% or more weight loss) will be analyzed by chi-square test with an Intention-to-Treat approach. Conclusions: This phase II randomized controlled trial has the aim to explore the effects of including dark chocolate as an adjuvant to classical therapies (hypocaloric diet and exercise) on weight loss in a 12-week period Trial registration : the trial will be registered at www.clinicaltrials.gov

Introduction: Early diagnosis of pulmonary tuberculosis(PTB) remains a challenge as many PTB patients are sputum scarce or AFB smear negative(AFBSN).Bronchoscopy is often performed to increase PTB yields and the recent bronchoalveolar lavage(BAL) Xpert MTB/RIF is a welcome advance. It is more sensitive than BAL AFB smear but expensive.Thus, it might be cost effective if one can select patients in whom BAL Xpert MTB/RIF is likely to enhance early PTB yields. Aim: We conducted a study to evaluate the presence of any clinical or radiographic predictors for a positive(+ve) BAL Xpert MTB/RIF in BAL AFBSN PTB patients who are sputum scarce or AFBSN. Methods: This is a retrospective review of 44 culture proven PTB patients who were sputum scarce or AFBSN and had undergone prior bronchoscopy for suspected PTB. Results : 81.8% were males; average age was 51.5 years. 79.5%(35/44) of the PTB patients were BAL AFBSN. 60%(21/35) of BAL AFBSN PTB patients had a +ve BAL Xpert MTB/RIF. Univariate analysis did not find any statistically significant clinical factors such as the presence of lung disease(p=0.58), nor radiographic feature(p> 0.05) to be predictive of a +ve BAL Xpert MTB/RIF in BAL AFBSN PTB patients.However,85.7%(6/7) of BAL AFBSN PTB patients with pleural effusion had a +ve BAL Xpert MTB/RIF versus 53.8%(14/26)in those without,but numbers were too small to be significant. Conclusion: We were unable to identify any significant clinical or radiographic predictors for a +ve BAL Xpert/MTB in BAL AFBSN PTB patients who are sputum scarce or AFBSN. There is a suggestion that pleural effusion may predict a +ve BAL Xpert/MTB but this warrants further research.

Mutations in TMEM230 have recently been associated to Parkinson's disease (PD). To further understand the role of this gene in the Caucasian population, we interrogated our large repository of next generation sequencing data from unrelated PD cases and controls, as well as multiplex families with autosomal dominant PD. We identified 2 heterozygous missense variants in 2 unrelated PD cases and not in our control database (p.Y106H and p.I162V), and a heterozygous missense variant in 2 PD cases from the same family (p.A163T). However, data presented herein is not sufficient to support the role of any of these variants in PD pathology. A series of unified sequence kernel association tests also failed to show a cumulative effect of rare variation in this gene on the risk of PD in the general Caucasian population. Further evaluation of genetic data from different populations is needed to understand the genetic role of TMEM230 in PD etiology.

A large expansion of the hexanucleotide repeat in the C9ORF72 gene is the most frequent identified genetic cause of ALS. It also causes other neurodegenerative diseases, especially frontotemporal dementia, and there may be clinical overlap in an individual and within families. Inheritance is autosomal dominant, although due to variable penetrance affected individuals may appear sporadic.

SEE KOBYLECKI AND MANN DOI101093/AWW267 FOR A SCIENTIFIC COMMENTARY ON THIS ARTICLE: Animal models have shown that tau seeding and propagation are strain- and neural network-specific. The study of preclinical cases is valuable to gain insights into early pathological features of corticobasal degeneration and its progression. Three preclinical corticobasal degeneration cases and six age-matched end-stage corticobasal degeneration cases were included in this study. Tau immunohistochemistry performed in 20 brain regions and quantitative assessment of regional tau load using image analysis were performed. Semi-quantitative grading of tau-positive cellular lesions and neuronal loss in the frontal, parietal and temporal cortices, striatum, substantia nigra and subthalamic nucleus were assessed. All preclinical cases were clinically asymptomatic but had widespread tau lesions in the typically affected regions in corticobasal degeneration and the pathognomonic astrocytic plaques were the most prominent lesion type in the anterior frontal and striatal regions. Mean total tau load (sum of all regional tau load) of end-stage corticobasal degeneration cases were nine times greater than that of the preclinical cases (P = 0.04) and less tau load was found in all regions of the preclinical cases. An anterior-to-posterior tau load ratio in the frontal cortex in preclinical cases was 12-fold greater than in end-stage corticobasal degeneration cases. Relatively greater tau burden in the anterior frontal cortex, striatum and subthalamic nucleus suggests the striatal afferent connection to the dorsolateral prefrontal cortex and basal ganglia circuitry are the earliest neural network connections affected by corticobasal degeneration-related tau pathology. Differential distribution of the tau pathology to selective cortical regions in these preclinical cases implies phenotypic presentation may be predetermined at a very early stage of the disease process. Neuronal loss of the substantia nigra was either absent or very mild in the preclinical cases and was moderate to severe in end-stage corticobasal degeneration cases (P < 0.05). Our findings suggest that a threshold of pathological burden in the 'right' anatomical regions needs to be reached before the onset of clinical symptoms. The early prominence of the astrocytic plaques in relation to sparse neuronal lesions leads one to speculate that corticobasal degeneration may begin as an astrogliopathy at a very early disease stage but neuronal lesions gradually take over as the predominant lesion type in advanced disease.

Aim Accumulating literature indicates that late acute rejection (LAR) after kidney transplantation portends an unfavorable prognosis. There is no data on the incidence of LAR in Asian subjects, nor its risk factors and associated clinical outcomes. Methods We conducted a retrospective single-centre case-control study to investigate the incidence, risk factors and prognosis of LAR in Chinese kidney transplant recipients. Subjects with or without LAR were matched for age, gender, era of transplantation, allograft type, and maintenance immunosuppression regimen. Results Thirty-two episodes of LAR occurred within an observation period of 12 years giving an incidence rate of 0.46 episodes per 1000 patient-years. Acute rejection within the first year after transplantation was associated with an increased risk of LAR (OR 3.59, p = 0.041). In patients receiving maintenance immunosuppression regimen with steroid, cyclosporin A (CsA) and mycophenolate or an m-TOR inhibitor, patients with LAR showed lower trough CsA levels prior to and at the time of rejection compared to Controls (86.0 ± 26.1 vs. 105.6 ± 13.3ug/l, p = 0.049; and 75.7 ± 35.7 vs. 106.0 ± 20.5ug/l, p = 0.032, respectively). Trough CsA level below 80ug/l was associated with the development of LAR (OR 10.82, p = 0.032). Patients with LAR showed an inferior allograft survival (p

Studies evaluating the role of transbronchial lung biopsy (TBLB) in diagnosing pulmonary tuberculosis (PTB) date back decades and have shaped current practice. However, with the recent advent of bronchoalveolar lavage (BAL) Xpert® MTB/RIF, it is time to re-evaluate the role of TBLB.To assess the impact of BAL and TBLB with the addition of BAL Xpert on diagnostic PTB yields and time to treatment initiation in sputum-scarce or acid-fast bacilli (AFB) smear-negative PTB patients.We retrospectively reviewed all sputum-scarce or AFB smear-negative patients who underwent both BAL and TBLB for suspected PTB between March 2011 and October 2013. Xpert was performed on all BAL specimens.Of 158 patients included in our analysis, 44 were culture-proven PTB. Ninety-four per cent of the patients had AFB smear-negative BAL samples. The sensitivity and specificity of Xpert in AFB smear-negative BAL samples were respectively 60% and 98%. The addition of BAL Xpert expedited the institution of PTB treatment while having diagnostic yields comparable to those of conventional BAL with TBLB.The use of BAL Xpert may obviate the need for TBLB in increasing the diagnostic yield of PTB in sputum-scarce or AFB smear-negative patients.

In this article, we first present a summary of the general assumptions about Down syndrome (DS) still to be found in the literature. We go on to show how new research has modified these assumptions, pointing to a wide range of individual differences at every level of description. We argue that, in the context of significant increases in DS life expectancy, a focus on individual differences in trisomy 21 at all levels—genetic, cellular, neural, cognitive, behavioral, and environmental—constitutes one of the best approaches for understanding genotype/phenotype relations in DS and for exploring risk and protective factors for Alzheimer’s disease in this high-risk population. Published version

To the Editor: Primary immunodeficiencies are a highly heterogeneous group of genetic disorders caused by Mendelian mutations in more than 150 immune-related genes1. Primary immunodeficiencies manifest as severe and/or disseminated recurrent infections and may also have autoimmune manifestations. We studied a female patient P1 of Pakistani origin who presented at the age of 4 years with a generalized lymphadenopathy, splenomegaly, neutropenia (0.05-0.28 ×109/L) and thrombocytopenia (platelet counts 20-40 ×109/L). A lymph node biopsy showed reactive changes, bone marrow aspirate was unremarkable and anti-neutrophil antibodies were present. She also had chronic diarrhea associated with an autoimmune enteropathy, characterized by duodenal villous atrophy and large bowel lymphocytic infiltration on biopsy. Her initial immunology work up revealed only raised IgG levels (22.6 g/L), raised inflammatory markers and a low number of NK cells (0.00-0.02). Lymphocyte subsets, double negative T-cells, T-cell proliferation assays, IgA (1.33 g/L), IgM (1.43 g/L), tetanus vaccine responses and a nitroblue tetrazolium (NBT) test were normal (Table 1). P1 had no significant history of infections except for a psoas abscess associated with chronic neutropenia. Over time she manifested growth failure and developed new autoimmune features including an episode of erythema nodosum, transient arthritis of both feet and recurrent haemolytic anaemia. As a result, she received several courses of steroids, rituximab (with prophylactic immunoglobulin replacement) and mycophenolate mofetil. Five years after initial presentation, following multiple courses of rituximab, she developed recurrent infections (Streptococcus pneumoniae facial cellulitis, Streptococcus pneumoniae sepsis and Haemophilus influenzae empyema) after withdrawal of immunoglobulin therapy. Although both her CD19+ B-cells and IgG level were normal, further investigation revealed a new-onset antibody deficiency with absent vaccine responses (Table 1). Due to further chest symptoms, despite recommencing immunoglobulin replacement, a chest CT scan was performed that showed extensive lung infiltration. Lung biopsy showed a florid diffuse lymphoid interstitial infiltrate consisting of a mixture of CD3+ T and CD20+ B cells, with scattered lymphoid follicles particularly around airways. No granulomata were seen and stains for bacteria, fungi and mycobacteria, as well as in-situ hybridisation for EBV, were negative. Table 1 Serial immunology assessments Patient P1 was born to a consanguineous marriage of first cousins. Therefore, we hypothesized that her disease is caused by a homozygous mutation. To identify the causative mutation we used exome sequencing. Patient’s blood sample was obtained with informed consent from the parents in accordance with the Declaration of Helsinki and with approval from the ethics committees (04/Q0501/119 and 06/Q0508/16). Library preparation, exome capture and sequencing have been done according to the manufacturers instructions. For exome target enrichment the Agilent SureSelect 38 Mb kit was used. Sequencing was done using Illumina HiSeq with 94 bp paired-end reads. In the exome data we found 17,280 single nucleotide variants and small insertions/deletions, including 424 very rare ones, i.e. those not seen in the 1000 Genomes database (May 2011 data release). However, we found no homozygous loss-of-function mutations. To identify larger deletions and duplications we used a new software tool, ExomeDepth2 (available to download at http://cran.r-project.org/web/packages/ExomeDepth/index.html). We found a large homozygous deletion that removed exons 1 to 30 of the 58-exon LPS-responsive vesicle trafficking, beach and anchor containing (LRBA) gene (Figure 1A). This deletion is novel and not present in the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation/). We validated it using a custom comparative genomic hybridization (CGH) array containing 270 probes in a 288 kb region defined around the LRBA gene (Figure 1B). We then sequenced the exact boundaries of this 252,396-nucleotide deletion (chr4: 151,748,856 - 152,001,251; Figure 1C). Figure 1 Homozygous deletion in the LRBA gene region We established an EBV-transformed B cell line of the patient and studied LRBA expression. We stimulated cells with 0, 1, 10 or 100 ng/ml of LPS for 16 hours. Then we extracted RNA, generated cDNA and amplified a part of the LRBA gene using primers 5′GCAGAAGTCATGCTTGGACA3′ and 5′TTTCGAAGTAGGGTCGCAAT3′. An expected 218 bp product from the LRBA exons 19-21 was present in control, but not in patient P1 (Figure 2A). From the LPS-stimulated cells we also extracted proteins and separated them using SDS PAGE. For Western blotting we used anti-LRBA (Sigma HPA019366) and anti-actin antibodies. We found the LRBA protein with the expected mass of approximately 319 kDa in control cells, but not in cells of patient P1 (Figure 2B). We also used immunofluorescence analysis and again found that LRBA protein is expressed in the cytoplasm of cells from a healthy control, but not from patient P1 (Figure 2C).. Figure 2 LRBA mRNA and protein are expressed in the EBV-transformed B cell line from a healthy control, but are absent in patient P1 The LRBA gene encodes a large broadly expressed protein of unknown function that is involved in intracellular vesicle trafficking3. Recently Lopez-Herrera et al. reported five patients with different homozygous mutations in the LRBA gene that also abolished its expression4. These patients had idiopathic thrombocytopenic purpura, lymphoid interstitial pneumonia and autoimmune enteropathy, as well as hypogammaglobulinemia. Reduced levels of IgG and IgA were found in all five patients and reduced IgM was recorded in four of those. Accordingly, all five patients have been diagnosed with childhood-onset common variable immunodeficiency (CVID). Patient P1 that we report here had many similar clinical features. However, hypogammaglobulinemia was not seen at presentation but occurred as a later event, and may have been secondary to rituximab therapy, as has previously been described5. Thus, our results show that deficiency caused by mutations in the LRBA gene may initially present as an autoimmune syndrome without CVID. Therefore, a possibility of LRBA gene mutations should be considered for a broad spectrum of patients with primary immunodeficiencies and autoimmunity.

We investigated the long-term outcome of patients with proliferative LN treated with CSs and MMF.This was a single-centre retrospective study on patients with biopsy-proven class III/IV ± V LN treated with prednisolone and MMF continuously as both early and maintenance immunosuppression.Sixty-five patients were included, and followed for 91.9 (47.7) months. All received prednisolone and MMF as induction immunosuppression. In 31 patients, maintenance immunosuppression comprised prednisolone and MMF only (MMF-MMF group). MMF was replaced with AZA in 23 patients (MMF-AZA), and with calcineurin inhibitors (CNIs) in 11 patients (MMF-CNI) at sometime during follow-up. Ten-year patient and renal survival rates were 91% and 86%, respectively, and were similar in the three groups. MMF-MMF group showed better relapse-free survival than MMF-AZA and MMF-CNI patients (76% vs 56% vs 43%, respectively at 5 years; 69% vs 32% vs 0%, respectively at 10 years; MMF-MMF vs MMF-AZA or MMF-CNI, P = 0.049 or 0.019, respectively; MMF-AZA vs MMF-CNI, P = 0.490). Patients treated with MMF for24 months had better relapse-free survival than those treated for shorter durations (88% vs 48% at 5 years; 81% vs 28% at 10 years; P0.001). Renal function at 10 years was better in the MMF-MMF group. Anaemia was associated with MMF treatment. Other adverse events were comparable and relatively minor with MMF, AZA or CNI as maintenance.Long-term treatment with CSs and MMF from induction to maintenance phase is associated with relatively favourable long-term outcome in Chinese LN patients. Discontinuation of MMF before 24 months may increase the risk of flares.

Vitamin D deficiency is common globally. There is evidence that vitamin D status may be related to immune function and cardiovascular disease. The vitamin D status of Chinese kidney transplant recipients has never been investigated. We performed a cross-sectional study and measured the level of 25-hydroxyvitamin D [25(OH)D] in 94 Chinese renal transplant recipients with stable allograft function. Vitamin D deficiency and insufficiency were detected in 43.6% and 54.2% of patients, respectively. About 53.2% of the patients also had elevated parathyroid hormone (PTH) levels. The level of 25(OH)D was lower in kidney transplant recipients compared with healthy controls matched for age and sex (52.5 ± 15.6 nmol/L vs. 57.5 ± 19.0 nmol/L, p = 0.05), but the level of serum creatinine was higher in kidney transplant recipients (120.3 ± 48.5 μmol/L and 78.3 ± 15.3 μmol/L, p 0.01). The level of 25(OH)D was negatively correlated with that of PTH (p = 0.001). The latter was associated with serum creatinine (p = 0.001) and duration of dialysis (p = 0.001). Patients with a history of acute rejection showed lower levels of 25(OH)D (45.3 ± 11.9 nmol/L vs. 54.2 ± 16.0 nmol/L, p = 0.003). We conclude that vitamin D deficiency is prevalent among Chinese renal transplant recipients. In view of the potential immunomodulatory effect of vitamin D, the relationship between vitamin D level and rejection and the effect of vitamin D supplementation in renal transplant recipients warrant further investigations.