Search

Allogeneic hematopoietic stem cell transplantation (HSCT) can cure transfusion-dependent thalassemia (TDT). In a multicenter trial, we investigated the efficacy of reduced intensity conditioning (RIC) before unrelated donor (URD) HSCT in children with TDT. Thirty-three children (1–17 years), received marrow or cord blood (UCB) allografts. Median time to neutrophil engraftment was 13 (range, 10–25) and 24 (range, 18–49) days; platelet engraftment was 23 (range, 12–46) and 50 (range, 31–234) days after marrow and UCB respectively. With median follow-up of 58 (range, 7–79) months, overall and thalassemia-free survival was 82% (95% CI, 0.64–0.92) and 79% (95% CI, 0.6–0.9) respectively. The cumulative incidence (CI) of grade II–IV acute graft-versus-host disease (GVHD) after marrow and UCB was 24% and 44%; the 2-year CI of chronic extensive GVHD was 29% and 21% respectively; 71% (marrow) and 91% (UCB) recipients discontinued systemic immunosuppression by 2 years. Six patients who had Pesaro risk class 2 (N=5) and class 3 (N=1) died of GVHD (N=3), viral pneumonitis (N=2) and pulmonary hemorrhage (N=1). Outcomes following this RIC compared favorably with URD HSCT outcomes for TDT and supported engraftment in 32 of 33 patients. Efforts to reduce GVHD and infectious complications are being pursued further.

Iron overload (IOL) is highly prevalent among patients with hemoglobinopathies; both transfusion dependent thalassemia (TDT) and non-transfusion dependent thalassemia (NTDT). Whether IOL is secondary to regular transfusions like in TDT, or develops from increased intestinal absorption like in NTDT, it can cause significant morbidity and mortality. In TDT patients, iron accumulation in organ tissues is highly evident, and leads to organ toxicity and dysfunction. IOL in NTDT patients is cumulative with advancing age, and concern with secondary morbidity starts beyond the age of 10 years, as shown by the OPTIMAL CARE study. Several modalities are available for the diagnosis and monitoring of IOL. Serum ferritin (SF) assessment is widely available and heavily relied on in resource-poor countries. Non-invasive iron monitoring using MRI has become the gold standard to diagnose IOL. Three iron chelators are currently available for the treatment of IOL: deferoxamine (DFO) in subcutaneous or intravenous injection, oral deferiprone (DFP) in tablet or solution form, and oral deferasirox (DFX) in dispersible tablet (DT) and film-coated tablet (FCT). Today, the goal of ICT is to maintain safe levels of body iron at all times. Appropriate tailoring ICT with chelator choices and dose adjustment must be implemented in a timely manner. Clinical decision to initiate, adjust and stop ICT is based on SF, MRI-LIC and cardiac T2*. In this article, we review the mechanism of IOL in both TDT and NTDT, the pathophysiology behind it, its complications, and the different ways to assess and quantify it. We will also discuss the different ICT modalities available, and the emergence of novel therapies.

Although the improvements in the treatment and management of thalassemia patients in new years lead to the improved survival and quality of life (QOL) in this group of patients, QOL is still is an important dimension of care in thalassemic patients. WHO defines QOL as “an individual’s perception of their position in life in the context of the culture and value systems in which they live and in relation to their goals, expectations, standards, and concerns”. Thalassemia is a chronic disease needs life-long care with multiple physical, mental and social complications that affect QOL in patients. The most important factors which affect QOL in thalassemia are: effects of the disease on family, skeletal and face changes, frequent blood transfusion and drug infusion, sexual impairment and infertility, heart and liver disease as well as endocrine disorders, anxiety and low life expectancy.

Early detection of iron overload cardiomyopathy is an important strategy in decreasing the mortality rate of patients with transfusion dependent thalassemia (TDT). Although cardiac magnetic resonance (CMR) T2* is effective in detecting cardiac iron deposition, it is costly and not generally available. We investigated whether heart rate variability (HRV) can be used as a screening method of iron overload cardiomyopathy in TDT patients. HRV, evaluated by 24-hour Holter monitoring, non-transferrin bound iron (NTBI), serum ferritin, left ventricular ejection fraction (LVEF), and CMR-T2* were determined. Patients with a cardiac iron overload condition had a significantly higher LF/HF ratio than patients without a cardiac iron overload condition. Log-serum ferritin (r = -0.41, p = 0.008), serum NTBI (r = -0.313, p = 0.029) and low frequency/high frequency (LF/HF) ratio (r = -0.286, p = 0.043) showed a significant correlation with CMR-T2*, however only the LF/HF ratio was also significantly correlated with LVEF (r = -0.264, p = 0.043). These significant correlations between HRV and CMR-T2* and LVEF in TDT confirmed the beneficial role of HRV as a potential early screening tool of cardiac iron overload in thalassemia patients, especially in a medical center in which CMR T2* is not available. A larger number of TDT patients with cardiac iron overload are needed to confirm this finding.

We conducted a prospective, phase II, multicenter, single-arm study to evaluate the efficacy and safety of deferasirox in patients age >2 to 1000 mu g/L; cardiac MRI T2* = 5 mg/g). Patients received deferasirox at an initial dose of 10 mg/kg/day, with up-titration to a maximum of 20 mg/kg/day. The study continued for 52 weeks and included a total of 27 patients (mean age, 9.1 +/- 3.8 years; 70.4% male). One patient (3.7%) was lost to follow-up. The majority of patients (n = 20; 74.1%) were able to achieve the intended dose of 20 mg/kg/day. No deaths occurred. A total of 134 adverse events (AEs) were reported in 25 patients (92.6%) during the study. The majority of patients had grade 1 or 2 AEs, with only 8 patients (29.6%) experiencing grade 3 AEs. Only 10 AEs occurring in 4 patients (14.8%) were suspected to be related to deferasirox (ALT/AST increase, n = 4; urinary tract infection, n = 1). The deferasirox dose had to be adjusted or interrupted for 6 AEs occurring in 4 patients (14.8%). A total of 6 serious AEs occurred in 3 patients (11.1%), none of which were suspected to be related to deferasirox. From baseline to week 52, there were decreases in median concentrations of alanine aminotransferase (ALT), from 30.0 to 17.0 IU/L, and aspartate aminotransferase (AST), from 35.5 to 26.0 IU/L. Median serum creatinine and cystatin C concentrations were similar at baseline and week 52. There was a continuous and significant decrease in median serum ferritin level from 1718.0 mu g/L at baseline to 845.3 mu g/L following 52 weeks of therapy (P

Transfusional iron overload is a major target in the care of patients with transfusion-dependent thalassemia (TDT) and other refractory anemias. Iron accumulates in the liver, heart, and endocrine organs leading to a wide array of complications. In this review, we summarize the characteristics of the approved iron chelators, deferoxamine, deferiprone, and deferasirox, and the evidence behind the use of each, as monotherapy or as part of combination therapy. We also review the different guidelines on iron chelation in TDT. This review also discusses future prospects and directions in the treatment of transfusional iron overload in TDT whether through innovation in chelation or other therapies, such as novel agents that improve transfusion dependence.

Background: Beta Thalassemia major is most common monogenic disorder in the world.. Transfusion dependent thalassemia major patients are at risk of iron overload and hence its associated complications. Thalassemia is a major sanitary problem not only for the patients and their families but also for each country’s public health systems with regard to treatment expenses including regular injections, iron chelating agents, frequent hospitalizations and other medical consistencies and they are vulnerable to, social and psychological problems. Objectives: To determine prevalence and severity of depression in transfusion dependent Beta thalassemia major patients attending a tertiary care hospital. Materials and Methods: The study was done in a tertiary care hospital. Thalassemia major patients who received blood transfusions for 2 to 4 weeks interval in the hospital were included in this study. Clinical assessment of each child was done and psychiatric illness was diagnosed using ICD-10 DCR. Hamilton Depression rating scale (HAM-D) were used. Result: Males (80%) outnumbered females (20%) with male to female ratio of 4:1. Nearly half of the study population was aged between 10 to 12 years. Majority of the patients had one blood transfusion per month (91.43%). Out of 31 patients, 25 were males and 6 were females. Age range was 10 -18 years with mean age of 12.45 ± 2.41 years. The prevalence of depression was 41.94 % with majority showing mild depression. Conclusion: This study helps to know the severity of the depression in β thalassemia patients who are chronically ill and have prolonged treatment. Early assessment and treatment by psychiatrist will surely help to have good psychological condition.

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α3.7/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Introduction: An assessment of morbidity and mortality caused by transfusion dependent thalassemia in India has never really been done despite thalassemia being the most prevalent life threatening non-communicable disorder of childhood. There is little structured understanding identifying the key risk factors feeding into research and policy making for effective management of thalassemia. With an estimated 10,000-12,000 children born with thalassemia each year in India, in addition to increasing focus on early pregnancy targeted screening, it seems critical to increase our understanding of risk factors associated with early mortality and morbidity. This is also relevant to family counselling about management options. Methodology: A retrospective analysis of mortality key risk factors in patients suffering from thalassemia major from 5 thalassemia day care centres in India was carried out. This included a total of 1,087 patients (656 males and 431 females with a median age of 8.6 years) enrolled for care between 1 Jan 2010 - 31 Oct 2018 at these centres. These centres were set up by a non-profit organization in collaboration with blood banks and /hospital facilities with the objective to provide comprehensive thalassemia care; A common web-based application was employed (ThalCare™). This system was used to track information associated with treatment including disease history at enrolment, demographic data and follow-up information. All analyses were performed with R Statistical software (3.5.2). Survival analysis was done from the age at presentation to the centre till October 2018. The reasons for mortality were categorized. Overall survival was also separately analyzed for patients in their 1st,2nd, 3rd or subsequent decades of life. The Cnaan and Ryan approach was used as patients entered and left the study cohort (left censored and right truncated data) and observation began only at enrolment and not at disease onset Results: The median age at enrolment was 5.4 years and the median follow up at the centre was 2.5 years. A total of 86 patients were cured by bone marrow transplantation (BMT), 13 of them moved to other centres for care and 41 patients died during the study period (28 males and 13 females). The median age at death was 15.4 years. Actuarial survival at 26.9 years of age was 50% (Figure 1) and under-five mortality was 7 times higher than the general population. Patients with transfusion-transmitted infections (TTI) had 3.4 times higher risk of death (p=0.031). Serum ferritin >4,000 ng/dL was associated with 4.6 times higher risk of mortality compared to ferritin 2 gm/dL/week had 7.7 times higher mortality risk compared to 2 gm/week (hazard ratio 5.58 ,p=0.0007) and lack of attention towards care for possible prevention from TTI (hazard ratio 2.86, p=0.0004) are factors independently associated with high mortality. Table 2 shows that in patients born after the year 2,000 overall survival is 85.2% compared to 29.4% for patients born earlier. Main causes of death were infection, iron overload, TTIs, and alloimmunization; In a quarter of patients the cause of death was unknown (Figure 2). Patients who received more than 4 years of adequate care had more than 66% mortality risk reduction (p Conclusion: Comprehensive care right from an early age at dedicated management centres is key to improving life expectancy of thalassemia patients in India. Optimizing blood transfusion, intensifying chelation and preventing TTIs seem particularly important. Sustained efforts in these areas coupled with increased prevention and access to safe BMT will ease the burden for both families and public healthcare. Disclosures No relevant conflicts of interest to declare.

To test the postulated hypothesis that splenectomy may influence the development of Hypothyroisdism (HT) in Transfused Dependent Thalassemia (TDT) young patients, basic factors known to influence the development of hypothyroidism were evaluated in 52 TDT adult patients (25 splenectomized) with HT. Precise analysis of data not only failed to disclose any statistical differences but revealed similarities, between splenectomized and non- splenectomized patients in respect to: i) the age at diagnosis of HT and ii)the ferritin levels on diagnosis and at the year of study. Interestingly a statistically higher age at diagnosis was recorded in central HT irrespective of splenectomy.

Iron overload is a major complication in transfusion-dependent thalassemia (TDT) patients. Chronic oxidative stress from iron overload may lead to cellular damage and viability. This is a cross-sectional study. Transfusion-dependent thalassemia patients aged ⩾18 years old were enrolled. Transfusion-dependent thalassemia patient’s serum and normal volunteer’s serum were separately incubated with healthy peripheral blood mononuclear cells (PBMCs). The cell viability was measured by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay at 24, 48, and 72 hours. Sixty-nine TDT patients and 22 healthy controls were enrolled. The mean of PBMCs viability after incubation with serum from TDT patients was lower than that with the controls (88.65% vs 103.56% at 24 hours, 78.77% vs 112.04%% at 48 hours, and 71.18% vs 132.16%% at 72 hours, respectively). High serum ferritin level (correlation −0.29, P

BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004.

BACKGROUND AND OBJECTIVES MRI-R2* has been accepted as a clinical tool for monitoring iron overload in thalassemia patients, especially for monitoring liver iron concentration (LIC). the most optimal and practical method of analysis however, is still open to further investigations. our objective was to investigate intra- and intersite observer variability of the pixel-wise method for liver R2* analysis in thalassemia patients using a mono-exponential with a constant offset model. PATIENTS AND METHODS We performed 88 liver R2* measurements on 72 thalassemia major patients. a single breath-hold multi-echo gradient-echo sequence was acquired and analyzed at both the reference (REF) and local (LoC) sites. the analysis defined the region of interest in the whole liver parenchyma, excluding the great vessels, and were reported as median values. RESULTS The R2* values from the REF and LOC were statistically comparable for all comparisons. the intrasite and intersite observer variation were 0.75% (less than 0.9%) and 2.5%, respectively, both of which are comparable to previous reports, but substantially lower than conventional region-based approaches. CONCLUSION The low variation of the R2* also yielded excellent variation in the tabulated hepatic iron content. however, caution is required when comparing the results to different implementation methods and appropriate evaluation and validation of methodology for any new scan site is essential before its clinical use.

Introduction One of the treatment modalities in transfusion dependent thalassemia (TDT) patient is splenectomy which aims to ameliorate red cell transfusion. However, not all thalassemia patients respond to splenectomy. Moreover, splenectomy may increase many unfavorable consequences. The study about the efficacy and complications after splenectomy is limited and the effect of splenectomy on iron overload is still unclear. This study aims to investigate the long-term efficacy of splenectomy, factor predicting a response to splenectomy, the consequences of splenectomy complications, CBC parameter changes and the effect on iron overload parameters after splenectomy. Methods All TDT patients (PRC transfusion ≥3 units/year), aged >15 years who had splenectomy were recruited from our hematology division data base. Clinical characteristics including age, sex, age at splenectomy, operation date, hemoglobin (Hb) typing were collected. PRC transfusion requirement (unit/year) and CBC were collected 1 year before splenectomy, 1 year and 5 year post splenectomy. In the complication cohort, TDT patients with intact spleen were recruited into control group. The sample size was calculated that at least 33 patients (66.6% from splenectomy group and 33.3% from non-splenectomy group) needed to be recruited to have 80% power to detect a difference in complication at an alpha level of 0.05. The diagnosis of pulmonary hypertension (PHT) was based on the echocardiogram performed by the cardiologist and using definition from the 2015 ESC guideline. The thrombosis events were collected from medical record. The iron overload was compared by serum ferritin, liver iron concentration (LIC) and cardiac iron concentration were assessed by MRI of liver and cardiac T2*. The associated factors of efficacy and complication for splenectomy were compared using Chi-squared test or Fisher exact test for categorical variables and T-test or Mann-Whitney test and repeated measure mixed model for continuous variables. Multivariate regression analysis was used to identify relationships between variables with the level of significance was defined as P value Results Fifty TDT patients were included from the data base. In term of splenectomy efficacy, 21 patients (42%) has been changed from TDT to non-transfusion dependent thalassemia (NTDT) patients after splenectomy and 25 patients (50%) had 50% reduction in PRC transfusion. The significant factors associated with changing from TDT to NTDT were genotype of thalassemia (P=0.001). HbH disease and beta thalassemia/HbE (β/E) patients were the group who had higher response (28.57% and 52.38%, respectively) compared to HbH with CS (9.52%) and homozygous beta-thalassemia (9.51%). Lower percentage of neutrophils (10 year old) was associated with higher response after splenectomy (P = 0.005). CBC before splenectomy, 1 and 5 years after splenectomy were compared. Mean Hb level was increased from 6.0 to 8.2 and 7.7 g/dL (P Sixty-four patients were included in the complication cohort, (44 patients in splenectomy group and 20 patients in non-splenectomy group). The baseline characteristics including age, sex, Hb, ferritin were similar between 2 groups. The splenectomy group had significant higher tricuspid valve regurgitation velocity (TRV) compared to non-splenectomy group (2.54 m/s vs. 2.31 m/s, P=0.029). The prevalence of PHT and thrombosis were higher in splenectomy group (27.3% vs. 15% and 9.1% vs. 0%, respectively). Serum ferritin, LIC and cardiac T2* were not different between the 2 groups. From multivariable analysis, the only significant factor for predicting PHT was the longer duration after splenectomy (p=0.045). Conclusion Splenectomy had benefit in some TDT patients. Factors that predict a higher response to splenectomy were thalassemia type (HbH and β/E), higher neutrophil percentage and older age at the time at splenectomy. Hb and platelet was significantly increased after splenectomy. In term of complication, splenectomy group had significant higher TRV and tended to have more prevalence of PHT and thrombosis. The longer time post splenectomy was the only significant factor for developing PHT. Disclosures No relevant conflicts of interest to declare.

Congestive heart failure is the most common cause of death in patients with thalassemia, as chronic accumulation of iron due to regular blood transfusions leads to biventricular systolic dysfunction and death at a very young age. The quantity of iron deposited in the heart is a key determinant of outcome. Early diagnosis and intensive chelation of the cardiac iron can avert heart failure and its fatal outcome.

Hemoglobin is a protein that plays an important role in the structure and the stability of red blood cells. Hemoglobin is also important for carrying oxygen throughout the body. Thalassemia is a ch...

Results Three groups of patients were identified: 27 patients (13 females, mean age 40.12±10.31 years) treated with desferioxamine (DFO mean dosage 37.52±8.69 mg/kg/ die), 23 patients (14 females, mean age 34.73±10.67 years) treated with deferiprone (DFPdosage 71.70 ±14.46mg/kg/die) and 14 patients (9 females, mean age 36.63±10.92 years) treated with deferasirox (DFX mean dosage 27.75±5.04 mg/kg/die). Excellent/good levels of compliance were similar in the DFO (92.6%), DFP (100%) and DFX (100%) groups (P=0.345). The mean starting age of regular transfusion was 14.73 ±15.89 years. At baseline in DFO group two patients (7.4%) showed a global heart T2*

The thalassemias are a heterogeneous group of inherited hypochromic anemias of varying severity. The mainstay of supportive treatment is regular blood transfusion accompanied by iron-chelating therapy. Hematopoietic stem cell transplantation (HSCT) provides an alternative option when curative therapy is considered. More than 400 patients in Taiwan have beta-thalassemia major or other transfusion-dependent thalassemias, and their treatment costs account for a considerable percentage of the National Health Insurance expenditure. In this report, we estimated the treatment costs of conventional therapy (regular blood transfusion accompanied by iron-chelating agents) and HSCT. The undiscounted medical cost of 20 years of follow-up (20 years from diagnosis) and the undiscounted total lifetime cost were NT$ 4 739 888 (NT$ means New Taiwan Dollars)/US$ 149 288 and NT$ 11 529 990/US$ 363 149, respectively, for patients undergoing conventional therapy, and NT$ 2 639 982/US$ 83 149 and NT$ 3 511 172/US$ 110 588, respectively, for those undergoing successful HSCT. Comparisons of treatment costs and other parameters between these two modalities can add to the information base on which policy is made by health authorities or clinicians.

Needle-induced trauma is one of the major contributing factors for poor compliance in patients with thalassaemia major on iron chelation therapy. A new generation of needles is currently available on the market, but their theoretical advantages have not been tested clinically. We performed a study to compare the pros and cons of the representative prototypes from each of the new (Thalaset needle) and old (butterfly scalp vein needle) generations of needles. Patients with thalassemia major who had been receiving subcutaneous iron chelation therapy for at least 2 years were recruited. Patients using butterfly needles were instructed to switch to the newer form of needle (Thalaset) for 2.5 months and then to change back to butterfly needles for another 2.5 months. Comparison was done by the intrapersonal cross-over model using three identical sets of questionnaires collected at the beginning of the study and after the use of Thalaset and butterfly needles, respectively. Fifty-four (22 females; 32 males) patients were included in the statistical analysis. The median age was 24.1 years (range = 7.6-47.2 years). Local reactions such as pain, itchiness, tenderness, and swelling were significantly different among the three evaluation periods and were all in favor of the Thalaset needle (all with P < 0.001), even after adjusting for the intention-to-treat calculation. The Thalaset needle is significantly better than the butterfly needle in reducing needle-related trauma. It induced fewer local skin reactions such as pain, itchiness, tenderness, and swelling. However, recommendations for its routine clinical use require further cost-effectiveness analysis.

Background: Early detection of iron overload cardiomyopathy is an important strategy to decrease the mortality rate of patients with transfusion dependent thalassemia (TDT). Although cardiac magnetic resonance (CMR) T2* is effective in detecting cardiac iron deposition, it is costly and not

BACKGROUND Transfusion dependent thalassemia (TDT) patients is a group of thalassemia patients who require regular blood transfusion. Red blood cell transfusion and increased intestinal iron absorption leads to iron overload. The cellular damage associated with iron overload is mainly mediated by the state of oxidative stress and the effect of free oxygen radicals on various cell components. Telomeres are terminal protein-DNA complexes that stabilize chromosome and prevent DNA from double-stranded breaks. Chronic oxidative stress from iron overload and ineffective erythropoiesis in thalassemia may lead to shortening of telomere length. METHOD We conducted a cross-sectional study in TDT patients aged more than 18 years old who attended the adult hematology clinic at Maharaj Nakorn Chiang Mai hospital, Chiang Mai University, Thailand from 1 January 2016 to 30 April 2016. TDT was defined as thalassemia who requiring a red cell transfusion at least 3 times per year, included both beta-thalassemia and alpha-thalassemia patients. Telomere length was measured by real-time quantitative PCR and compared with matched healthy controls by age and sex. We used Pearson's correlation coefficient to test whether telomere length was associated with any factors. The threshold for statistical significance for all comparisons was chosen as P RESULT Thirty TDT patients and 30 matched healthy control were included in this study. For TDT group, there were 19 female patients (63.3%). The median age was 29.2 (18-48) years. Baseline hemoglobin pre-transfusion 6.4 g/dL (5.3-7.4). Of these, there were 18 beta-thalassemia/Hb E disease (60%) who was the majority population. There were 11 beta-thalassemia major patients (36.4%) and 1 HbH with Constant spring patient (3.3%). The median telomeric terminal restriction fragment (TRF) length of TDT thalassemia group was 5.76 (4.94-7.13) kb. The median TRF length of control group was 6.79 (5.52-9.02) kb. TDT patients had significant shorter TRF length compared to control group (age and sex match), (p CONCLUSION TDT patients had shorter telomere length compared to control group. Telomere shortening in TDT thalassemia is aging-dependent process. Chronic oxidative stress from iron overload and ineffective erythropoiesis in thalassemia may play the significant role in this accelerated telomere shortening process. Table The median telomeric terminal restriction fragment length of TDT patients compared with control group Table. The median telomeric terminal restriction fragment length of TDT patients compared with control group Disclosures No relevant conflicts of interest to declare.

Introduction: Although routine tissue iron monitoring using magnetic resonance imaging (MRI) has become a standard clinical management of both transfusion dependent and non-transfusion dependent thalassemias (TDT & NTDT) in several developed countries since this module can provide a better organ-directed iron measurement and related to clinical outcome including morbidity and mortality secondary to iron overload (IOL). However, accessibility of this monitoring remains limited in several developing countries including Thailand, where thalassemia and hemoglobinopathies are highly prevalent. Earlier in 2016, we have demonstrated that although not so perfectly crafted, a cross-sectional measurement of serum ferritin (SF) can be used for determination of IOL as a predictive marker; in NTDT, MRI for liver iron concentration (LIC) should be performed in those with SF >300 ug/L and for TDT, the SF cut off of >2,500 and >3,500 ug/L are useful to predict patients with severe LIC (>15 mgFe/g dw) and cardiac siderosis (T2*< 20 ms) (Ekwattanakit S. et.al., EHA 2016). In this study, we performed a further analysis to evaluate whether a serial measurement of SF and its trend can provide a better prediction. Objectives: To evaluate the clinical utility of serial SF trend compared with a cross-sectional SF cut-off for early detection of IOL in a real-life practice in thalassemic patients in order to select the most vulnerable patients for further MRI evaluation in a resource limited setting. Methods: In this prospective study, total 968 standard MRI for LIC and cardiac T2*were performed at Siriraj hospital during 2009-2014 and paired clinical data including serial SF measurements were collected from 301 thalassemia patients; NTDT (N=76; 109 LIC and 95 cardiac T2* results) and TDT (N=155; 478 LIC and 474 cardiac T2*). In addition, 71 patients were NTDT with regular blood transfusion later on in their life, mainly Hb E/β thalassemia (218 LIC and 210 cardiac T2*). These patients were evaluated for IOL using SF every 4-12 weeks during their follow up. Median follow up time was 96 months. Receiver operating characteristic (ROC) analysis was performed using different SF cut-off levels (1000, 1500 and 2000ug/L) and percentage of serial SF measurements that above each these cut-off levels (50 and 75%) during different durations before MRI (1, 2, or 3 years priori) for predicting liver IOL (LIC >5 in NTDT and severe liver siderosis; LIC > 15 mgFe/g dw) and cardiac IOL (T2* Results: Baseline characteristics were shown in Table1. In NTDT, using ROC analysis, SF >1000 ug/L over 75% of serial measurements in 1-year period prior to MRI can predict LIC > 5 mgFe/g dw with the AUC of 0.59 with PPV 86.7% and NPV 51.1% and serial SF >1500 ug/l over 50% of measurement in a year prior predict LIC >15 mgFe/g dw (AUC of 0.72, PPV 75% and NPV 89.7%). Only 1 NTDT had cardiac IO. These newly identified criteria do not provide a more sensitive predictor of LIC results than our previous SF cut-off. In TDT population, the majority of patients were HbE/β thal (78%) and cardiac iron overload was detected mainly in patients older than 15 yrs (81/83; 97.6%). The best predictor for LIC>15 mgFe/g dw was SF >2000 ug/L over 75% of serial measurement durations in 3-year period (AUC 0.778, PPV 50.8%, NPV 95.5%). However this cut-off during 1 year priori also provided a similar prediction (AUC 0.769, PPV 51%, NPV 93.6%). This cut-off value also provided the best prediction for cardiac T2* < 20 ms in all age group (AUC 0.754, PPV 31.5%, NPV 97.4%) and a higher sensitivity and specificity when it was applied in patients >15 yrs of age (AUC 0.764, PPV 41.9%, NPV 96.3%). In NTDT with regular transfusion, all cardiac IOL (N=19) occurred after 15 years of age and again the same criteria was the good predictive cut-off for cardiac IO (AUC 0.788, PPV 19%, NPV 100%) and severe LIC >15 mgFe/g dw (AUC 0.728, PPV 52.8%, NPV 87.3%). Conclusions: In a resource limited setting for MRI evaluation, a serial measurement of SF and its values in thalassemic patients who received regular blood transfusion above the cut-off of 2000 ug/L over 75% of measurement in one year priori could be used as a predictive marker for selecting the most vulnerable TDT for MRI evaluation since this criteria is strongly associated with severe liver (LIC > 15 mgFe/g dw) and cardiac siderosis (T2* Disclosures Siritanaratkul: Novartis: Research Funding; Jansen-Cilag: Research Funding; Roche: Research Funding; Pfizer: Research Funding. Wood:Celgene: Consultancy; AMAG: Consultancy; Ionis Pharmaceuticals: Consultancy; Ionis Pharmaceuticals: Consultancy; World Care Clinical: Consultancy; Biomed Informatics: Consultancy; Vifor: Consultancy; Apopharma: Consultancy; Biomed Informatics: Consultancy; Vifor: Consultancy; Apopharma: Consultancy; World Care Clinical: Consultancy; AMAG: Consultancy; Celgene: Consultancy. Viprakasit:Agios: Consultancy; Mersanger: Consultancy; Novartis: Consultancy, Honoraria, Research Funding, Speakers Bureau; Celgene Corporation: Consultancy, Research Funding; Faculty of Medicine, Siriraj Hospital, Mahidol University: Employment; Shire: Research Funding.

With around 7,500 β-thalassemia (β-thal) births in India annually, preventive measures such as pre marital counseling and prenatal diagnosis are needed to decrease the incidence of the disease in the country. The predominant mutant alleles vary from the Middle East through India to Sri Lanka, as well as in different regions within a state in India. In the present study, involving the characterization of mutations in the Gwalior-Chambal region of Central India, IVS-I-5 (G>C) was found to be the most common allele followed by Hb E [β26(B8)Glu→Lys, GAG>AAG]/β-thal accounting for 10.83% and 619 bp deletion for 7.5% of the alleles. The high frequency of Hb E/β-thal in this region of Central India, unlike earlier reports from studies carried out in the state of Madhya Pradesh (Central India), mandates a more focused region-wise identification of common mutant alleles rather than the state as a whole.

The survival of patients with thalassemia major has progressively improved with advances in therapy; however, osteoporosis remains a frequent, unresolved issue [1]. Adequate circulating levels of vitamin D are essential for optimal skeletal health and reducing fracture risk [2]. Vitamin D insufficiency is reported in the majority of patients with thalassemia in the USA [3] and elsewhere [4–10], despite routine prescription of 400–1,000 IU vitamin D per day. In this study, assessment of serum 25-hydroxy vitamin D (25-OH D) levels in 96 patients with thalassemia revealed that 70 (73%) were either deficient ( 80 ng/ml was observed over the course of the observation period. There were 18 individuals who attained a 25-OH D level >30 ng/ml at the end of their supplementation period and continued daily supplementation of 400–1,000 IU vitamin D thereafter. When retested at an average of 8 months (1–21 months) later, the serum 25-OH D had dropped significantly and collectively for all but two of them, from a mean of 34.4 ± 3.7 to 26.9 ± 6.8 ng/ml (P < 0.001). The rate of decline was on an average 1.5 ng/ml per month. Hence, patients who had inadequate vitamin D status on screening were likely to require ongoing high-dose supplementation. In contrast, the

Background: Thalassemia is a common hemoglobin disorder in Iran and one of the major public health problems. Although blood transfusions are lifesavers for thalassemia patients, they may be associated with some complications especially erythrocyte alloimmunization. The purpose of this study was to investigate the prevalence of red blood cell alloantibodies and to determine types of these antibodies among multiple-transfused thalassemic patients. Materials and Methods: A total of 313 thalassemia patients in the northeast of Iran, who received regular blood transfusion, were included in this study. Screening of antibodies was performed on fresh serum of all patients and then antibodies were identified in patients' serum that had positive antibody screening test using a panel of recognized blood group antigens. Results: We identified 12 alloantibodies in 9 patients (2.87%) that all were against Rhesus (Rh) blood group antigens (D, C, E). Three patients developed 2 antibodies, and others had one antibody. The most common alloantibodies were Anti-D (88.88%) and followed by Anti-C and Anti-E. Higher frequency of alloimmunization was observed in female, Rh negative and splenectomized patients. Conclusion: This study showed that evaluation of the packed cells for Rh (C, E) from the start of transfusion can be helpful in decreasing the rate of alloantibody synthesis.

Molecular defects responsible for 𝛽 -thalassemias (thal) were investigated among 254 chromosomes from 127 transfusion-dependent unrelated thalassemic patients from two provinces in Northern Iraq. Among fourteen identified mutations, the seven most common found in 88.2% of the thal chromosomes were: IVS-II-1 ( G → A ), IVS-I-1 ( G → A ), codon 8 ( − A A ), codon 39 ( G → T ), codon 8/9 ( + G ), codon 44 ( − C ), and codon 5 ( − C T ). There were some notable differences in frequencies of various mutations in comparison to other Eastern Mediterranean populations, as well as between the two provinces studied. The latter illustrates the relative heterogeneity of the mutations distribution in Iraq, and the need to screen other areas of the country, to ensure establishing an effective prenatal program.

Recent advances in magnetic resonance imaging (MRI) techniques allow the assessment of iron overload in tissues 1 especially the heart, 2 in transfusion-dependent thalassemia patients. The R2* value (1/T2*) recorded in the intraventricular septum of the heart indirectly measures the degree of cardiac iron load. Applying this new technology we looked at a number of historical and biochemical parameters in order to determine their relationship to cardiac iron overload and the effect of cardiac iron on functional and structural changes of the heart in transfusion-dependent thalassemics.