Search

Frequencies as high as 60% of overexpressed p16INK4 were recently reported in lichen planus (LP). Because p16INK4 overexpression may be a feature of human papilloma virus (HPV)–induced cancer, it has been postulated that LP may be somehow related to HPV. The present study is the first to evaluate both high p16INK4 expression and HPV in patients with LP. Study Design Thirty-five consecutive biopsy specimens from patients with LP constituted the basis of the present study. Level of p16INK4A expression was evaluated in each sample by immunohistochemical analysis, and the presence of HPV DNA was tested by real-time polymerase chain reaction (PCR). Results p16INK4 expression was detected in 26 specimens, whereas HPV was found in 4 lesions: 3 low-risk HPV and 1 high-risk HPV. All HPV-positive lesions also indicated p16INK4A overexpression, whereas 22 cases of overexpressed p16INK4A were HPV negative (Chi square 2.6; ns). Conclusions p16INK4 overexpression is not correlated with HPV in patients with LP. Objective Frequencies as high as 60% of overexpressed p16INK4 were recently reported in lichen planus (LP). Because p16INK4 overexpression may be a feature of human papilloma virus (HPV)-induced cancer, it has been postulated that LP may be somehow related to HPV. The present study is the first to evaluate both high p16INK4 expression and HPV in patients with LP. Study Design Thirty-five consecutive biopsy specimens from patients with LP constituted the basis of the present study. Level of p16INK4A expression was evaluated in each sample by immunohistochemical analysis, and the presence of HPV DNA was tested by real-time polymerase chain reaction (PCR). Results p16INK4 expression was detected in 26 specimens, whereas HPV was found in 4 lesions: 3 low-risk HPV and 1 high-risk HPV. All HPV-positive lesions also indicated p16INK4A overexpression, whereas 22 cases of overexpressed p16INK4A were HPV negative (Chi square 2.6; ns). Conclusions p16INK4 overexpression is not correlated with HPV in patients with LP.

Introduction: About 30% of the general population manifests periodontal disease (PD). Patients with parents with a compromised periodontal condition may need prosthetic or implantology treatment (PIT), therefore those patients are at increased risk of developing PD during or after dental treatment. Hence the use of a genetic test for identify those most at risk of PD and submit them to very closely oral hygiene protocols, is mandatory. PIT of these patients must be done safely having previously assessed the risk of developing PD. Polymorphisms of IL6 and IL10 constitute risk factors for chronic periodontitis, so the use of a genetic test is fundamental to ensure a correct preventive protocol and plaque control in healthy patients.

Objectives Nonsyndromic cleft lip with or without cleft palate (CL/P) is a frequent craniofacial malformation with a complex aetiology. Since the first report of an association between DNA sequence variants at the transforming growth factor α gene (TGFA) and nonsyndromic oral clefts, several studies have been carried out, which have produced conflicting results. Overall, TGFA is considered as a genetic clefting modifier in humans. Murine models indicate that the Tgfa product (tgfα), as well as its receptor (Egfr), actively participates in palate development. Notably, Egfr null mice showed an increased incidence in orofacial clefts. In the present study, genes which code for subunits of epidermal growth factor receptors (EGFRs) have been considered as candidate genes for CL/P. Methods A family based investigation was performed using a sample of 239 case/parent triads. The aim was to test for an allelic association between common non-synonymous polymorphisms in EGFR genes and CL/P. Results and conclusion The results did not suggest any evidence of a link between the investigated polymorphisms and CL/P, however the involvement of different polymorphisms or mutations in such genes cannot be excluded.

Objectives This study aims to determine the possible association between folate pathway gene polymorphisms and idiopathic pulmonary fibrosis. This represents the first study carried out on folate pathway gene polymorphisms as possible risk factors in this kind of pathology. The premise is that several polymorphisms mapping on genes responsible for folate uptake are associated with the risk of numerous diseases occurring between pregnancy and old age, and that too little is currently known about idiopathic pulmonary fibrosis. Design and methods We genotyped 9 single nucleotide polymorphisms and 1 polymorphic insertion in 7 essential genes belonging to the folate pathway in 32 Italian idiopathic pulmonary fibrosis patients and 81 control subjects. This was done by PCR and restriction analysis. Results Allelic and genotypic association tests indicated that for all the analysed polymorphisms there were no significant differences between patients and controls. Nevertheless, the haplotype association analysis revealed a significant association between idiopathic pulmonary fibrosis and transcobalamin II gene polymorphisms: specifically the haplotype 776G (rs1801198)–c.1026-394G (rs7286680)–444C (rs10418) (OR = 2.84; 95% C.I. 1.36–5.93, P value = 0.004). Conclusions This small-scale preliminary study would suggest the importance of further research focusing on the role of folate in the onset of idiopathic pulmonary fibrosis.

The risk of colorectal cancer (CRC) may be influenced by aberrant DNA methylation and altered nucleotide synthesis and repair, possibly caused by impaired dietary folate intake as well as by polymorphic variants in one-carbon metabolism genes. A case–control study using seventy-one CRC patients and eighty unrelated healthy controls was carried out to assess the genetic association of fifteen SNP and one insertion in nine genes belonging to the folate pathway. Polymorphism selection was based on literature data, and included those which have a known or suspected functional impact on cancer and missense polymorphisms that are most likely to alter protein function. Genotyping was performed by real-time PCR and PCR followed by restriction analysis. The likelihood ratio statistic indicated that most of the polymorphisms were not associated with the risk of CRC. However, an increased risk of CRC was observed for two variant alleles of SNP mapping on the transcobalamin 2 gene (TCN2): C776G (rs1801198) and c.1026-394T>G (rs7286680). Considering the crucial biological function played by one-carbon metabolism genes, further investigations with larger cohorts of CRC patients are needed in order to confirm our preliminary results. These preliminary results indicate that TCN2 polymorphisms can be a susceptibility factor for CRC.

Craniofacial morphogenesis is determined by multistep processes involving signalling molecules and transcription factors, which are organised into highly coordinated pathways. Derailment from this intricate network can lead to congenital malformations. Cells migrate from neural crests to populate different structures, such as branchial arches, involved in embryonal orofacial development. The EDN1 pathway is involved in branchial arch development. Gene knockout and knockdown experiments on EDN1 or its downstream effector dHAND resulted in mice that were characterised by craniofacial defects and cleft palate. Our aim was to evaluate whether the transcription factor HAND2 could be implicated in non-syndromic cleft lip with or without cleft palate (CL/P) aetiology. A sample study composed of 39 multiplex Italian pedigrees was enrolled to test linkage between two microsatellite flanking HAND2 locus and CL/P. No evidence of linkage between HAND2 and CL/P was obtained. Indeed, formal levels of exclusion were obtained with different inheritance models. Investigation results did not support a role of HAND2 in CL/P aetiology. Nevertheless a minor contribute of the gene in clefting could not be ruled out.

BACKGROUND: Periodontitis is a disease mainly caused by a chronic infection of tissues that support the teeth. Several factors, such as diabetes, smoking and oral care, as well as genetic susceptibility can influence both the risk to develop periodontitis and its progression. The aim of the investigation was to test whether alleles of candidate genes were associated with periodontitis. MATERIALS AND METHODS: A case control study was performed with a cohort of 184 patients with chronic periodontitis and 231 healthy controls from the Italian population. A total of six single nucleotide polymorphisms from five candidate genes, i.e., IL1A, IL1B, IL6, IL10 and vitamin D receptor, were investigated. RESULTS: Evidence of association were obtained for rs1800795 mapping in IL6 (P value = 0.01) as well as for the rs1800872 mapping in IL10 (P = 0.04). The rarer variant allele lowered the risk to develop periodontitis at IL6 (Odds Ratio [OR] = 0.69 [95% confidence interval {CI} 0.51-0.93]) and increased the risk at IL10 (OR = 1.38 [95% CI 1.01-1.86]). CONCLUSIONS: The present investigation indicated that polymorphisms of IL6 and IL10 constitute risk factors for chronic periodontitis, while there was no evidence implicating a specific IL1A or IL1B genotype.

Epidermal growth factor receptor (EGFR) family members (EGFR, HER2, HER3 and HER4) have been extensively investigated for its possible involvement in cancer development and progression. In colorectal cancer (CRC) EGFR family has been found frequently over-expressed, thus therapy targeting EGFR has been developed. Interestingly, it has been observed that genetic variants in these receptors may alter the therapeutic efficacy of EGFR inhibitors. Polymorphic variants in members of the EGFR family could influence different biologic activities, such as ligands affinity, dimerization efficiency, kinase activity, expression levels, with a consequent impact in signalling pathways and cell behaviour. This study aimed to verify whether single nucleotide polymorphisms (SNPs) of EGFR family members could represent susceptibility factors able to influence the risk to develop CRC. Peripheral blood of 70 Italian colon cancer patients and 72 healthy controls was used as a source of genomic DNA to investigate EGFR, HER2 and HER3 common non-synonymous SNPs. Genetic association tests were performed to verify a possible relationship with CRC. Evidence of genotype association was found for the R521K EGFR polymorphism under a dominant mode of inheritance (Mid-P=0.031). Genotypes with the variant allele of EGFR R521K SNP confer a risk reduction to develop CRC.

Squamous cell carcinoma is the most frequent malignant tumour of the oral cavity. It is widely known that tobacco and alcohol consumption are the major causes of the development of oral squamous cell carcinoma (OSCC). The human papilloma virus infection has also been postulated as a risk factor for squamous cell carcinoma, although conflicting results have been reported. The aim of this study is to evaluate the presence of high-risk and low-risk type human papillomavirus in a large sample of squamous cell carcinoma limited to the oral cavity by means of quantitative real-time polymerase chain reaction. Data were obtained from 278 squamous cell carcinoma limited to oral cavity proper. Sequencing revealed that 5 samples were positive for HPV type 16, 5 for HPV type 11, and 1 for HPV type 6. Human papillomavirus 11 was detected in 5 tumours out of the 278 examined. The prevalence rate for Human papillomavirus 11 was 1.8% (C.I. 0.7–3.9). The matched case-controls analysis indicated that the prevalence among controls did not significantly differ with respect to cases and that Human papillomavirus 11 alone did not correlate with squamous cell carcinoma.

Non-syndromic cleft lip with or without cleft palate (NSCLP) is a malformation with variable phenotypes, resulting from a mixture of genetic and environmental factors. Some studies have supported a role for the 16q24 region and its candidate gene, CRISPLD2, in clefting. A replication study is necessary to confirm these findings. The aim of the present study was to test, by genetic linkage and association analyses, whether the candidate gene, CRISPLD2, represents a risk factor for NSCLP. The analysis of 39 multigenerational families provided formal exclusion of a linkage between NSCLP and the CRISPLD2 locus under different genetic models and non-parametric analyses. The family-based study of 239 unrelated probands and their parents revealed no association between any particular allele or haplotype and NSCLP. Therefore, the present investigation did not support the hypothesis of the involvement of CRISPLD2 in NSCLP malformation, at least with regard to the Italian population.

Squamous cell carcinoma is the most frequent malignant tumor of the oral cavity. Markers of tumor progression that could help to define diagnosis, plan treatment and implement prognosis have still to be identified. Seven candidate markers for tumor progression were investigated using a loss of heterozygosity (LOH) assay. The sample was made up of 51 squamous cell carcinoma and adjacent normal tissues from the same patients. LOH at one, or more, markers was a relatively frequent event that was observed in 53% of tumors. The number of losses detected in each tumor was significantly associated with tumor severity. Significant association between UICC stage grouping and LOH was found for 3 gene loci: programmed cell death 4 (PDCD4), catenin beta 1 (CTNNB1), and caspase 4 (CASP4). No association between allelic loss and the occurrence of lymph node metastasis was found for any of the seven investigated loci. Overall, LOH contributes to tumor progression of oral SCC. A specific role for PDCD4, CTNNB1, and CASP4 was found.

Orofacial clefts have a multifactorial aetiology encompassing both genetic and environmental components. While there is wide agreement on the importance of both genetic and nutritional factors, genetic influence in particular has not been well defined. As genetic variants in folate and homocysteine metabolism have been reported to influence the risk of orofacial clefts, an Italian cleft lip with or without cleft palate (CL/P) data set was enrolled for an analysis based on family association to test betaine-homocysteine methyltransferase (BHMT and BHMT2) and cystathionine beta-synthase (CBS) variants. No significant level of association was found between BHMT and BHMT2 variants, while evidence of an allelic association with CL/P was found for the single nucleotide polymorphism rs4920037, mapping at the CBS gene. A log-linear approach indicated that the best genetic model takes into account both mother and child genotypes. This suggests that human orofacial development is influenced by CBS genotypes that possibly operate through intergenerational fetal-maternal interaction.

The 12q13 region has been suggested as a candidate locus for orofacial cleft by different investigators. In the present study we tested the region for linkage with non syndromic cleft lip with or without cleft palate in a collection of 39 Italian multigenerational families, using microsatellite markers. No evidence of linkage was detected between the marker map and NSCLP under different mode of inheritance nor with a nonparametric method. Formal level of linkage exclusion, were obtained for each point of the map. Genetic heterogeneity and the different impact of the candidate locus among populations could explain conflicting results obtained in different studies.

Epithelial mesenchymal transformation is considered a cardinal process in orofacial development. Several molecular players appear to be involved in this delicate mechanism; the activation of LEF1 transcription factor by transforming growth factor beta 3 seems to be a key step for the correct flow of events. The failure of orofacial processes during embryonic development may provoke cleft lip and/or cleft palate malformations. The scope of the present investigation was to verify whether genetic variants at LEF1 could influence the risk of orofacial clefting. The approach was a family based association study involving a total of 512 Italian patients and their parents, 401 having cleft lip with or without cleft palate (CL/P) and 111 with cleft palate only (CPO). Haplotype association analysis provided moderate evidence of an association with clefting (p 0.01). A log-linear likelihood-based method was used to verify maternal and foetal-maternal association. An association between the maternal genotype and the occurrence of CL/P was observed at two polymorphic loci, at rs10022956 (P = 0.0049) and rs10025431 (P = 0.0065) respectively, while a foetal-maternal effect modulating the risk of clefting was found at locus rs10025431 (P = 0.0071). These data further corroborate the importance of the mother's genotype with regard to susceptibility to malformations and early-onset diseases.

Objective To assess the possible association between TGFB3 allele variants and nonsyndromic cleft lip with or without cleft palate in a Chilean population. Design In our study we used a case-parents trios design. The sample consisted of 150 unrelated trios ascertained through probands affected with nonsyndromic cleft lip with or without cleft palate. Three TGFB3 polymorphisms were analyzed (rs2268626, rs2268625, and rs3917201). An allele/haplotype transmission disequilibrium test was used to evaluate the possible genotype-phenotype association. Results An overtransmission from parents to affected progeny was observed for the A allele of rs3917201 ( p = .03) and for the rs2268625-rs3917201 A-A haplotype ( p = .022). A defect of transmission of rs2268625-rs3917201 G-G haplotype ( p = .022) was observed also. Conclusions Allelic and haplotypic associations implicate a possible role of TGFB3 in nonsyndromic cleft lip with or without cleft palate in the Chilean population. Additional studies are needed in order to elucidate the possible mechanisms that can explain the role of TGFB3 genetic variants in the condition.

BACKGROUND: PerioGlas® (PG) is an alloplastic material used for grafting periodontal osseous defects since 1995. In animal models, it has been proven that PG achieves histologically good repair of sur-gically created defects. In clinical trials, PG was effective as an adjunct to conventional surgery in the treatment of intrabony defects. Because the molecular events due to PG that are able to alter osteob-last activity to promote bone formation are poorly understood, we investigated the expression of os-teoblastic related genes in mesenchymal stem cells exposed to PG. METHODS: The expression levels of bone related genes like RUNX2, SP7, SPP1, COL1A1, COL3A1, BGLAP, ALPL, and FOSL1 and mesenchymal stem cells marker (CD105) were analyzed, using real time reverse transcription-polymerase chain reaction. Pearson's chi-square (χ(2)) test was used to detect markers with significant differences in gene expression. RESULTS: PG caused induction of osteoblast transcriptional factor (like RUNX2), bone related genes osteopontin (SPP1), osteocalcin (BGLAP) and alkaline phosphatase (ALPL). All had statistical sig-nificant P values (< 0.05). CONCLUSION: PG has a differentiation effect on mesenchymal stem cells derived from peripheral blood. The obtained results can be relevant to better understanding of the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects.

Oral squamous cell carcinoma, the most frequently occurring malignant head and neck tumour, generally exhibits poor prognosis and metastases are the main cause of death. The discovery of reliable prognostic indicators of tumour progression could greatly improve clinical practice. MicroRNAs are involved in the regulation of basic cellular processes such as cell proliferation, differentiation, and apoptosis. Since miRNAs have been shown to be abnormally expressed in different tumours their importance as potential cancer prognostic indicators is increasing. To define the role of miRNA in OSCC tumours we investigated the expression profile of 15 OSCC (8 without metastasis and 7 with lymph node metastasis) using microarray analysis. Thirteen miRNA were significantly overexpressed (miR-489, miR-129, miR-23a, miR-214, miR-23b, miR-92, miR-25, miR-210, miR-212, miR-515, miR-146b, miR-21, miR-338) and 6 miRNA were underexpressed (miR-520h, miR-197, miR-378, miR-135b, miR-224, miR-34a) in oral tumours. Underexpression of mir-155, let-7i, mir-146a was found to characterize progression to metastastatic tumours. Further investigations will elucidate whether differentially expressed miRNAs will help to better classify OSCCs, thus improving diagnoses and patient care.

Background. Head and neck squamous cell carcinomas (SCCs) are among the most aggressive types of cancer. The Simian virus 40 (SV40), which is a polyomavirus known for its oncogenic potential, was found as a contaminant of oral vaccines and has been related to human pleomorphic adenoma in the parotid gland. The aim of this study was to evaluate the presence of SV40 and 2 human polyomaviruses—BK virus (BKV) and JC virus (JCV)—in a large sample of SCCs of the oral cavity. Methods. Quantitative real-time polymerase chain reaction (PCR) was used to evaluate virus load. Results. Overall, the prevalence of SV40, BKV, and JCV in oral SCC was negligible. Matched-pair case-control analysis indicated that prevalence among the controls did not significantly differ with respect to analyzed cases. Conclusion. The results did not indicate a major role for SV40, BKV, and JCV in the etiology of oral SCC. © 2009 Wiley Periodicals, Inc. Head Neck, 2010

Calcium sulfate (CaS) is a highly biocompatible material and enhances bone formation in vivo. However, how CaS alters osteoblast activity to promote bone formation is incompletely understood. We therefore investigated the translation regulation in osteoblasts exposed to CaS by using microRNA microarray techniques. Transduction, transcription, and translation are the three levels of regulation of cell activity. Recently, a new type of translation regulation has been identified: RNA interference (RNAi). RNAi is a process in which microRNA, (miRNA), that is, noncoding RNAs of 19-23 nucleotides can induce sequence-specific mRNA degradation and/or translational repression. The human genome encodes a few hundred miRNAs that can post-transcriptionally repress thousands of genes. The miRNA oligonucleotide microarray provides a novel method of carrying out genome-wide miRNA profiling in human samples. By using miRNA microarrays containing 329 probes designed from Human miRNA sequences, we identified in osteoblast-like cells line (MG-63) cultured with CaS (Surgiplaster, Classimplant, Roma, Italy) several miRNA whose expression is significantly modified. The data reported are, to our knowledge, the first study on translation regulation in osteoblasts exposed to CaS. They could be relevant to a better understanding of the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects.

Clefts of the orofacial region are among the most common congenital defects, caused by abnormal facial development during gestation. Non-syndromic cleft lip with or without cleft palate (NSCLP) is a complex trait most probably caused by multiple interacting loci, with possible additional environmental factors. As facial clefts form part of more than 300 syndromes, one strategy for identifying the genetic causes of NSCLP could be to study candidate genes responsible for clefting syndromes. Three genes were selected for this investigation: TP63, which codes for the tumour protein p63 and causes Ectrodactyly-Ectodermal dysplasia-orofacial Cleft syndrome; JAG2, a downstream gene of TP63; and MID1, which is responsible for Opitz syndrome. A linkage disequilibrium investigation was performed with intragenic single nucleotide polymorphisms on each of these genes in a sample study of 239 patients/parents trios. Evidence which suggests that JAG2 and MID1 may play a role in NSCLP was obtained.

Porous polyethylene (PP or Medpor) is an alloplastic material worldwide used for craniofacial reconstruction. Although several clinical studies are available, there is a lack as regard the genetic effects. Because PP is always fixed on bone and the mechanism by which PP acts on osteoblasts is unknown, we therefore attempted to address this question by using microRNA microarray techniques to investigate the translation regulation in osteoblasts exposed to PP. The miRNA oligonucleotide microarray provides a novel method to carry out genome-wide microRNA profiling in human samples. By using miRNA microarrays containing 329 probe designed from Human miRNA sequence, we identified in osteoblast-like cells line (MG-63) cultured with Medpor (Porex Corporation, Fairburn, Georgia, USA) several miRNA which expression is significantly modified. We identified 16 up-regulated miRNA (i.e. mir-337, mir-515-3p, mir-377, mir-153, mir-367, mir-152, let-7b, mir-92, mir-155, mir-424, mir-148b, mir-368, mir-18b, mir-520d, mir-20b, mir-128a) and 2 down-regulated miRNA (i.e. mir-143, mir-32). The data reported are, to our knowledge, the first study on translation regulation in osteoblasts exposed to PP. They can be relevant to better understand the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects.

Bio-Oss (BO), composed of anorganic bovine bone, is widely used in several bone regeneration procedures in oral surgery. PerioGlas (PG) is an alloplastic material that has been used for grafting of periodontal osseous defects since the 1990s. However, how these biomaterials alter osteoblast activity to promote bone formation is poorly understood. We attempted to address this question by using microRNA microarray techniques to investigate differences in translational regulation in osteoblasts exposed to BO and PG. By using miRNA microarrays containing 329 probes designed from human miRNA sequences, we investigated miRNAs whose expression was significantly modified in an osteoblast-like cell line (MG-63) cultured with BO vs PG. Three up-regulated miRNAs (mir- 337, mir-200b, mir-377) and 4 down-regulated miRNAs (mir-130a, mir-214, mir-27a, mir-93) were identified. Our results indicated that BO and PG act on different miRNAs. Globally, PG causes activation of bone- forming signaling, whereas BO also activates cartilage- related pathways. (J. Oral Sci. 50, 301-307, 2008)

The normal development of cranial primordia and orofacial structures involves fundamental processes in which growth, morphogenesis, and cell differentiation take place and interactions between extracellular matrix (ECM) components, growth factors and embryonic tissues are involved. Biochemical and molecular aspects of craniofacial development, such as the biological regulation of normal or premature cranial suture fusion, has just begun to be understood, thanks mainly to studies performed in the last decade. Several mutations has been identified in both syndromic and non-syndromic craniosynostosis patients throwing new light onto the etiology, classification and developmental pathology of these diseases. In the more common craniosynostosis syndromes and other skeletal growth disorders, the mutations were identified in the genes encoding fibroblast growth factor receptor types 1-3 (FGFR1, 2 and 3) where they are dominantly acting and affect specific and important protein binding domain. The unregulated FGF signaling during intramembranous ossification is associated to the Apert and Crouzon syndrome. The non syndromic cleft of the lip and/or palate (CLP) has a more complex genetic background if compared to craniosynostosis syndrome because of the number of involved genes and type of inheritance. Moreover, the influence of environmental factor makes difficult to clarify the primary causes of this malformation. ECM represents cell environment and results mainly composed by collagens, fibronectin, proteoglycans (PG) and hyaluronate (HA). Cooperative effects of ECM and growth factors regulate regional matrix production during the morphogenetic events, connective tissue remodelling and pathological states. In the present review we summarize the studies we performed in the last years to better clarify the role of ECM and growth factors in the etiology and pathogenesis of craniosynostosis and CLP diseases.

Titanium is the gold standard among materials used for prosthetic devices, because of its good mechanical and chemical properties. When exposed to oxygen, titanium becomes an oxide that is biocompatible and able to induce osseointegration. Three allotropic forms of titanium dioxide exist, that is brookite, rutile, and anatase. Anatase can be prepared as a colloidal suspension and then used to coat surfaces. Anatase coating (AC) can potentially have specific biological effects. Here we are testing the effect of AC on osteoblast-like cells (MG63) by using microarray techniques to identify genes that are differently regulated in osteoblasts exposed to AC. By using DNA microarrays containing 20,000 genes, we identified in osteoblast-like cell lines (MG-63) cultured on AC, several genes whose expression was significantly up- or downregulated. They cover a broad range of functional activities: signaling transduction, immunity, cell cycle regulation, lysosomes composition and vesicular transport, cell adhesion, cytoskeleton and extracellular matrix components, proliferation, and apoptosis. The data reported constitute, to our knowledge, the first genetic portrait of AC effects. They can be relevant to a better understanding of the molecular mechanism of bone regeneration and as a model for comparing other materials with similar clinical effects.

PerioGlas (PG) is an silicate-based (i.e. anorganic) material used for grafting periodontal osseous defects since the ninety whereas P-15 is an analog of the cell binding domain of collagen (i.e. organic material) that is successfully used in clinical trial to promote bone formation. However, how PG (i.e anorganic material) and P-15 (i.e. collagen) differentially alter osteoblast activity to promote bone formation is unknown. We therefore attempted to get more insight by using microRNA microarray techniques to investigate the translation process in osteoblasts differentially exposed to PG and P-15. We identified 3 up-regulated miRNA (i.e. mir-30b, mir-26a, mir-92) and 8 down-regulated miRNA (i.e. mir-337, mir-377, mir-25, mir-200b, mir-129, mir-373, mir-133b, mir-489). The data reported are, to our knowledge, the first study on translation regulation in osteoblatsts differentially exposed to cell binding domain of collagen and to silicate-based material. Both enhance the translation of several miRNA belonging to osteogenetic genes, but P-15 acts preferentially on homeobox genes

Nonsyndromic cleft lip and/or palate (or orofacial cleft, OFC) is a malformation characterized by an incomplete separation between nasal and oral cavities without any associated anomalies. The last point defines the distinction between syndromic and nonsyndromic OFC. Nonsyndromic OFC is one of the most common malformations among live births and is composed of two separate entities: cleft lip with or without cleft palate (CL+/-P) and cleft palate isolated (CPI). Because of the complex etiology of nonsyndromic OFC, which is due to the differences between CL+/-P and CPI, and the heterogeneity of each group, caused by the number of genes involved, the type of inheritance, and the interaction with environmental factors, we reviewed those genes and available loci in the literature whose involvement in the onset of nonsyndromic OFC has more sound scientific evidence. Genetic studies on human populations have demonstrated that CL+/-P and CPI have distinct genetic backgrounds and, therefore, environmental factors probably disclose only these malformations. In CL+/-P several loci, OFC from 1 to 10 have been identified. The first locus, OFC1, has been mapped to chromosome 6p24. Other CL+/-P loci have been mapped to 2p13 (OFC2), 19q13.2 (OFC3) and 4q (OFC4). OFC5-8 are identified by mutations in the MSX1, IRF6, PVRL1, and TP73L gene, respectively. OFC9 maps to 13q33.1-q34, whereas OFC10 is associated with haploinsufficiency of the SUMO1 gene. In addition, MTHFR, TGF-beta3, and RARalpha play a role in cleft onset. In CPI one gene has been identified (TBX22) at present, but others are probably involved. Greater efforts are necessary in order to have a complete picture of the main factors involved in lip and palate formation. These elements will permit us to better understand and better treat patients affected by OFC.

Nonsyndromic cleft lip with or without cleft palate (CL/P) is a complex genetic trait and little is known about its aetiology. Recent investigations on rare clefting syndromes provided interesting clues about genes involved in face development. The PVRL1 gene encodes nectin1, a cell-to-cell adhesion molecule. Mutations in its sequence have been shown to cause the rare autosomal recessive syndrome CL/P-ectodermal dysplasia syndrome (CLPED1), while heterozygosity for the mutation W185X seemed to increase the risk of non syndromic CL/P in a population from northern Venezuela. In the present study, we screened 143 Italian CL/P patients for mutations in PVRL1. Three rare sequence variants in exon 3 that create amino-acid changes were detected in a total of 7 patients. Two of these mutations were not found in a panel of 292 unaffected controls, while the third was found in two controls. This study describes new mutations that may represent genetic risk factors for CL/P. Even though a study to look at the effects of the mutations on nectin1 function was not feasible, supporting evidence was reported, thus confirming the involvement of PVRL1 in the aetiology of non-syndromic CL/P malformation.

Cleft lip with or without cleft palate (CL/P) is the most common inborn craniofacial anomaly. Affected individuals require extensive medical and psychosocial support. Although CL/P has a complex and poorly understood etiology, increasing evidence of folate pathway involvement has been collected. So far, only the MTHFR gene has been extensively investigated as a risk factor for CL/P, while little has been done to test genetic variations in the folate biosynthetic pathways that may influence the infant's susceptibility to these birth defects. To date, this paper presents the first attempt to verify the involvement of four genes belonging to the folate pathway in nonsyndromic cleft onset. We used a case-parent triad design to test for linkage disequilibrium in the case of seven SNPs mapping on four different genes: transcobalamin 1 and 2 (TCN1 and TCN2), methionine synthase (MTR), and MTR reductase (MTRR). Our finding suggests that TCN2 is involved in causing CL/P. Indeed, significant overtransmission of the C allele was observed at the polymorphism c.776C>G (p.Pro259Arg) to the affected offspring (P=0.01). Results obtained with additional TCN2 polymorphisms suggest that c.776C>G may be functionally related to CL/P. However, because conflicting data exist with regard to the effect of the polymorphism in transcobalamin 2 function or in perturbing plasma levels of key molecules in the folate pathway, further investigation is warranted to confirm our data.

Malignant mesothelioma is a rare form of cancer, in which the cancer cells are found in the sac lining the chest (pleura) or abdomen (peritoneum). This lethal disease is associated with asbestos and has vast economic and legal implications. As the disease takes approximately twenty years to manifest itself in humans, a wave of diagnoses is expected in the near future. In the United States alone, an estimated 3,500 - 4,000 patients are diagnosed with mesothelioma annually, and it is estimated that over the next 35 years, more than 250,000 people in Western Europe will be diagnosed with the disease. Malignant Mesothelioma, edited by internationally recognized experts in the field, is a comprehensive text that relates science, pathology, clinical aspects and therapy for mesothelioma under one cover. The book integrates the newest research and advances in its discussions of the disease, covering such topics as carcinogenesis, epidemiology, benchwork, endoscopy, multimodality approaches and treatment. It includes discussions on novel approaches to mesothelioma, such as gene therapy, vaccination strategies and immunotherapy, as well as discussions on the legal and economic aspects of the disease. Over 200 illustrations round out the text. An invaluable reference for the medical oncologist, thoracic surgeon, radiation oncologist, pulmonologist, and benchworker interested in the disease.

Unregulated fibroblast growth factor 2 (FGF2) signaling caused by mutations in the fibroblast growth factor receptor (FGFR2) leads to human craniosynostosis such as the Apert syndrome. In an in vitro control model of calvarial osteoblasts from Apert patients carrying the FGFR2 P253R mutation, we studied the changes in cellular phenotype and evaluated the effects of FGF2. Compared with wild-type controls, osteocalcin mRNA was down-regulated in Apert osteoblasts, Runt-related transcription factor-2 (RUNX2) mRNA was differentially spliced, and FGF2 secretion was greater. Total protein synthesis, fibronectin and type I collagen secretion were up-regulated, while protease and glycosidase activities and matrix metalloproteinase-13 (MMP-13) transcription were decreased, suggesting an altered ECM turnover. Adding FGF2 increased protease and glycosidase activities and down-regulated fibronectin and type I collagen secretion in Apert osteoblasts. High affinity FGF2 receptors were up-regulated in Apert osteoblasts and analysis of signal transduction showed elevated levels of Grb2 tyrosine phosphorylation and the Grb2-p85 beta association, which FGF2 stimulation strongly reduced. All together these findings suggest increased constitutive receptor activity in Apert mutant osteoblasts and an autocrine loop involving the FGF2 pathway in modulation of Apert osteoblast behavior.

Summary Squamous cell carcinoma is the most frequent malignant tumor of the oral cavity and often arises from premalignant lesions. Traditional methods used by the pathologist are subjective and lack the sensitivity to predict accurately which precancers may progress with time. Therefore, it is important to search for markers that may identify progression of premalignant lesions. Microarray technology can be use with this aim. Here, we define the genetic expression profile of lingual dysplasia (DS) progression. By using cDNA microarray containing 19.2 K clones and a baseline of 11 normal tissues, we compared 5 mild and 4 severe DS. We identified 270 genes differentially expressed in normal tissue vs. mild DS (i.e. 161 up- and 109 down-regulated) and 181 genes differentially expressed in mild vs. severe DS (i.e. 63 up- and 118 down-regulated). The described genes cover a broad range of functional activities: (a) anti-oxidative, (b) DNA-repair, (c) inflammatory response, (d) cell-adhesion/mobility, (e) extracellular matrix depolimerization, and (f) cell-cycle regulation. The data reported better define DS progression and can help in classifying premalignant lesions.

Nonsyndromic cleft lip with or without cleft palate (CL/P; MIM 119530), a common birth defect, is a genetically complex trait. Several genetic and environmental factors seem to be involved in the development of this malformation [Carinci et al., 2003]. Nevertheless, CL/P also occurs as a part of many single gene syndromes, and some of these genes may also have roles in nonsyndromic CL/P. Suzuki et al. [2000] showed that the rare autosomal recessive syndrome CL/P-ectodermal dysplasia (CLPED1; MIM 225060) is caused by the loss-of-function of PVRL1 gene, which encodes nectin-1, a cell-to-cell adhesion molecule. The same group demonstrated that heterozygosity of the nonsense mutation W185X is a genetic risk factor for nonsyndromic CL/P in northern Venezuela [Sozen et al., 2001]. To verify whether the W185X mutation is a genetic risk factor for nonsyndromic CL/P in the Italian population, 71 familial CL/P belonging to 71 different pedigrees, 75 sporadic CL/P, and 100 unrelated unaffected individuals were enrolled in this study. The W185X mutation is a singlenucleotide change G!A that creates a StyI restriction endonuclease site. Therefore, a 160 bp segment of the exon 3 containing the mutation was amplified by PCR using the following primers: W185X.for 50CCACCAATTGGATAGAGGGTA30 and W185X.rev 50CGGATCTCCTGGTACTCTGC30. Amplimers were digested with StyI restriction endonuclease, electrophoresed on 2.5% agarose gel, and visualized by ethidium bromide. Positive controls, containing the mutation generated by site-directed mutagenesis (www.buckinstitute. org/benz/prot/prot12.htm), were included to verify the assay efficiency in each test. Of the 146 CL/P patients and of the 100 unaffected individuals analyzed in this study for the presence of the W185X mutation in the PVRL1 exon 3, none was positive. The results of this investigation indicate that in Italy the W185X mutation is not common and in turn, it does not constitute a risk factor for nonsyndromic CL/P. As suggested by Suzuki et al. [2000], since the PVRL1 gene product constitutes a receptor for herpesviruses, in the Margarita Island population the mutation may be selected positively for an increased resistance to infections of the carriers. Our findings significantly differ from those previously observed in the Venezuelan population [Sozen et al., 2001]. This discrepancy likely reflects the complex etiology of the CL/P malformation. Indeed, the numerous genetic and environmental factors involved probably contribute differently to the development of the malformation in distinct populations.

Nonsyndromic cleft of the lip with or without palate (CLP) derives from an embryopathy with failure of the nasal processes and/or fusion of the palatal shelves. This severe birth defect is one of the most common malformations among live births. Human cleft is composed of two separate entities: cleft lip and/or palate (CLP) and cleft palate only (CPO). Both have a genetic origin, whereas environmental factors contribute to these congenital malformations. In this review we analyse the role of drugs, environmental factors, genes and loci related to the onset of cleft. The data were obtained from (i) epidemiologic studies, (ii) animal models and (iii) human genetic investigations. Epidemiologic studies have demonstrated a relation between certain environmental factors (alcohol, cigarette smoking, steroids and anticonvulsants) during pregnancy and a higher risk of generating offspring with CLP. On the contrary, folic acid intake seems to have a protective effect. No clear relation has been demonstrated between aspirin and CLP. Murine models were developed to investigate drug-induced embryopathy and, more recently, to obtain information regarding genes and biochemical pathways. Steroids and anticonvulsants are the most widely studied clefting drugs, whereas TGFs and retinoic acids are the most thoroughly investigated among biochemical pathways. Human genetic studies on CLP have identified several loci and, in one case, also a specific gene. In CPO, one gene has been identified, though many more are probably involved. Among the identified chromosomal regions, there are some carrying genes with functions related to environmental factors with a clefting or protective effect.

Crocidolite asbestos elicits oxidative stress and cell proliferation, but the signaling cascades linked to these outcomes are unclear. To determine the role of mitogen-activated protein kinases (MAPK) in asbestos-induced cell signaling, we evaluated the effects of crocidolite asbestos, EGF and H2O2, on MAPK activation in murine lung epithelial cells (C10 line). In contrast to rapid and transient activation of extracellular signal-regulated kinase 5 (ERK5) by EGF or H2O2, asbestos caused protracted oxidant-dependent ERK5 activation that was inhibited by an Src kinase inhibitor (PP2), but not by an inhibitor of epidermal growth factor receptor (EGFR) phosphorylation (AG1478). ERK1/2 activation by asbestos was inhibited by either PP2 or AG1478. To confirm the involvement of Src in ERK1/2 and ERK5 activation, a dominant-negative Src construct was used. These experiments showed that Src was essential for ERK1/2 and also ERK5 phosphorylation by asbestos. Time frame studies indicated immediate activation of Src by asbestos fibers, whereas EGFR phosphorylation occurred subsequently. Data suggest that asbestos causes activation of ERK5 through an EGFR-independent pathway, whereas ERK1/2 activation is dependent on Src through a mechanism involving phosphorylation of the EGFR. Furthermore, Src, ERK1/2 and ERK5 activation are essential for cell proliferation by asbestos. The use of a dominant-negative ERK5 construct caused selective downregulation of c-jun expression, whereas inhibition of Src by PP2 or MEK1 by PD98059 caused decreases in c-fos, fra-1 and c-jun expression in asbestos-exposed C10 cells. These observations may have broad relevance to cell proliferation by carcinogenic mineral fibers and oxidants.

Objective We aimed to characterize the fibroblast phenotype of patients by analyzing gene and protein expression of cleft lip and/or cleft palate fibroblasts in relation to collagen turnover and extracellular matrix remodeling. Patients Human palatal fibroblasts were obtained from three healthy subjects without cleft lip and/or cleft palate and from three subjects with nonsyndromic cleft lip and/or cleft palate. Collagen turnover–related gene and protein expression were analyzed by real-time polymerase chain reaction, Western and dot blots, and sodium dodecyl sulfate zymography. Results Cleft lip and/or cleft palate fibroblasts, compared with controls, displayed a down-regulation of collagens type I and III messenger RNA ( p < .0001 and p < .001, respectively) but an opposite tendency to increase protein levels. Cleft lip and/or cleft palate cells had higher lysyl hydroxylase-2b messenger RNA levels expressed in relation to collagen type I messenger RNA, down-regulated matrix metalloproteinase-1, tissue inhibitor of matrix metalloproteinase-1, and Secreted Protein Acidic and Rich in Cysteine messenger RNA ( p < .0001 and p < .01, respectively). Pro–matrix metalloproteinase-1 tended to decrease, and pro–matrix metalloproteinase-2 and -9 were down-regulated ( p < .01, p < .05, respectively), as was Secreted Protein Acidic and Rich in Cysteine protein expression ( p < .05). Conclusions Our results suggest that the cleft lip and/or cleft palate fibroblast phenotype is characterized by a tendency toward interstitial collagen deposition due to posttranslational modifications, such as decreased collagen degradation by matrix metalloproteinases and increased collagen cross-links. These findings may contribute to the knowledge of the cleft lip and/or cleft palate fibroblast phenotype and may be useful to the surgeon when considering the potential wound contraction and subsequent undesired scarring in cleft lip and/or cleft palate ocurring after the surgical closure of a cleft palate.

Cleft lip with or without cleft palate (CL/P) is one of the most common birth defects, but its etiology is largely unknown. It is very likely that both genetic and environmental factors contribute to this malformation. Mutations in the gene for interferon regulatory factor 6 (IRF6) have been shown to be the cause of Van der Woude syndrome, a dominant disorder that has CL/P as a common feature. Recently, it has been reported that genetic polymorphisms at the IRF6 locus are associated with nonsyndromic CL/P, with stronger association in Asian and South American populations. We investigated four markers spanning the IRF6 locus, using the transmission/disequilibrium test. A sample of 219 Italian triads of patients and their parents were enrolled in the study. Strong evidence of linkage disequilibrium was found between markers and disease in both single-allele (P=.002 at marker rs2235375) and haplotype (P=.0005) analyses. These findings confirm the contribution of IRF6 in the etiology of nonsyndromic CL/P and strongly support its involvement in populations of European ancestry.

Bio-Oss (Geistlich) is composed of an organic bovine bone and has been widely used in several bone regeneration procedures during oral surgery. However, how this biomaterial enhances osteoblast activity to promote bone formation is not completely understood. MicroRNAs (miRNAs) represent a class of small, functional, noncoding RNAs of 19 to 23 nucleotides that regulate the transcription of messenger RNAs (mRNAs) in proteins. In this study, the miRNA microarray technique was used to investigate translation regulation in an osteoblast-like cell line (MG63) exposed to Bio-Oss. Nine up-regulated miRNAs (mir-423, mir-492, mir-191, mir-23a, mir-377, mir-494, mir-214, mir-193b, mir-320) and 4 down-regulated miRNAs (mir-27a, mir-24, mir-188, let-7c) were identified. Because each miRNA regulates 100 mRNAs, only mRNAs related to bone formation were analyzed. The vast majority of detected mRNAs are down-regulated, including some homeobox genes (genes that regulate the morphogenesis of an entire segment of the body), such as noggin and EN1. An indirect positive effect was demonstrated on bone morphogenetic protein-4. To the authors' knowledge, the data reported here are the first on translation regulation in osteoblasts exposed to Bio-Oss. This study may be relevant in better understanding the molecular mechanism of bone regeneration and used as a potential tool for analyzing the combined use of cytokines.

Epidemiological studies have correlated lower maternal periconceptional levels of plasma folate and cobalamin with increased risk of delivering offspring presenting congenital malformations such as cleft lip with or without cleft palate (CL/P) or neural tube defects. A number of genetic studies aimed at correlating these biochemical levels or the occurrence of malformations with specific genetic defects or polymorphisms have been successfully performed. The cubilin gene (CUBN) codes for a carrier that plays a crucial role in cobalamin cell internalization. CUBN polymorphisms were previously found to be associated with spina bifida occurrence. In this work, a family-based association study was performed to test CUBN involvement in CL/P. A sample of 391 CL/P triads was investigated with three single nucleotide polymorphisms mapping on the cubilin gene. Association tests indicated no significant association between CL/P and marker alleles or marker haplotypes. No evidence of maternal effect and imprinting were obtained. These data suggest that CUBN is not involved in CL/P onset in the investigated Italian population.

The aim of this study is to preventively contaminate the abutment-fixture connection (AFC) with Lactobacillus reuteri (L. reuteri), to evaluate the presence of micro leaks in different types of implant-abutment connections, by measuring the concentration of L. reuteri in the sulcular fluid over time. This microorganism produces the Reuterine, an antibiotic which counteracts the development of other microbial species. Fourteen biphasic implants were placed on 10 patients (3 women; 7 men; mean age 55.9±16.54y). Eight implants had a flat top connection (internal Hex) while six implants had a tapered connection (conical plus octagonal). At the time of prosthetic finalization, before the healing screw was removed, the sulcular fluid was harvested, on each implant, by means of three sterile paper cones placed into the gingival sulcus and left in place for 20sec before to be transferred to a sterile tube. Once the healing screw has been removed, first the implant connection has been gently dried with air jet for 10sec and then completely filled with L. reuteri DSM 17938 (Reuflor, Italchimici, Italy). Immediately after the prosthetic finalization the sulcular fluid was then harvested again, with the same procedure described before, and repeated at 1 week and 1 month of follow up. The samples were then sent for subsequent DNA extraction and real-time PCR. Our results demonstrate that the concentration of L. reuteri, in the sulcular fluid, does not persist over time in case of preventive contamination of the AFC, demonstrating no significative differences between flat top and tapered connections. Therefore, the use of the latter does not lead to a lower risk of Peri Implant Disease (PID). Long-term studies, involving a larger number of samples, are advisable to confirm these findings.

Nonsyndromic cleft of the lip and/or palate (CLP or orofacial cleft) derives from an embryopathy with consequent failure of the nasal process and/or palatal shelves fusion. This severe birth defect is one of the most common malformations among live births. Nonsyndromic CLP is composed of two separate entities: cleft lip and palate (CL+/-P) and cleft palate only (CPO). Both have a genetic background, and environmental factors probably disclose these malformations. In CL+/-P, several loci have been identified, and, in one case, a specific gene has also been found. In CPO, one gene has been identified, but many more are probably involved. Because of the complexity of the genetics of nonsyndromic CLP as a result of the difference between CL+/-P and CPO, heterogeneity of each group caused by the number of involved genes, type of inheritance, and interaction with environmental factors, we discuss the more sound results obtained with different approaches: epidemiological studies, animal models, human genetic studies, and in vitro studies.

Periodontal disease (PD) is among the most common infectious diseases in the world, caused by pathogenic bacteria that trigger innate, inflammatory, and adaptive immune responses, leading to the destruction of supporting periodontal tissues and, if untreated, tooth loss. This study included 3593 patients, of them 1963 had a complete dataset and thus were analysed: 1088 (55%) were from Northern Italy, 749 (38%) from Central and 126 (7%) from Southern. Aggregatibacter actinomycetemcomitans, Porphyromonas gengivalis, Treponema denticola, and Tannerella forsythia, Campylobacter rectus, Fusobacterium nucleatum, and total bacterial load were investigated. There was a significant difference in geographic distribution as regard A. actinomycetemcomitans (p

Pulsed Electromagnetic Fields (PEMFs) are commonly used in the clinical practice to treat several pathologies like osteotomies, avascular necrosis of the femoral head and bone grafts. The sequences of events by which electromagnetic stimulation can lead its effects on bone healing are not completely understood. In order to get more information on the mechanism of action of PEMFs, we asked whether a) PEMFs are able to induce changes in the production of growth factors in human osteoblasts and in human mesenchymal stem cells b) the production of growth factors induced by PEMFs vary at different time points (12 and 24 hrs) c) PEMFs induce a different production of growth factors in cells at different stages of differentiation like human Mesenchymal Stem cells and human osteoblasts. Twenty seven genes out of the 84 studied were significantly over and down expressed and fourteen of those genes up or down regulated are related to bone formation or inflammation. Our data demonstrate that PEMFs exert their effects by activating or suppressing a large number of growth factors simultaneously with different functions and that this variation of expression varies depending on time and depending on the different stage of differentiation of the cell.

Gingivitis and periodontitis are the two main periodontal diseases. Both are characterized by inflammation of the tissues surrounding the teeth but while tissue damages observed in gingivitis are mild and reversible, destruction caused by periodontitis is deeper and irreversible. Periodontal diseases and levels of degeneration of tissues surrounding teeth depend on several interacting endogenous and exogenous factors. Polymorphisms of genes encoding molecules that modulate the immune response and tissue homeostasis are the main causes of individual susceptibility to periodontal diseases. The aim of this study was to investigate IL6, IL10 and VDR gene polymorphisms in a large number of subjects affected by either gingivitis or chronic periodontitis. The sample included 750 Italian patients. We found that the rs1800795 SNP located in the IL6 gene promoter was strongly associated with the occurrence of both gingivitis and periodontitis. Indeed, homozygous individuals with variant allele appeared less-susceptible to both gingivitis OR=0.47 (95% C.I. 0.27-0.82) and periodontitis OR=0.36 (95% C.I. 0.21-0.64). No evidence of association between periodontal diseases and IL10 or VDR polymorphisms was obtained. This data confirmed the role of IL6 in susceptibility to periodontitis among the Italian population. The evidence that IL6 polymorphisms are also involved in gingivitis has implications in periodontal disease pathogenesis and reduces the appeal of IL6 as a periodontitis biomarker.

Larynx squamous cell carcinoma represents one of the most common head and neck cancers in the world. Herbal drugs are popularly emerging as complementary and alternative therapies in cancer because of their cost effectiveness and minimal side effects. The present study was undertaken to explore the anti-tumor potential of berberine, an isoquinolone present in the extract of Tinospora cordifolia in HEP2 human laryngeal cancer cell line. Besides, it was aimed to investigate whether berberine could enhance the anti-cancer effect of 5-fluorouracil and cisplatin in HEP2. Our data seem to support a role for berberine in decreasing the expression of genes usually seen overexpressed in larynx squamous cell carcinoma and involved in pathways such as those of cell cycle and regulation, differentiation, and epithelial-mesenchymal transition. Moreover, a down regulation of these genes caused by cisplatin or 5-fluorouracil, treatment of election in laryngeal cancers was enhanced by a 4h pre-treatment with berberine.