Search

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

Specific cleavages within the shufflon-specific recombination site of plasmid R64 were detected by primer extension when a DNA fragment carrying the recombination site was incubated with the shufflon-specific Rci recombinase. Rci-dependent cleavages occurred in the form of a 5' protruding 7 bp staggered cut, suggesting that DNA cleavage and rejoining in the shufflon system take place at these positions. As a result, shufflon crossover sites were designated as sfx sequences consisting of a central 7 bp spacer sequence, and left and right 12 bp arms. R64 sfx sequences are unique among various site-specific recombination sites, since only the spacer sequence and the right arm sequence are conserved among various R64 sfxs, whereas the left arm sequence is not conserved and is not related to the right arm sequence. From nuclease protection analyses, Rci protein was shown to bind to entire R64 and artificial sfx sequences, suggesting that one Rci molecule binds to the conserved sfx right arm in a sequence-specific manner and the second to the sfx left arm in a non-specific manner. The sfx left arm sequences as well as the right arm sequences were shown to determine affinity to Rci and subsequently inversion frequency. Asymmetry of the sfx sequence may be the reason why Rci protein acts only on the inverted sfx sequences., ((c) 2002 Elsevier Science Ltd.)

We have previously shown that the pilL, pilN, pilQ, pilS, pilU, and pilV genes of plasmid R64 encode outer membrane lipoprotein, secretin, cytoplasmic ATPase, major pilin, prepilin peptidase, and minor pilin, respectively, which are required for thin-pilus formation. In this work, we characterized the products of the remaining essential genes, pilK, pilM, pilO, pilP, pilR, and pilT, with regard to their localization and processing. Overexpression systems containing pilM, pilO, and pilP genes fused with N-terminal glutathione S-transferase (GST) or a His tag were constructed. Overproduced proteins were purified and used to raise specific antibodies. Localization of PilM, PilO, and PilP proteins was performed by Western blot analysis with anti-GST-PilM, anti-PilO, and anti-PilP antibodies, respectively. The pilK, pilR, and pilT products were produced with a C-terminal His tag and then detected by anti-His tag antibody. Subcellular fractionation experiments with Escherichia coli cells producing R64 thin pili revealed that PilK, PilM, and PilR are inner membrane proteins, and PilP and PilT are periplasmic proteins. PilO protein was localized to the outer membrane in the presence of other Pil proteins, whereas it was localized to the cytoplasm in the absence of these proteins. Furthermore, the cleavage site of PilP protein was determined by N-terminal amino acid sequencing of purified mature PilP protein. We predict that PilK, PilM, PilO, PilP, and PilT proteins function as the components of the pilin transport apparatus and thin-pilus basal body.

Cry4A is a dipteran-specific delta-endotoxin produced by Bacillus thuringiensis, and toxic to Culex pipiens (mosquito) larvae. The immunohistochemical staining of the midgut sections of C. pipiens larvae revealed that Cry4A bound in vitro and in vivo to the microvilli of the epithelial cells of posterior midgut and gastric caecae. The binding of digoxigenin-labeled Cry4A (DIG-Cry4A) to the apical microvilli was almost abolished in the presence of excess unlabeled Cry4A, suggesting that the binding of Cry4A to the microvilli was specific. Several Cry4A-specific binding proteins were detected using the ligand blotting technique with DIG-Cry4A. Moreover, an insertion assay was done, where the binding of DIG-Cry4A to the BBMVs was completely irreversible and did not compete with excess unlabeled Cry4A. On the basis of these results, we propose a schematic interpretation for the binding process of Cry4A.

Plasmid R64 pilQ gene is essential for the formation of thin pilus, a type IV pilus. The pilQ product contains NTP binding motifs and belongs to the PulE-VirB11 family of NTPases. The pilQ gene was overexpressed with an N-terminal His tag, and PilQ protein was purified. Purified His tag PilQ protein displayed ATPase activity with a V(max) of 0.71 nmol/min/mg of protein and a K(m) of 0.26 mm at pH 6.5. By gel filtration chromatography, PilQ protein was eluted at the position corresponding to 460 kDa, suggesting that PilQ protein forms a homooctamer. To analyze the relationship between structure and function of PilQ protein, amino acid substitutions were introduced within several conserved motifs. Among 11 missense mutants, 7 mutants exhibited various levels of reduced DNA transfer frequencies in liquid matings. Four mutant genes (T234I, K238Q, D263N, and H328A) were overexpressed with a His tag. The purified mutant PilQ proteins contained various levels of reduced ATPase activity. Three mutant PilQ proteins formed stable multimers similar to wild-type PilQ, whereas the PilQ D263N multimer was unstable. PilQ D263N monomer exhibited low ATPase activity, while PilQ D263N multimer did not. These results indicate that ATPase activity of the PilQ multimer is essential for R64 thin pilus biogenesis.

Abscisic acid (ABA) is a plant hormone involved in seed development and responses to various environmental stresses. Oxidation of abscisic aldehyde is the last step of ABA biosynthesis and is catalysed by aldehyde oxidase (EC 1.2.3.1). We have reported the occurrence of three isoforms of aldehyde oxidase, AOalpha, AObeta and AOgamma, in Arabidopsis thaliana seedlings, but none oxidized abscisic aldehyde. Here we report a new isoform, AOdelta, found in rosette leaf extracts, which efficiently oxidizes abscisic aldehyde. AO delta was specifically recognized by antibodies raised against a recombinant peptide encoded by AAO3, one of four Arabidopsis aldehyde oxidase genes (AAO1, AAO2, AAO3 and AAO4). Functionally expressed AAO3 protein in the yeast Pichia pastoris showed a substrate preference very similar to that of rosette AOdelta. These results indicate that AOdelta is encoded by AAO3. AOdelta produced in P. pastoris exhibited a very low Km value for abscisic aldehyde (0.51 microM), and the oxidation product was determined by gas chromatography-mass spectrometry to be ABA. Northern analysis showed that AAO3 mRNA is highly expressed in rosette leaves. When the rosette leaves were detached and exposed to dehydration, AAO3 mRNA expression increased rapidly within 3 h of the treatment. These results suggest that AOdelta, the AAO3 gene product, acts as an abscisic aldehyde oxidase in Arabidopsis rosette leaves.

A gene encoding embryonic chicken pepsinogen (ECPg), a zymogen of the digestive enzyme pepsin, is expressed specifically in epithelial cells of glands of embryonic stage proventriculus (glandular stomach) under the influence of mesenchyme. We found four GATA and one Sox binding motifs in 1.1 kb of the 5' flanking region of the ECPg gene which are essential to the organ-specific expression of the gene. The expression of cGATA-5 and cSox2 in the proventriculus from day 6 to day 12 of incubation was therefore analyzed. cGATA-5 was more strongly expressed in glandular epithelial cells than in luminal epithelial cells, while cSox2 gene expression was weaker in glandular epithelial cells. Using heterologous recombination explants we also discovered that the expression of cGATA-5 and cSox2 in epithelial cells was affected by mesenchyme when the latter induced ECPg gene expression in epithelial cells. Introduction of expression constructs into epithelial cells by electroporation demonstrated that cGATA-5 upregulated transcription of a reporter luciferase gene via a cis element in the 5' flanking region of the ECPg gene. The gel mobility shift assay revealed that the cGATA-5 protein specifically binds to the GATA binding sites. cSox2 downregulated the activity of luciferase but it was not through the Sox binding motif. These results suggest that cGATA-5 positively regulates transcription of the ECPg gene and is involved in spatial regulation of the pepsinogen gene during development., (Copyright 2000 Academic Press.)

Intercellular transfer of plasmid DNA during bacterial conjugation initiates and terminates at a specific origin of transfer, oriT. We have investigated the oriT structure of conjugative plasmid R64 with regard to the initiation and termination of DNA transfer. Using recombinant plasmids containing two tandemly repeated R64 oriT sequences with or without mutations, the subregions required for initiation and termination were determined by examining conjugation-mediated deletion between the repeated oriTs. The oriT subregion required for initiation was found to be identical to the 44-bp oriT core sequence consisting of two units, the conserved nick region sequence and the 17-bp repeat A sequence, that are recognized by R64 relaxosome proteins NikB and NikA, respectively. In contrast, the nick region sequence and two sets of inverted repeat sequences within the 92-bp minimal oriT sequence were required for efficient termination. Mutant repeat A sequences lacking NikA-binding ability were found to be sufficient for termination, suggesting that the inverted repeat structures are involved in the termination process. A duplication of the DNA segment between the repeated oriTs was also found after mobilization of the plasmid carrying initiation-deficient but termination-proficient oriT and initiation-proficient but termination-deficient oriT, suggesting that the 3' terminus of the transferred strand is elongated by rolling-circle-DNA synthesis.

The shufflon, a multiple DNA inversion system in plasmid R64, consists of four invertible DNA segments which are separated and flanked by seven 19-bp repeat sequences. The product of a site-specific recombinase gene, rci, promotes site-specific recombination between any two of the inverted 19-bp repeat sequences of the shufflon. To analyze the molecular mechanism of this recombination reaction, Rci protein was overproduced and purified. The purified Rci protein promoted the in vitro recombination reaction between the inverted 19-bp repeats of supercoiled DNA of a plasmid carrying segment A of the R64 shufflon. The recombination reaction was enhanced by the bacterial host factor HU. Gel electrophoretic analysis indicated that the Rci protein specifically binds to the DNA segments carrying the 19-bp sequences. The binding affinity of the Rci protein to the four shufflon segments as well as four synthetic 19-bp sequences differed greatly: among the four 19-bp repeat sequences, the repeat-a and -d sequences displayed higher affinity to Rci protein. These results suggest that the differences in the affinity of Rci protein for the 19-bp repeat sequences determine the inversion frequencies of the four segments.

The predicted amino acid sequences of the pilL and pilN genes, required for the thin pilus formation of IncI1 plasmids R64 and ColIb-P9, contain N-terminal lipoprotein signal peptide motifs. The pilL and pilN products were labeled with [(3)H]palmitic acid as 38- and 57-kDa proteins, respectively, indicating that they are lipoproteins. Both PilL and PilN were localized to the outer membrane., (Copyright 2000 Academic Press.)

The entire nucleotide sequence of the transfer region of IncI1 plasmid R64 was determined together with previously reported sequences. Twenty-two transfer genes, traE-Y and nuc, were newly identified in the present study. The protein products of 17 genes were detected by maxicell experiments or by the T7 RNA polymerase expression system. Mutagenesis experiments indicated that 16 genes were indispensable for R64 transfer both in liquid and on surfaces. In summary, the R64 transfer region located within an approximately 54 kb DNA segment was shown to encode the most complex transfer system so far studied. It contains at least 49 genes and may produce 58 different proteins as a result of shufflon DNA rearrangement and overlapping genes. Among the 49 genes, 23 tra, trb and nik genes have been shown to be indispensable for R64 conjugal transfer in liquid and on surfaces. Twelve additional pil genes are required only for liquid matings. The amino acid sequences of 10 R64 tra/trb products share similarity with those of the icm/dot products of Legionella pneumophila that are responsible for its virulence, suggesting that the R64 transfer and L. pneumophila icm/dot systems have evolved from a common ancestral genetic system.

Production of a large amount of insecticidal crystal proteins encoded on large plasmids is largely dependent upon the mother cell, Bacillus thuringiensis (B. thuringiensis, also Bt), specific transcription systems attributable to sporulation. In the middle stages of sporulation, cry4A is most actively transcribed from the promoter cry4A-P1. The proximal transcriptional start point of cry4A, which is under the control of the promoter P1, is used in Bacillus subtilis (B. subtilis) in the middle stage of sporulation. The nucleotide sequence that determines the cry4A-P1 promoter is homologous to the consensus sequence for the promoter of sigma E-specific genes in B. subtilis, and to those promoters of the insecticidal protein genes that are efficiently transcribed in vitro with the RNA polymerase E sigma 35 isolated from B. thuringiensis. The sigma factor sigma 35 of B. thuringiensis is highly homologous and functionally equivalent to sigma E of B. subtilis. These results suggest that the cry4A transcription from P1 is under the control of sigma E in B. subtilis, and under the control of sigma 35 in B. thuringiensis.

Dipteran-specific insecticidal protein Cry4A is produced as a protoxin of 130 kDa in Bacillus thuringiensis subsp. israelensis. Here we performed the in vitro processing of Cry4A and showed that the 130-kDa protoxin of Cry4A was processed into the two protease-resistant fragments of 20 and 45 kDa through the intramolecular cleavage of a 60-kDa intermediate. The processing into these two fragments was also observed in vivo. To investigate functional properties of the two fragments, GST (glutathione S-transferase) fusion proteins of the 60-kDa intermediate and the 20- and 45-kDa fragments were constructed. Neither the GST-20-kDa fusion protein (GST-20) nor the GST-45-kDa fusion protein (GST-45) was actively toxic against mosquito larvae of Culex pipiens, whereas the GST-60-kDa intermediate fusion protein (GST-60) exhibited significant toxicity. However, when the two fusion proteins GST-20 and GST-45 coexisted, significant toxicity was observed. The coprecipitation experiment demonstrated that the two fragments associated with each other. Therefore, it is strongly suggested that the two fragments formed an active complex of apparently 60 kDa. A mutant of the 60-kDa protein which was apparently resistant to the intramolecular cleavage with the midgut extract of C. pipiens larvae had toxicity slightly lower than that of GST-60.

Polyclonal antibodies were raised against synthetic peptides or recombinant polypeptides encoded by Arabidopsis atAO-1 and atAO-2 cDNAs, which have sequences similar to maize and animal aldehyde oxidase (AO) cDNAs. Anti-atAO-1 antibodies recognized AOalpha and AObeta among the three isoforms, AOalpha, AObeta, and AOgamma, detected in Arabidopsis seedlings after native PAGE, while anti-atAO-2 antibodies reacted with AObeta and AOgamma. The polypeptide specifically recognized by each antibody was collected as the Protein-A/IgG/antigen complex. The 150- and 145-kDa polypeptides were purified by SDS-PAGE and digested with Achromobacter Protease I. From the amino acid sequences and molecular masses of the derivative peptides, it was revealed that the 150- and 145-kDa polypeptides were the products of atAO-1 and atAO-2, respectively. Molecular masses of the native forms of AOalpha, AObeta, and AOgamma were estimated as approximately 290-300 kDa. These results suggest that AOalpha and AOgamma are homodimers consisting of atAO-1 and atAO-2 products, respectively, and that AObeta is a heterodimer of the atAO-1 and atAO-2 products.

The IncI1 plasmid R64 produces two kinds of sex pili: a thin pilus and a thick pilus. The thin pilus, which belongs to the type IV family, is required only for liquid matings. Fourteen genes, pilI to -V, were found in the DNA region responsible for the biogenesis of the R64 thin pilus (S.-R. Kim and T. Komano, J. Bacteriol. 179:3594-3603, 1997). In this study, we introduced frameshift mutations into each of the 14 pil genes to test their requirement for R64 thin pilus biogenesis. From the analyses of extracellular secretion of thin pili and transfer frequency in liquid matings, we found that 12 genes, pilK to -V, are required for the formation of the thin pilus. Complementation experiments excluded the possible polar effects of each mutation on the expression of downstream genes. Two genes, traBC, were previously shown to be required for the expression of the pil genes. In addition, the rci gene is responsible for modulating the structure and function of the R64 thin pilus via the DNA rearrangement of the shufflon. Altogether, 15 genes, traBC, pilK through pilV, and rci, are essential for R64 thin pilus formation and function.

Conservative site-specific recombination functions to create biological diversity in prokaryotes. Simple site-specific recombination systems consist of two recombination sites and a recombinase gene. The plasmid R64 shufflon contains seven recombination sites, which flank and separate four DNA segments. Site-specific recombinations mediated by the product of the rci gene between any two inverted recombination sites result in the inversion of four DNA segments independently or in groups. The shufflon functions as a biological switch to select one of seven C-terminal segments of the PilV proteins, which is a minor component of R64 thin pilus. The shufflon determines the recipient specificity in liquid matings of plasmid R64. Other multiple inversion systems as well as integrons, which are multiple insertion systems, are also described in this review.

The thin pili of IncI1 plasmid R64, which is required for conjugation in liquid media, belong to the type IV pilus family. They consist of a major subunit, the pilS product, and a minor component, one of the seven pilV products. The pilS product is first synthesized as a 22-kDa prepilin, processed to a 19-kDa mature pilin by the function of the pilU product, and then secreted outside the cell. The mature pilin is assembled to form a thin pilus with the pilV product. To reveal the relationship between the structure and function of the pilS product, 27 missense mutations, three N-terminal deletions, and two C-terminal deletions were constructed by PCR and site-directed mutagenesis. The characteristics of 32 mutant pilS products were analyzed. Four pilS mutant phenotype classes were identified. The products of 10 class I mutants were not processed by prepilin peptidase; the extracellular secretion of the products of two class II mutants was inhibited; from 11 class III mutants, thin pili with reduced activities in liquid mating were formed; from 9 class IV mutants, thin pili with mating activity similar to that of the wild-type pilS gene were formed. The point mutations of the class I mutants were distributed throughout the prepilin sequence, suggesting that processing of the pilS product requires the entire prepilin sequence.

To identify the roles of the two nucleotide-binding folds (NBFs) in the function of human P-glycoprotein, a multidrug transporter, we mutated the key lysine residues to methionines and the cysteine residues to alanines in the Walker A (WA) motifs (the core consensus sequence) in the NBFs. We examined the effects of these mutations on N-ethylmaleimide (NEM) and ATP binding, as well as on the vanadate-induced nucleotide trapping with 8-azido-[alpha-32P]ATP. Mutation of the WA lysine or NEM binding cysteine in either of the NBFs blocked vanadate-induced nucleotide trapping of P-glycoprotein. These results suggest that if one NBF is non-functional, there is no ATP hydrolysis even if the other functional NBF contains a bound nucleotide, further indicating the strong cooperation between the two NBFs of P-glycoprotein. However, we found that the effect of NEM modification at one NBF on ATP binding at the other NBF was not equivalent, suggesting a non-equivalency of the role of the two NBFs in P-glycoprotein function.

Thin pili of the closely related IncI1 plasmids ColIb-P9 and R64 are required only for liquid mating and belong to the type IV family of pili. They were sedimented by ultracentrifugation from culture medium in which Escherichia coli cells harboring ColIb-P9- or R64-derived plasmids had been grown, and then the pili were purified by CsCl density gradient centrifugation. In negatively stained thin pilus samples, long rods with a diameter of 6 nm, characteristic of type IV pili, were observed under an electron microscope. Gel electrophoretic analysis of purified ColIb-P9 thin pili indicated that thin pili consist of two kinds of proteins, pilin and the PilV protein. Pilin was demonstrated to be the product of the pilS gene. Pilin was first synthesized as a 22-kDa prepilin from the pilS gene and subsequently processed to a 19-kDa protein by the function of the pilU product. The N-terminal amino group of the processed protein was shown to be modified. The C-terminal segments of the pilV products vary among six or seven different types, as a result of shufflon DNA rearrangements of the pilV gene. These PilV proteins were revealed to comprise a minor component of thin pili. Formation of PilV-specific cell aggregates by ColIb-P9 and R64 thin pili was demonstrated and may play an important role in liquid mating.

We developed a sensitive, accurate, and fast method to detect foreign gene expression using reverse transcriptase-mediated polymerase chain reaction (RT-PCR) in poplar tree (Populus alba L.) protoplasts. Template total RNA was purified by removing the transfected foreign gene vector completely with DNase I treatment before the RT reaction. Expression of cDNA that encodes goat growth hormone was confirmed at the mRNA level 24 h after electroporation mediated DNA transfer.

In CFTR, a member of the ABC superfamily and a chloride channel, amino acid substitutions in its transmembrane domains 1 and 6 (TM1, TM6) have been reported to modulate the anion selectivity or ion conductance of the ion channel. In P-glycoprotein, no amino acid substitution in TM1, but some in TM6, have been reported to modify the substrate specificity of this protein. In this work, we demonstrated the involvement of His61, which is in the middle of the predicted TM1, in the function of P-glycoprotein. His61 was replaced by all other amino acid residues, and each of the mutant cDNAs was introduced into drug-sensitive human carcinoma cells, KB3-1. The drug-resistance profile of cells stably expressing each mutated P-glycoprotein was investigated by comparing their relative resistance to vinblastine, colchicine, VP16, and adriamycin. The resistance to vinblastine was increased by replacing His61 by amino acids with smaller side chains, while it was lowered by replacing by amino acids with bulkier side chains. The reverse effect was observed for resistance to colchicine and VP16. The resistance to adriamycin was increased by replacing by amino acids with bulkier side chains except Lys or Arg, which have a basic side chain. We also showed that the replacement of His61 by Phe and Lys greatly impaired the efflux of calcein AM, while the replacement had no effect on the efflux of rhodamine 123. These results suggest that an amino acid residue at position 61 in TM1 is important in deciding the substrate specificity of P-glycoprotein.

Multidrug resistance-associated protein (MRP), a member of the ABC superfamily transporters, functions as an ATP-dependent efflux pump that extrudes cytotoxic drugs from the cells. Although glutathione has been considered to play an important role in the function of MRP, there is no convincing evidence that glutathione directly interacts with MRP. Here we demonstrate that vanadate-induced trapping of 8-azido-ATP in MRP was stimulated in the presence of glutathione, oxidized glutathione and the anti-cancer drugs VP-16 and vincristine. MRP in membrane from a human MRP cDNA transformant was specifically photolabeled with 8-azido-[alpha-32P]ATP by the vanadate-trapping technique. Vanadate and Mg2+ were required for trapping of nucleotides, and vanadate trapping of nucleotides was inhibited by excess ADP as well as ATP. These results suggest that a stable inhibitory complex MRP x MgADP x Vi, an analog of the MRP x MgADP x Pi transition state complex, is formed in the presence of vanadate. Glutathione as well as anti-cancer drugs would directly interact with MRP, and stimulate the formation of the transition state of the ATPase reaction of MRP.

The sog gene of the IncI1 plasmid R64 was sequenced and characterized. The sog gene was shown to express two acidic proteins, SogL and SogS, with 1255 and 844 amino acid residues, respectively. The SogS protein was expressed by translational reinitiation within the SogL reading frame. Analysis of dnaG-suppression activity using the Escherichia coli dnaG strain indicated that the domain for this activity was located within the N-terminal one-third segment of the SogL protein. A Deltasog mutation was constructed by replacing most of the sog coding sequence with a DNA fragment encoding a tetracycline resistance gene. Introduction of the Deltasog mutation into an R64 derivative resulted in approximately a 50-fold reduction in transfer frequency. It was observed that only a limited portion of the SogL or SogS protein corresponding to an internal 0.94-kb EcoRV-SnaBI segment of the sog gene was required for the conjugal transfer of R64.

The human MDR1 gene encodes the multidrug transporter P-glycoprotein (Pgp). Although the MDR2/Pgp shares about 80% identity at the amino acid level with the MDR1/Pgp, the MDR2/Pgp cannot act as a multidrug transporter. We examined the drug sensitivity of Saccharomyces cerevisiae expressing either the human MDR1/Pgp or MDR2/ Pgp. The human MDR1/Pgp conferred about 4-fold resistance to aureobasidin A, a cyclic depsipeptide antifungal antibiotic, on the drug-sensitive yeast strains. Interestingly the human MDR2/Pgp also conferred about 2.5-fold resistance to aureobasidin A. The resistance to aureobasidin A conferred by the MDR2/Pgp as well as by the MDR1/Pgp was overcome by vinblastine, verapamil, and cyclosporin A, depending on their concentrations, but not by colchicine. Aureobasidin A probably interacts directly with Pgps, because it overcame multidrug resistance of human cells and inhibited azidopine photoaffinity labeling of MDR1/Pgp in human cell membranes. These results suggest the possibility that the human MDR1 and MDR2/Pgps have conserved domain(s) for drug recognition.

A new developmental gene, fruA, of Myxococcus xanthus was cloned using a one-step cloning vector, TnV. DNA sequencing of the wild-type allele of the fruA gene indicated that the fruA gene encodes a protein of 229 amino acid residues with a calculated molecular weight of 24672. The deduced amino acid sequence of FruA protein showed similarity to those of many bacterial regulatory proteins carrying a DNA-binding helix-turn-helix motif. The transcription-initiation site of the fruA gene was determined by a primer-extension experiment. Development of M. xanthus cells with a disrupted fruA gene stopped at the stage of mound formation. Although cells were able to aggregate to form mounds, myxospores were not formed. By Northern and Western blot analysis, it was found that the fruA expression was not detected during vegetative growth but initiated at around 6 h and reached the highest level at 12 h after the onset of development. Expression of the fruA gene was dependent on the expression of asg, bsg, csg, dsg, and esg genes, indicating that a series of intercellular signalling is necessary for the expression of the fruA gene. The effects of the fruA mutation on beta-galactosidase expression of various developmentally regulated genes fused with the lacZ gene were analysed; three developmental lacZ fusions (omega 4469, omega 4273 and omega 4500) were either poorly induced or not induced at all, while three other lacZ fusions (omega 4408, omega 4521 and omega 4455) expressed at the early stage of development were normally induced but were unable to be repressed at a later stage of development as in the wild-type strain. Interestingly, in the fruA mutant, tps (the gene for protein S) was not activated. From these results together with analysis of the amino acid sequence of FruA, we propose that FruA is a putative transcription factor required for the development of M.xanthus.

Coxsackievirus 3C proteinase (3Cpro) cleaves between Gln and Gly, but additional amino acids are required to constitute a cleavage site. To investigate the additional sequence requirements, cleavages of the peptide substrate, and its derivatives were examined. Substitutions of each residue from the P2 to P5 positions showed the importance of the P2 Phe and P4 Ala for recognition by 3Cpro.

Bacterial plasmids of Escherichia coli incompatibility group Q (IncQ) are broad-host-range plasmids that are able to proliferate in almost all Gram-negative bacteria. They are small, nonconjugative, and multicopy plasmids. They can be mobilized into many species of Gram-negative bacteria by coresident conjugative plasmids. Plasmids RSF1010, R1162, and R300B have DNAs of a size of 8.7 kb, and are best studied among IncQ plasmids. These plasmids encode by themselves three major proteins essential for the initiation of DNA replication. This makes the plasmid DNA replication less dependent on the DNA replication apparatus of host cells, and leads to promiscuity or a broad host range. Considering the biological features of these plasmids, they are potent DNA cloning vehicles. Moreover, their characteristic DNA replication mechanism that makes IncQ plasmids promiscuous is elaborate, and is an interesting object of scientific studies.

The catalytic domain (sGnT-I) of rat liver N-acetylglucosaminyl-transferase I (GnT-I) was expressed in Escherichia coli. Lysates from pETsGnT-I transformants contained a prominent protein species of 46 kDa with which a significant GnT-I activity was associated. To purify the relevant enzyme, we constructed cDNAs encoding sGnT-ICH and sGnT-INH, which had six additional histidine residues as an affinity tag at the C-terminal and the N-terminal of sGnT-I, respectively, and introduced them into E. coli cells for expression. sGnT-INH was purified and its enzymatic properties were examined.

The replication origin of the broad host-range plasmid RSF1010 contains 3.5 copies of a 20mer iteron sequence that bind specifically to the plasmid-encoded initiator, RepC. Here we demonstrated that even a single iteron was bent upon binding of RepC. Moreover, the bending angle seems to become larger along with the increment of the number of iterons. In a mutational analysis of the iteron sequence, we isolated seven kinds of base-substitution mutants of iterons, and estimated the replication activity of these mutants in vivo. We found that each of the subsections in the 20mer iteron sequence made a distinct contribution to the initiation of RSF1010 DNA replication. With the binding assay of RepC and mutated iterons in vitro, we found that the formation of a productive RepC-iteron complex was required for the initiation of plasmid DNA replication.

To analyze the functional contribution to the ssiA function of subsections of the ssiA-determinant sequence based on their dimensions, we constructed ssiA mutants carrying insertions and deletions. Results of the examination of the ssiA mutants told us that, in addition to the base sequence, the dimensions were crucial factors for the functional contribution of the subsections of ssiA.

We cloned four kinds of goat insulin-like growth factor-I (IGF-I) cDNAs. Each of them encodes the same mature IGF-I and different signal peptides. In this study, we analyzed expression of the four kinds of mRNAs in tissues in various developmental stages by a reverse transcriptase-polymerase chain reaction assay. The results suggest that their expression may be controlled by different promoters, the activities of which are tissue- and development-specific.

To investigate the mechanism of transcriptional regulation of cryIVA and cryIVB, encoding 130-kDa dipteran-active crystal proteins, in Bacillus thuringiensis subsp. israelensis, we introduced each gene into several sporulation mutants of Bacillus subtilis. A spoIIG mutation, the wild-type gene of which encodes sigma E precursor, completely blocked the cryIVB transcription. In contrast, low but detectable transcription of cryIVA was observed in the spoIIG mutant. In the wild-type B. subtilis, no transcription of cryIVB was detected before T2 (2 h after the onset of stationary phase), while the cryIVA transcription started at the late exponential phase at low levels. Furthermore, in a wild-type strain of B. thuringiensis subsp. israelensis, transcription of cryIVA began earlier than that of genes encoding other crystal components, cryIVB and cytA. A consensus sequence recognized by an RNA polymerase containing sigma H of B. subtilis was found upstream of the transcription start point of cryIVA, which overlapped with that recognized by sigma E.

The SpoIIID protein of Bacillus subtilis (Bs) is a small DNA-binding protein that is essential for gene expression of the mother cell compartment during sporulation. We have cloned a DNA fragment from Bacillus thuringiensis (Bt) that showed a specific hybridization with the Bs spoIIID gene. Sequence analysis found an open reading frame encoding 90 amino acids (aa), which are 89% identical to the deduced aa sequence of Bs spoIIID. Upstream from the transcription start point (tsp), a nucleotide sequence highly homologous to the consensus sequence motif for the sigma 35-recognized promoters was found. Northern blot analysis has indicated that the expression of the gene is induced only at the midsporulation stage, and that the gene constitutes an operon with a downstream gene, mreB. The Bs strain carrying the spoIIID delta erm or spoIIID83 mutation completely restored sporulation ability upon introduction of the spoIIID homologous gene from Bt. These results strongly suggest that the gene we have cloned is a Bt homolog of spoIIID.

Goat IGF-I (gIGF-I) cDNA was cloned using the reverse transcriptase-polymerase chain reaction (RT-PCR). The cDNA, which was homologous to rat class 1 IGF-I cDNA, was 969 bp long. From the open reading frame found in it, we predicted a 154 amino acid protein consisting of a 49 amino acid signal peptide, a 70 amino acid mature IGF-I peptide, and a 35 amino acid E domain (the COOH-terminal peptide). From the gIGF-I gene, we isolated and sequenced some segments containing four exons that encompassed the entire gIGF-I cDNA sequence. Goat liver RNA was analyzed by RT-PCR, and the nucleotides of the RT-PCR products were sequenced and checked with the nucleotide sequences of the segments from the gIGF-I gene. The gene had three leader exons (1W, 1, and 2, from upstream to downstream) and was transcribed into three kinds of mRNAs (classes 1W, 1, and 2). Another RNA species was detected by RT-PCR analysis of exon 1W. We sequenced it and found that in this transcript, the 3'-portion of exon 1 was inserted between exons 1W and 3, resulting in class 1W-1 del. mRNA. That is to say, the gIGF-I gene had three leader exons and four kinds of mature mRNA.

Single amino acid substitutions were introduced into the putative substrate-binding site of 3C proteinase (3Cpro) of coxsackievirus B3, a member of the picornavirus family. Mutations at either Thr142, His161, Gly164, Gly169, or Ala172 severely impaired or abolished the proteolytic activity except that a conservative Thr142 to Ser mutant had detectable activity. These results, which have shown the participation of the 5 residues in 3Cpro activity, are consistent with the earlier predictions that these residues might be involved in substrate binding.

The shufflon is a unique DNA rearrangement found in plasmid R64. R64 shufflon consists of four DNA segments, which are flanked and separated by seven 19-bp repeat sequences. Site-specific recombination between any inverted repeats results in a complex DNA rearrangement where four DNA segments invert independently or in groups. The shufflon is a biological switch to select one of the seven C-terminal segments of the pilV gene. To examine the biological significance of the shufflon, R64 derivatives, where the pilV gene was fixed in seven C-terminal segments, were constructed and used as donor cells for liquid mating. The transfer frequencies depended markedly on the combinations of recipient bacterial strains and C-terminal segments of the pilV gene in donor cells, indicating that the shufflon determines the recipient specificity in liquid mating of R64. The products of the pilV genes were found to be a component of thin pili produced by R64.

There are five amino acid sequences highly conserved among Bacillus thuringiensis delta-endotoxins. We have changed the amino acid residues in block 5, one of the conserved sequences, of CryIVA. When the amino acid residues with charged side chains were replaced by others, the amount of production of the altered CryIVA protein was markedly decreased. It is suggested that the decrease is caused by the unstable conformation of the altered CryIVA protein molecule, as judged by digestion with trypsin and thermolysin. On the other hand, the substitution of amino acid residues in block 5 did not affect the insecticidal activity of CryIVA. These results strongly suggest that block 5 of CryIVA is one of the stability-determining elements of the protoxin molecule.

We have cloned and sequenced the exc gene determining surface exclusion of IncI1 plasmid R64. R64 exc gene is highly homologous to the R144 exc gene. The R64 exc gene may encode two proteins with 220 and 147 amino acid residues by inframe reinitiation of translation, as the R144 exc gene does, while the larger protein with 220 amino acids was shown to be essential for surface exclusion function. R64 derivatives carrying deletion or insertion mutations in the exc gene transferred at a frequency similar to that of wild-type R64, indicating that the exc gene is not essential for the transfer of R64.

The broad host-range plasmid RSF1010 contains two oppositely oriented priming signals, ssiA and ssiB, for DNA synthesis dependent on the origin of vegetative DNA replication (oriV). If either ssiA or ssiB was deleted or inverted, the RSF1010 miniplasmids containing engineered oriVs were maintained at low copy numbers, replicated abnormally as dimers, and accumulated specific single strands in the Escherichia coli strain supplying the three RSF1010-encoded RepA, RepB', and RepC proteins. Interestingly, an additional intracellular supply of the Sog primase (the sog gene product of plasmid CoIIb-P9) reversed the replication deficiency of these miniplasmids with respect to all three aspects described above. These were also true for the RSF1010 miniplasmids in which either ssiA or ssiB was replaced by the primosome assembly site (PAS) or by the G4-type ssi signal (G site). Furthermore, comparative analysis of the functional contribution of the two oppositely oriented ssi signals to the DNA replication of RSF1010 showed that, irrespective of their types, ssi signals conducting the initiation of DNA chain elongation away from the iterons were functionally more important than ones in the inverted orientation. We consider that this functional difference reflects the inherent properties of the initiation mechanism of RSF1010 DNA replication.

The broad host range plasmid RSF1010 requires for its replication in Escherichia coli three plasmid-encoded proteins and specific nucleotide sequences ssiA, ssiB, and iterons in the oriVRSF1010. In Pseudomonas aeruginosa, a recombinant mini-RSF1010 plasmid lacking ssiB lost its replication ability, but a miniplasmid lacking ssiA or carrying a primosome assembly site in place of ssiA could replicate. Moreover, ssiA, as a sole ssi signal, in the orientation that ssiB had originally taken was sufficient for replication of the miniplasmid. These results indicated that only one RSF1010-specific ssi signal in the orientation that ssiB takes in wild-type oriVRSF1010 was essential for replication of RSF1010. Replication of the miniplasmids was dependent on the three plasmid-encoded proteins, RepA, B', and C, as in E. coli.

We isolated a cDNA of N-acetylglucosaminyltransferase I (GnT-I) from rat liver and analyzed GnT-I mRNA expression in several rat tissues. We found that GnT-I mRNA was expressed in a tissue-specific manner and the pattern of its expression was suggested to be species-specific by comparison with the reported result in mice.

To analyze the mechanism of drug transport, mechanism of inhibitors, and physiological substrates of human P-glycoprotein, we established a transepithelial transport system by introducing MDR1 cDNA into LLC-PK1, a pig kidney epithelial cell line. P-glycoprotein functions as a steroid transporter as well as a drug transporter as physiological functions. P-glycoprotein also transports MDR modulators such as cyclosporin A, FK506, and calcium channel blockers.

The two single-strand DNA initiation signals, ssiA(RSF1010) and ssiB(RSF1010) of the broad host-range plasmid RSF1010 contain proposed stem-loop structures. Nine single base-change mutations in the stem of the ssiA structure, each of which destroyed a relevant base pairing, damaged the ssiA activity. A second single-base change was introduced into each of the nine ssiA mutants in such a way that the base pairing was restored. Only three out of nine second base changes that restored the base pairing restored the ssiA activity up to the wild-type level. Thus, the three are intramolecular suppressors. The results strongly suggested that, in the area of the stem of ssiA where the suppressor mutations fell, base pairing was the most important structural parameter for the ssiA activity. By contrast, it is most probable that, in the other part of the stem of ssiA, both base-pairing and the intrinsic base sequence were the major determinants of the ssiA activity.

Human MDR1 cDNA was introduced into the human cultured cells KB-3-1 and Schizosaccharomyces pombe pmd1 null mutant KN3. The drug sensitivity of KB-G2 and KN3/pgp, expressing human P-glycoprotein, was examined. KB-G2 was resistant to the peptide antibiotics valinomycin and gramicidin D as well as having a typical multidrug resistance (MDR) phenotype. KN3/pgp was resistant to valinomycin and actinomycin D, but not to adriamycin. The ATP-hydrolysis-deficient mutant did not confer KN3 resistance to these antibiotics. Human P-glycoprotein expressed in S. pombe seemed to lack N-glycosylation. The N-glycosylation-deficient mutant, however, conferred a typical MDR phenotype on KB-3-1. These results suggest that human P-glycoprotein functions as an efflux pump of valinomycin and actinomycin D in the membrane of S. pombe.

Understanding of the interactions between P-glycoprotein and multidrug resistance (MDR) reversing agents is important in designing more effective MDR modulators. We examined transcellular transport of several MDR modulators by using a drug-sensitive epithelial cell line, LLC-PK1, and its transformant cell line, LLC-GA5-COL300, which expresses human P-glycoprotein on the apical surface. Basal-to-apical transports of azidopine and diltiazem across the LLC-GA5-COL300 monolayer were increased and apical-to-basal transports were decreased compared to those across the LLC-PK1 monolayer, indicating that P-glycoprotein transports azidopine and diltiazem. Movements of nitrendipine and staurosporine across the epithelial monolayer were not affected by P-glycoprotein. These results suggests that some MDR modulators exert their inhibitory effect not only by blocking the initial binding of anticancer drugs but throughout the course of the transport process.

To analyze the RSF1010-specific priming mechanism, a library of randomly mutagenized ssiA sequences was constructed by chemical synthesis using mixed nucleotide phosphoramidites. Synthetic ssiA sequences with the single base-substitutions were assayed for the SSI activity in E. coli JM109 expressing RepB' primase. It was demonstrated that the activity of ssiA was damaged markedly by single base-substitutions within the possible stem-loop structure and its 3'-flanking region. It is conceivable that these domains are critical in recognition and primer synthesis by RepB' primase.

The cryIVA gene encodes a component of the delta-endotoxin of Bacillus thuringiensis subsp. israelensis. By S1 nuclease mapping and primer extension analysis, we have identified the transcriptional initiation site of cryIVA. The transcriptional activity from the promoter was detected only for the sporulating cells more than 3 h after onset of the stationary phase. Upstream from the cryIVA transcriptional initiation site was found a nucleotide sequence partially homologous to the promoter consensus sequence for the E sigma E holoenzyme of Bacillus subtilis. Thus, it was strongly suggested that the identified cryIVA promoter, like some other crystal protein gene promoters, was under the control of sigma 35, the B. thuringiensis homolog of sigma E.

To delineate the mosquitocidal regions of the ISRH3 (CryIVB) and ISRH4 (CryIVA) proteins, which are two of the mosquitocidal 130-kDa proteins contained in the crystalline protein bodies (CPBs) of Bacillus thuringiensis var. israelensis (BTI), a deletion analysis of these protein genes has been done. Based on the evidence that each 130-kDa protein had two mosquitocidal regions, N-terminal and C-terminal ones, and these two regions shared a common part in the center of the 130-kDa proteins, deleted genes on this region were constructed. As the protein products which lacked the central region had reduced activities, the central region could be important for the mosquitocidal activity. The mosquitocidal and non-mosquitocidal truncated gene products of 130-kDa protein genes were also applied to a cultured lepidopteran cell line, TN-368. The mosquitocidal proteins caused the swelling and disruption of the cells in spite of the insecticidal specificity of CPBs of BTI, but the non-mosquitocidal proteins did not. Therefore, TN-368 cells were sensitive to the mosquitocidal fragments of 130-kDa proteins of BTI under the assay conditions used.