Search

The two major histopathologic hallmarks of Alzheimer's disease (AD) are amyloid beta protein (Aβ) plaques and neurofibrillary tangles (NFT). Aβ pathology is a common feature in the aged nonhuman primate brain, whereas NFT are found almost exclusively in humans. Few studies have examined AD-related pathology in great apes, which are the closest phylogenetic relatives of humans. In the present study, we examined Aβ and tau-like lesions in the neocortex and hippocampus of aged male and female western lowland gorillas using immunohistochemistry and histochemistry. Analysis revealed an age-related increase in Aβ-immunoreactive plaques and vasculature in the gorilla brain. Aβ plaques were more abundant in the neocortex and hippocampus of females, whereas Aβ-positive blood vessels were more widespread in male gorillas. Plaques were also Aβ40-, Aβ42-, and Aβ oligomer-immunoreactive, but only weakly thioflavine S- or 6-CN-PiB-positive in both sexes, indicative of the less fibrillar (diffuse) nature of Aβ plaques in gorillas. Although phosphorylated neurofilament immunostaining revealed a few dystrophic neurites and neurons, choline acetyltransferase-immunoreactive fibers were not dystrophic. Neurons stained for the tau marker Alz50 were found in the neocortex and hippocampus of gorillas at all ages. Occasional Alz50-, MC1-, and AT8-immunoreactive astrocyte and oligodendrocyte coiled bodies and neuritic clusters were seen in the neocortex and hippocampus of the oldest gorillas. This study demonstrates the spontaneous presence of both Aβ plaques and tau-like lesions in the neocortex and hippocampus in old male and female western lowland gorillas, placing this species at relevance in the context of AD research.

Decreases in testosterone and 17β-oestradiol (E(2)) are associated with an increased risk for Alzheimer's disease (AD), which has been attributed to an increase in β-amyloid and tau pathological lesions. Although recent studies have used transgenic animal models to test the effects of sex steroid manipulations on AD-like pathology, almost none have systematically characterised the associations between AD lesions and sex steroid levels in the blood or brain in any mutant model. The present study evaluated age-related changes in testosterone and E(2) concentrations, as well as androgen receptor (AR) and oestrogen receptor (ER) α and β expression, in brain regions displaying AD pathology in intact male and female 3xTgAD and nontransgenic (ntg) mice. We report for the first time that circulating and brain testosterone levels significantly increase in male 3xTgAD mice with age, but without changes in AR-immunoreactive (IR) cell number in the hippocampal CA1 or medial amygdala. The age-related increase in hippocampal testosterone levels correlated positively with increases in the conformational tau isoform, Alz50. These data suggest that the over-expression of human tau up-regulate the hypothalamic-pituitary-gonadal axis in these mice. Although circulating and brain E(2) levels remained stable with age in both male and female 3xTgAD and ntg mice, ER-IR cell number in the hippocampus and medial amygdala decreased with age in female transgenic mice. Furthermore, E(2) levels were significantly higher in the hippocampus than in serum, suggesting local production of E(2). Although triple transgenic mice mimic AD-like pathology, they do not fully replicate changes in human sex steroid levels, and may not be the best model for studying the effects of sex steroids on AD lesions.

The presence of Alzheimer's disease (AD)-related neuropathology among cognitively normal individuals has been well documented. It has been proposed that these individuals may represent a pre-clinical AD population. Previous studies have demonstrated a negative association between the presence of both amyloid-β (Aβ) plaques and neurofibrillary tangles with ante-mortem cognitive performance, a relationship which is likely influenced by a number of factors including age and APOE ɛ4 carrier status. The present study determined whether the presence of neuritic plaques (NPs) and diffuse plaques (DPs) are associated with performance in a number of cognitive domains after accounting for APOE ɛ4 carrier status and neurofibrillary tangle presence in a cohort of 123 older participants from the Rush Religious Order Study who died with a premortem clinical diagnosis of no cognitive impairment (NCI). After adjusting for age at death, education, gender, Braak stage, and APOE ɛ4 carrier status, the presence of NPs was associated with lower performance in the cognitive domains of Global Cognition (p = 0.002), Episodic Memory (p = 0.03), Semantic Memory (p = 0.009), and Visuospatial performance (p = 0.006), while DPs showed no association with any cognitive domain examined. These results suggest that decreases in cognition in elderly NCI individuals are associated with an increase in NPs and not DPs when age at death, education, gender, APOE ɛ4 status, and Braak stage are taken into consideration.

Central cholinergic structures within the brain of the even-toed hoofed Goettingen miniature domestic pig (Sus scrofa domesticus) were evaluated by immunohistochemical visualization of choline acetyltransferase (ChAT) and the low-affinity neurotrophin receptor, p75NTR. ChAT immunoreactive (-ir) perikarya were seen in the olfactory tubercle, striatum, medial septal nucleus, vertical and horizontal limbs of the diagonal band of Broca and the nucleus basalis of Meynert, medial habenular nucleus, zona incerta, neurosecretory arcuate nucleus, cranial motor nuclei III and IV, Edinger-Westphal nucleus, parabigeminal nucleus, pedunculopontine nucleus and laterodorsal tegmental nucleus. Cholinergic ChAT-ir neurons were also found within transitional cortical areas (insular, cingulate, and piriform cortices) and hippocampus proper. ChAT-ir fibers were seen throughout the dentate gyrus and hippocampus, in the mediodorsal, laterodorsal, anteroventral and parateanial thalamic nuclei, the fasciculus retroflexus of Meynert, basolateral and basomedial amygdaloid nuclei, anterior pretectal and interpeduncular nuclei, as well as select laminae of the superior colliculus. Double immunofluorescence demonstrated that virtually all ChAT-ir basal forebrain neurons were also p75NTR positive. The present findings indicate that the central cholinergic system in the miniature pig is similar to other mammalian species. Therefore, the miniature pig may be an appropriate animal model for preclinical studies of neurodegenerative diseases where the cholinergic system is compromised.

Amyloid beta (Aβ) and tau pathology have been described in the brains of captive aged great apes, but the natural progression of these age-related pathologies from wild great apes, including the gorilla, is unknown. In our previous study of Western lowland gorillas (Gorilla gorilla gorilla) who were housed in American Zoos and Aquariums-accredited facilities, we found an age-related increase in Aβ-positive plaques and vasculature, tau-positive astrocytes, oligodendrocyte coiled bodies, and neuritic clusters in the neocortex as well as hippocampus in older animals. Here, we demonstrate that aged wild mountain gorillas (Gorilla beringei beringei), who spent their entire lives in their natural habitat, also display an age-related increase in amyloid precursor protein (APP) and/or Aβ-immunoreactive blood vessels and plaques, but very limited tau pathology, in the frontal cortex. These results indicate that Aβ and tau lesions are age-related events that occur in the brain of gorillas living in captivity and in the wild.

Amyloid-β (Aβ) plaques occur in close apposition to thickened or swollen cholinergic and galaninergic neurites within the neocortex and hippocampus in Alzheimer’s disease (AD). Despite this observation, the effect of Aβ deposition upon cholinergic and galaninergic dystrophic neurite formation remains unclear. Therefore, the purpose of this study was to evaluate the interaction between Aβ deposition within the neocortex and hippocampus upon cholinergic and galaninergic dystrophic neurite formation. Neocortical and hippocampal tissue harvested from 3- and 12-month-old amyloid-β protein precursor (AβPP)swe/PS1ΔE9 transgenic (tg) mice were dual-immunolabeled with antibodies against either choline acetyltransferace (ChAT) and Aβ (10D5) or galanin (Gal) and Aβ. Stereology was used to quantify amyloid plaques and cholinergic or galaninergic dystrophic neurites. Plaque number was assessed using the optical fractionator; plaque area was calculated with the Cavalieri estimator, and dystrophic neurite numbers and thickness were manually measured. Neither amyloid nor dystrophic neuritic profiles were seen in the brains of 3-month-old tg mice. In contrast, quantitative analysis revealed significantly more plaques in neocortex than hippocampus, with no difference in regional plaque size in 12-month-old tg mice. Significantly more cholinergic than galaninergic dystrophic neurites-per-plaque occurred in the neocortex and hippocampus. Additionally, cholinergic dystrophic neurites were thicker than galaninergic dystrophic neurites in both regions. These data suggest that amyloid plaque deposition has a greater impact upon cholinergic than galaninergic dystrophic neurite formation in the neocortex and hippocampus in AβPPswe/PS1ΔE9 tg mice. These data are also compatible with the hypothesis that galanin is neuroprotective and reduces dystrophic neurite formation in the face of amyloid toxicity.

Alzheimer's disease (AD) is characterized by a progressive phenotypic downregulation of markers within cholinergic basal forebrain (CBF) neurons, frank CBF cell loss and reduced cortical choline acetyltransferase activity associated with cognitive decline. Delaying CBF neurodegeneration or minimizing its consequences is the mechanism of action for most currently available drug treatments for cognitive dysfunction in AD. Growing evidence suggests that imbalances in the expression of NGF, its precursor proNGF and the high (TrkA) and low (p75(NTR)) affinity NGF receptors are crucial factors underlying CBF dysfunction in AD. Drugs that maintain a homeostatic balance between TrkA and p75(NTR) may slow the onset of AD. A NGF gene therapy trial reduced cognitive decline and stimulated cholinergic fiber growth in humans with mild AD. Drugs treating the multiple pathologies and clinical symptoms in AD (e.g., M1 cholinoceptor and/or galaninergic drugs) should be considered for a more comprehensive treatment approach for cholinergic dysfunction.

Galanin (GAL) and GAL receptors (GALRs) are overexpressed in degenerating brain regions associated with cognitive decline in Alzheimer’s disease (AD). The functional consequences of GAL plasticity in AD are unclear. GAL inhibits cholinergic transmission in the hippocampus and impairs spatial memory in rodent models, suggesting GAL overexpression exacerbates cognitive impairment in AD. By contrast, gene expression profiling of individual cholinergic basal forebrain (CBF) neurons aspirated from AD tissue revealed that GAL hyperinnervation positively regulatesmRNAs that promote CBF neuronal function and survival. GAL also exerts neuroprotective effects in rodent models of neurotoxicity. These data support the growing concept that GAL overexpression preserves CBF neuron function which in turn may slow the onset of AD symptoms. Further elucidation of GAL activity in selectively vulnerable brain regions will help gauge the therapeutic potential of GALR ligands for the treatment of AD. (Part of a Multi-author Review)

Endosomal-lysosomal and autophagic dysregulation occurs in the hippocampus in prodromal Alzheimer disease (AD), but its relationship with β-amyloid (Aβ) and tau pathology remains unclear. To investigate this issue, we performed immunoblot analysis of hippocampal homogenates from cases with an antemortem clinical diagnosis of no cognitive impairment, mild cognitive impairment (MCI), and AD. Western blot analysis revealed significant increases in the acid hydrolase cathepsin D and early endosome marker rabaptin5 in the MCI group compared with AD, whereas levels of phosphorylated mammalian target of rapamycin proteins (pmTOR), total mammalian target of rapamycin (mTOR), p62, traf6, and LilrB2 were comparable across clinical groups. Hippocampal Aβ1-40 and Aβ1-42 concentrations and AT8-immunopositive neurofibrillary tangle density were not significantly different across the clinical groups. Greater cathepsin D expression was associated with global cognitive score and episodic memory score but not with mini mental state examination or advanced neuropathology criteria. These results indicate that alterations in hippocampal endosomal-lysosomal proteins in MCI are independent of tau or Aβ pathology.

The neuropeptide galanin (GAL) is widely distributed in the mammalian CNS. Several lines of evidence suggest that GAL may play a critical role in cognitive processes such as memory and attention through an inhibitory modulation of cholinergic basal forebrain activity. Furthermore, GAL fibers hyperinnervate remaining cholinergic basal forebrain neurons in Alzheimer's disease (AD). This suggests that GAL activity impacts cholinergic dysfunction in advanced AD. Pharmacological and in vitro autoradiographic studies indicate the presence of heterogeneous populations of GAL receptor (GALR) sites in the basal forebrain which bind GAL with both high and low affinity. Interestingly, we have recently observed that GALR binding sites increase in the anterior basal forebrain in late-stage AD. Three G protein-coupled GALRs have been identified to date that signal through a diverse array of effector pathways in vitro, including adenylyl cyclase inhibition and phospholipase C activation. The repertoire and distribution of GALR expression in the basal forebrain remains unknown, as does the nature of GAL and GALR plasticity in the AD basal forebrain. Recently, GAL knockout and overexpressing transgenic mice have been generated to facilitate our understanding of GAL activity in basal forebrain function. GAL knockout mice result in fewer cholinergic basal forebrain neurons and memory deficits. On the other hand, mice overexpressing GAL display hyperinnervation of basal forebrain and memory deficits. These data highlight the need to explore further the putative mechanisms by which GAL signaling might be beneficial or deleterious for cholinergic cell survival and activity within basal forebrain. This information will be critical to understanding whether pharmacological manipulation of GALRs would be effective for the amelioration of cognitive deficits in AD.

Galanin (GAL) is a biologically active 29 amino acid (30 in humans) which participates in the modulation of several ascending neurotransmitter systems including cholinergic basal forebrain (CBF) neurons, which undergo extensive degeneration in Alzheimer's disease (AD). GAL immunoreactive fibers within the CBF display hypertrophy and hyperinnervate surviving CBF neurons in late AD. Over the years, this unique neuronal plasticity response has been an active area of research for our group. We have examined tissue from a clinically well characterized cohort of retired elderly clergy to determine whether people with mild cognitive impairment display GAL hyperinnervation upon CBF neurons. We found that GAL hyperinnervation is a late stage event and that CBF neuron reduction is not correlated with GAL over expression during prodromal AD. Interestingly, findings from our laboratory using tau immunohistochemistry and single cell gene array technologies suggest that GAL remodeling may influence neurofibrillary tangle formation by altering tau phosphorylation events in CBF neurons in AD. Studies using GAL-tg mice suggest that GAL over expression reduces the cholinergic phenotype but does not produce a frank loss of CBF cells. This phenotypic down regulation of ChAT is reminiscent of the lack of a frank CBF neuron loss in prodromal AD. Moreover, studies using mice transgenic for both the amyloid precursor protein (APP) and presenilin-1 (PS1) bearing AD-related mutations (APPswe/PS1Δ9) displayed increased GAL immunoreactive fibers, neurities and plaques in cortex and hippocampus. These fin'dings provide evidence for a mechanistic relationship between amyloidosis and GAL over expression in AD. Understanding GALs role in the clinical and pathological features of AD, may lead to novel drug treatments for this disease.

The present study used single and dual immunohistochemistry to determine the topography and chemical phenotype of ERalpha containing neurons within the monkey forebrain utilizing antibodies directed against the full-length human ERalpha (NCL-ER-6F11), calcium-binding proteins calbindin-D(28k), and parvalbumin as well as choline acetyltransferase (ChAT). Our findings demonstrate for the first time ERalpha immunoreactive (-ir) cells in the monkey cerebral cortex (layers I-II) and in the claustrum. In addition, ERalpha-ir cells were seen in the septum, basal forebrain, amygdala and hypothalamus. Double-labeled cells for ERalpha and calbindin-D(28k) were seen only in the ventrolateral part of the ventromedial hypothalamic nucleus. In contrast, the co-localization of ERalpha and parvalbumin or ChAT was not seen in any of the areas of the monkey forebrain examined. These observations suggest that estrogens, at least in part, via ERalpha regulate calbindin-D(28k) hypothalamic but not parvalbumin or ChAT containing neurons in select monkey forebrain regions.

Galanin (GAL) and GAL receptors (GALR) are overexpressed in limbic brain regions associated with cognition in Alzheimer disease (AD). The functional consequences of this overexpression are unclear. Because GAL inhibits cholinergic transmission and restricts long-term potentiation in the hippocampus, GAL overexpression may exacerbate clinical features of AD. In contrast, GAL expression increases in response to neuronal injury, and galaninergic hyperinnervation prevents the decreased production of protein phosphatase 1 subtype mRNAs in cholinergic basal forebrain neurons in AD. Thus, GAL may also be neuroprotective for AD. Further elucidation of GAL activity in selectively vulnerable brain regions will help gauge the therapeutic potential of GALR ligands for the treatment of AD.

Galanin receptor (GALR) expression is increased in various areas of the limbic system in end stage Alzheimer's disease (AD). The amygdaloid complex is a key component of the limbic circuit, is involved in homeostatic and cognitive functions, is impacted in AD and contains the peptide and receptor for galanin. Although GALR expression occurs in the amygdala in end stage AD, it remains to be determined whether a plasticity response occurs early or late in the disease. Therefore, we analyzed the distribution and associated changes in GALR binding in the amygdala during the progression of AD using an in vitro receptor autoradiographic method. Human galanin ([125I]hGAL) receptor binding was performed on brain sections from early and late AD cases, as well as normal age-matched control subjects. In aged controls, densities of [125I]hGAL binding sites were found in the central and the corticomedial nuclei. Relative to controls, possible/early AD cases displayed significantly greater numbers of [125I]hGAL binding sites in the central nucleus and cortico-amygdaloid transition area. In contrast, we found a decrease in the number of binding sites for [125I]hGAL in late as compared to early AD cases. The over-expression of GALRs in subfields of the amygdaloid early in AD suggests that galaninergic systems play a key role in limbic related behavioral changes during the disease process.

Intravenous immunoglobulin (IVIG) has shown limited promise so far in human clinical studies on Alzheimer's disease (AD), yet overwhelmingly positive preclinical work in animals and human brain cultures support the notion that the therapy remains potentially efficacious. Here, we elaborate on IVIG neuropreservation by demonstrating that IVIG protects human primary neurons against oxidative stress in vitro and that IVIG preserves antioxidant defense mechanisms in vivo. Based on these results, we propose the following translational impact: If the dosage and treatment conditions are adequately optimized, then IVIG treatment could play a significant role in preventing and/or delaying the progression of neurodegenerative diseases, such as AD. We suggest that IVIG warrants further investigation to fully exploit its potential as an anti-oxidant, neuroprotective and synapto-protecting agent.

The two major histopathologic hallmarks of Alzheimer’s disease (AD) are amyloid beta protein (Aβ) plaques and neurofibrillary tangles (NFT). Aβ pathology is a common feature in the aged nonhuman primate brain, whereas NFT are found almost exclusively in humans. Few studies have examined AD-related pathology in great apes, which are the closest phylogenetic relatives of humans. In the present study, we examined Aβ and tau-like lesions in the neocortex and hippocampus of aged male and female western lowland gorillas using immunohistochemistry and histochemistry. Analysis revealed an age-related increase in Aβ-immunoreactive plaques and vasculature in the gorilla brain. Aβ plaques were more abundant in the neocortex and hippocampus of females, whereas Aβ-positive blood vessels were more widespread in male gorillas. Plaques were also Aβ40-, Aβ42-, and Aβ oligomer-immunoreactive, but only weakly thioflavine S- or 6-CN-PiB-positive in both sexes, indicative of the less fibrillar (diffuse) nature of Aβ plaques in gorillas. Although phosphorylated neurofilament immunostaining revealed a few dystrophic neurites and neurons, choline acetyltransferase-immunoreactive fibers were not dystrophic. Neurons stained for the tau marker Alz50 were found in the neocortex and hippocampus of gorillas at all ages. Occasional Alz50-, MC1-, and AT8-immunoreactive astrocyte and oligodendrocyte coiled bodies and neuritic clusters were seen in the neocortex and hippocampus of the oldest gorillas. This study demonstrates the spontaneous presence of both Aβ plaques and tau-like lesions in the neocortex and hippocampus in old male and female western lowland gorillas, placing this species at relevance in the context of AD research.

Hippocampal precursor of nerve growth factor (proNGF)/NGF signaling occurs in conjunction with β-amyloid (Aβ) accumulations in Alzheimer disease (AD). To assess the involvement of this pathway in AD progression, we quantified these proteins and their downstream pathway activators in postmortem tissues from the brains of subjects with no cognitive impairment (NCI), mild cognitive impairment (MCI), and AD using immunoblotting and ELISA. Hippocampal proNGF was significantly greater in AD cases compared with those in NCI and MCI cases. TrkA was significantly reduced in MCI compared with those in NCI and AD, whereas p75 neurotrophin receptor, sortilin, and neurotrophin receptor homolog 2 remained stable. Akt decreased from NCI to MCI to AD, whereas phospho-Akt and phospho-Akt-to-Akt ratio were elevated in AD compared with those in MCI and NCI. No differences were found in phospho-Erk, Erk, or their ratio across groups. Although c-jun kinase (JNK) remained stable across groups, phospho-JNK and the phospho-JNK-to-JNK ratio increased significantly in AD compared with those in NCI and MCI. Expression levels of Aβ(1-40), Aβ(1-42), and Aβ(40/42) ratio were stable. Statistical analysis revealed a strong positive correlation between proNGF and phospho-JNK, although only proNGF was negatively correlated with cognitive function and only TrkA was negatively associated with pathologic criteria. These findings suggest that alterations in the hippocampal NGF signaling pathway in MCI and AD favor proNGF-mediated proapoptotic pathways, and that this is independent of Aβ accumulation during AD progression.

Cholinergic basal forebrain (CBF) nucleus basalis (NB) neurons display neurofibrillary tangles (NFTs) during Alzheimer's disease (AD) progression, yet the mechanisms underlying this selective vulnerability are currently unclear. Rac1, a member of the Rho family of GTPases, may interact with the proapoptotic pan-neurotrophin receptor p75 NTR to induce neuronal cytoskeletal abnormalities in AD NB neurons. Herein, we examined the expression of Rac1b, a constitutively active splice variant of Rac1, in NB cholinergic neurons during AD progression. CBF tissues harvested from people who died with a clinical diagnosis of no cognitive impairment (NCI), mild cognitive impairment, or AD were immunolabeled for both p75 NTR and Rac1b. Rac1b appeared as cytoplasmic diffuse granules, loosely aggregated filaments, or compact spheres in p75 NTR -positive NB neurons. Although Rac1b colocalized with tau cytoskeletal markers, the percentage of p75 NTR -immunoreactive neurons expressing Rac1b was significantly increased only in AD compared with both mild cognitive impairment and NCI. Furthermore, single-cell gene expression profiling with custom-designed microarrays showed down-regulation of caveolin 2, GNB4, and lipase A in AD Rac1b-positive/p75 NTR -labeled NB neurons compared with Rac1b-negative/p75 NTR -positive perikarya in NCI. These proteins are involved in Rac1 pathway/cell cycle progression and lipid metabolism. These data suggest that Rac1b expression acts as a modulator or transducer of various signaling pathways that lead to NFT formation and membrane dysfunction in a subgroup of CBF NB neurons in AD.

Mild cognitive impairment (MCI) is rapidly becoming one of the most common clinical manifestations affecting the elderly. The pathologic and molecular substrate of people diagnosed with MCI is not well established. Since MCI is a human specific disorder and neither the clinical nor the neuropathological course appears to follow a direct linear path, it is imperative to characterize neuropathology changes in the brains of people who came to autopsy with a well-characterized clinical diagnosis of MCI. Herein, we discuss findings derived from clinical pathologic studies of autopsy cases who died with a clinical diagnosis of MCI. The heterogeneity of clinical MCI imparts significant challenges to any review of this subject. The pathologic substrate of MCI is equally complex and must take into account not only conventional plaque and tangle pathology but also a wide range of cellular, biochemical and molecular deficits, many of which relate to cognitive decline as well as compensatory responses to the progressive disease process. The multifaceted nature of the neuronal disconnection syndrome associated with MCI suggests that there is no single event which precipitates this prodromal stage of AD. In fact, it can be argued that neuronal degeneration initiated at different levels of the central nervous system drives cognitive decline as a final common pathway at this stage of the dementing disease process.

Expression of the neuropeptide galanin is known to be upregulated in the brain of patients with Alzheimer's disease (AD). We and others have shown that galanin plays a neuroprotective role in a number of excitotoxic injury paradigms, mediated by activation of the second galanin receptor subtype (GAL2). In the present study, we investigated whether galanin/GAL2 plays a similar protective role against amyloid-β(Aβ) toxicity. Here we report that galanin or the GAL2/3-specific peptide agonist Gal2-11, both equally protect primary dispersed mouse wildtype (WT) neonatal hippocampal neurons from 250 nM Aβ1-42 toxicity in a dose dependent manner. The amount of Aβ1-42 induced cell death was significantly greater in mice with loss-of-function mutations in galanin (Gal-KO) or GAL2 (GAL2-MUT) compared to strain-matched WT controls. Conversely, cell death was significantly reduced in galanin over-expressing (Gal-OE) transgenic mice compared to strain-matched WT controls. Exogenous galanin or Gal2-11 rescued the deficits in the Gal-KO but not the GAL2-MUT cultures, confirming that the protective effects of endogenous or exogenous galanin are mediated by activation of GAL2. Despite the high levels of endogenous galanin in the Gal-OE cultures, the addition of exogenous 100 nM or 50 nM galanin or 100 nM Gal2-11 further significantly reduced cell death, implying that GAL2-mediated neuroprotection is not at maximum in the Gal-OE mice. These data further support the hypothesis that galanin over-expression in AD is a neuroprotective response and imply that the development of a drug-like GAL2 agonist might reduce the progression of symptoms in patients with AD.

The cholinotrophic system, which is dependent upon nerve growth factor and its receptors for survival, is selectively vulnerable in Alzheimer's disease (AD). But, virtually nothing is known about how this deficit develops in relation to the hallmark lesions of this disease, amyloid plaques and tau containing neurofibrillary tangles. The vast majority of transgenic models of AD used to evaluate the effect of beta amyloid (Aβ) deposition upon the cholinotrophic system over-express the amyloid precursor protein (APP). However, nothing is known about how this system is affected in triple transgenic (3xTg)-AD mice, an AD animal model displaying Aβ plaque- and tangle-like pathology in the cortex and hippocampus, which receive extensive cholinergic innervation. We performed a detailed morphological and biochemical characterization of the cholinotrophic system in young (2-4 months), middle-aged (13-15 months) and old (18-20 months) 3xTg-AD mice. Cholinergic neuritic swellings increased in number and size with age, and were more conspicuous in the hippocampal-subicular complex in aged female than in 3xTg-AD male mice. Stereological analysis revealed a reduction in choline acetyltransferase (ChAT) positive cells in the medial septum/vertical limb of the diagonal band of Broca in aged 3xTg-AD mice. ChAT enzyme activity levels decreased significantly in the hippocampus of middle-aged 3xTg-AD mice compared to age-matched non-transgenic (or wild type) mice. ProNGF protein levels increased in the cortex of aged 3xTg-AD mice, whereas TrkA protein levels were reduced in a gender-dependent manner in aged mutant mice. In contrast, p75(NTR) protein cortical levels were stable but increased in the hippocampus of aged 3xTg-AD mice. These data demonstrate that cholinotrophic alterations in 3xTg-AD mice are age- and gender-dependent and more pronounced in the hippocampus, a structure more severely affected by Aβ plaque pathology.

Galanin (GAL) and GAL receptors (GALR) are overexpressed in degenerating brain regions associated with cognitive decline in Alzheimer’s disease (AD). The functional consequences of GAL plasticity in AD are unclear. GAL inhibits cholinergic transmission in the hippocampus and impairs spatial memory in rodent models, suggesting that GAL overexpression exacerbates cognitive impairment in AD. By contrast, gene expression profiling of individual cholinergic basal forebrain (CBF) neurons aspirated from AD tissue revealed that GAL hyper-innervation positively regulates mRNAs that promote CBF neuronal function and survival. GAL also exerts neuroprotective effects in rodent models of neurotoxicity. These data support the growing concept that GAL overexpression preserves CBF neuron function, which may in turn delay the onset of symptoms of AD. Further elucidation of GAL activity in selectively vulnerable brain regions will help gauge the therapeutic potential of GALR ligands in the treatment of AD.

Alzheimer’s disease (AD) is characterized by a progressive phenotypic downregulation of markers within the cholinergic basal forebrain (CBF) system including CBF cell loss and reduced cortical choline acetyltransferase activity associated with cognitive decline. Growing evidence suggests that imbalances in the expression of nerve growth factor (NGF), its precursor proNGF and the tyrosine kinase A (TrkA) high-affinity and p75NTR low-affinity NGF receptors, as well as metalloproteinase are key factors underlying CBF dysfunction at the onset of AD. This article discusses shifts in the balance of the proNGF:NGF receptor:metalloproteinase system during aging and the progression of AD.

Epidemiological and clinical trial findings suggest that consumption of docosahexaenoic acid (DHA) lowers the risk of Alzheimer's disease (AD). We examined the effects of short-term (3 months) DHA enriched diet on plaque deposition and synaptic defects in forebrain of young APPswe/PS1 Delta E9 transgenic (tg) and non-transgenic (ntg) mice. Gas chromatography revealed a significant increase in DHA concomitant with a decrease of arachidonic acid in both brain and liver in mice fed with DHA. Female tg mice consumed relatively more food daily than ntg female mice, independent of diet. Plaque load was significantly reduced in the cortex, ventral hippocampus and striatum of female APPswe/PS1 Delta E9 tg mice on DHA diet compared to female tg mice on control diet. Immunoblot quantitation of the APOE receptor, LR11, which is involved in APP trafficking and A beta production, were unchanged in mice on DHA or control diets. Moreover drebrin levels were significantly increased in the hippocampus of tg mice on the DHA diet. Finally, in vitro DHA treatment prevented amyloid toxicity in cell cultures. Our findings support the concept that increased DHA consumption may play and important role in reducing brain insults in female AD patients.

The functional interactions of the neuropeptide galanin (GAL) occur through its binding to three G protein-coupled receptor subtypes: galanin receptor (GALR) 1, GALR2 and GALR3. Previously, we demonstrated that GALR1 mRNA expression was increased in the CA1 region of the hippocampus and discrete hypothalamic nuclei in galanin transgenic (GAL-tg) mice. This observation suggested a compensatory adjustment in cognate receptors in the face of chronic GAL exposure. To evaluate the molecular alterations to GALR2 and GALR3 in the forebrain of GAL overexpressing mice, we performed complementary quantitative, real-time PCR (qPCR), in situ hybridization, and immunohistochemistry in select forebrain regions of GAL-tg mice to characterize the neuronal distribution and magnitude of GAL mRNA and peptide expression and the consequences of genetically manipulating the neuropeptide GAL on the expression of GALR2 and GALR3 receptors. We found that GAL-tg mice displayed dramatic increases in GAL mRNA and peptide in the frontal cortex, posterior cortex, hippocampus, septal diagonal band complex, amygdala, piriform cortex, and olfactory bulb. Moreover, there was evidence for ectopic neuronal GAL expression in forebrain limbic regions that mediate cognitive and affective behaviors, including the piriform and entorhinal cortex and amygdala. Interestingly, regional qPCR analysis failed to reveal any changes in GALR2 or GALR3 expression in the GAL-tg mice, suggesting that, contrary to GALR1, these receptor genes are not under ligand-mediated regulatory control. The GAL-tg mouse model may provide a useful tool for the investigation of GAL ligand-receptor relationships and their role in normal cognitive and affective functions as well as in the onset of neurological disease.

The present study was conducted to identify the localization and possible contribution of the two estrogen receptor (ER) subtypes in the rat brain at postnatal (P) days 3, 7 and 14. Evaluation of the distribution of ERalpha and ERbeta immunoreactive (ir) nuclei did not reveal gender differences at the developmental point times examined. With the exception of the cerebral cortex, the pattern of staining for these ERs was unchanged across the postnatal ages examined. The distribution of ERalpha-ir nuclei was wider than ERbeta-ir during brain development. From P3, ERbeta and ERalpha-ir nuclei were found in different regions of the cerebral cortex, basal forebrain, amygdala, thalamus, hypothalamus, mesencephalon, pons, cerebellum and medulla oblongata. In addition, ERalpha-ir nuclei were exclusively detected in the hippocampal subfields, epithalamus and in several circumventricular organs. ERalpha and ERbeta dual immunofluorescence revealed positive nuclei in the medial part of the bed nucleus of the stria terminalis, periventricular preoptic nucleus and in caudal aspects of the ventrolateral part of the ventromedial hypothalamic nucleus. Although the functional significance of the dual expression of both ERs within the same nuclei remains unknown, it is possible that ERs play different roles in gene regulation within the same cell. The presence of ERs in diverse brain regions through early postnatal periods supports a potential role for estrogens in neural differentiation.

PURPOSE To determine whether beta-amyloid (Abeta) deposition affects the structure and function of the retina of the APPswe/PS1DeltaE9 transgenic (tg) mouse model of Alzheimer's disease. METHODS Retinas from 12- to 19-month old APPswe/PS1DeltaE9 tg and age-matched non-transgenic (ntg) littermates were single or double stained with thioflavine-S and antibodies against Abeta, glial fibrillar acidic protein (GFAP), microglial marker F4/80, choline acetyltransferase (ChAT), and syntaxin 1. Quantification of thioflavine-S positive plaques and retinal layer thickness was analyzed semi-quantitatively, whereas microglial cell size and levels of F4/80 immunoreactivity were evaluated using a densitometry program. Scotopic electroretinogram (ERG) recording was used to investigate retinal physiology in these mice. RESULTS Thioflavine-S positive plaques appeared at 12 months in the retinas of APPswe/PS1DeltaE9 tg mice with the majority of plaques in the outer and inner plexiform layers. Plaques were embedded in the inner plexiform layer strata displaying syntaxin 1 and ChAT. The number and size of the plaques in the retina increased with age. Plaques appeared earlier and in greater numbers in females than in male tg littermate mice. Microglial activity was significantly increased in the retinas of APPswe/PS1DeltaE9 tg mice. Although we did not detect neuronal degeneration in the retina, ERG recordings revealed a significant reduction in the amplitudes of a- and b-waves in aged APPswe/PS1DeltaE9 tg compared to ntg littermates. CONCLUSIONS The present findings suggest that Abeta deposition disrupts retinal structure and may contribute to the visual deficits seen in aged APPswe/PS1DeltaE9 tg mice. Whether Abeta is involved in other forms of age-related retinal dysfunction is unclear.

The quantitative PCR (qPCR) primer sequences reported for mouse galanin receptor 2 (GALR2) mRNA [forward primer (5=-3=) TGCTCTTCTGTACCTCTCACGTCTG; reverse primer (5=-3=) AAGTTGGTTTTTATTGG] are specific for the mouse GALR1 receptor, whereas the primer sequences reported for mouse GALR3 mRNA [forward primer (5=-3=) CAGATTGCGAGAGTGGTGACATAG; reverse primer (5=-3=) GGATCTCAGGTAGTTCAAGGACTCC] are specific for mouse GALR2 message. Therefore, the qPCR data describing regional GALR2 expression in GAL wild type (WT) and GAL transgenic (GAL-tg) mouse forebrain actually refer to GALR1 expression, whilst data reported for GALR3 should instead be attributed to GALR2. The revised qPCR component of our report indicates that GALR1 and GALR2 mRNA levels do not change in seven different subregions (e.g., piriform cortex, hippocampus, amygdala) of the GAL-tg mouse forebrain compared to the WT mouse. This contrasts with a previous in situ hybridization study showing increased GALR1 mRNA in hippocampal CA1 neurons of these same GAL-tg mice (Hohmann et al., 2003). These observations suggest that GAL overexpression does not influence global GALR1 or GALR2 expression in the mouse forebrain but that changes in GALR expression in GAL-tg mice may be restricted to discrete neuronal groups. These focal alterations in GALR expression are likely undetectable by regional qPCR analysis.

A major feature of Alzheimer’s disease (AD) is the loss of noradrenergic locus coeruleus (LC) projection neurons that mediate attention, memory, and arousal. However, the extent to which the LC projection system degenerates during the initial stages of AD is still under investigation. To address this question, we performed tyrosine hydroxylase (TH) immunohistochemistry and unbiased stereology of noradrenergic LC neurons in tissue harvested postmortem from subjects who died with a clinical diagnosis of no cognitive impairment (NCI), amnestic mild cognitive impairment (aMCI, a putative prodromal AD stage), or mild/moderate AD. Stereologic estimates of total LC neuron number revealed a 30% loss during the transition from NCI to aMCI, with an additional 25% loss of LC neurons in AD. Decreases in noradrenergic LC neuron number were significantly associated with worsening antemortem global cognitive function as well as poorer performance on neuropsychological tests of episodic memory, semantic memory, working memory, perceptual speed, and visuospatial ability. Reduced LC neuron numbers were also associated with increased postmortem neuropathology. To examine the cellular and molecular pathogenic processes underlying LC neurodegeneration in aMCI, we performed single population microarray analysis. These studies revealed significant reductions in select functional classes of mRNAs regulating mitochondrial respiration, redox homeostasis, and neuritic structural plasticity in neurons accessed from both aMCI and AD subjects compared to NCI. Specific gene expression levels within these functional classes were also associated with global cognitive deterioration and neuropathological burden. Taken together, these observations suggest that noradrenergic LC cellular and molecular pathology is a prominent feature of prodromal disease that contributes to cognitive dysfunction. Moreover, they lend support to a rational basis for targeting LC neuroprotection as a disease modifying strategy. Electronic supplementary material The online version of this article (doi:10.1186/s40478-017-0411-2) contains supplementary material, which is available to authorized users.