Search

Mesobiotus dilimanensis, new species (Tables 3, 4, Figs. 1–5) Material examined: 65 animals (including eight simplex), 47 eggs, and 7 empty chorions mounted on microscope slides in Hoyer's medium, 5 eggs fixed on SEM stubs, and 8 specimens processed for DNA sequencing. Type locality: 14°39′40″N, 121°04′07″E; 76 m asl: Philippines, Quezon City, Diliman, University of the Philippines, A. Roces St.; moss on a rock; September 2015; coll. Lowelyn Itang. Etymology: The species is named after Diliman, the district in Quezon City, Philippines, where it was discovered. Type depositories: Holotype: slide PH.006.10 with six paratypes; 58 paratypes (slides: PH.006. *, where the asterisk can be substituted by any of the following numbers: 02–03, 11–16), 47 eggs (slides: PH.006. *: 5–9, 17); seven empty chorions (slides: PH.006. *: 01, 04) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland.

Itang, Lowelyn A. M., Stec, Daniel, Mapalo, Marc A., Mirano-Bascos, Denise, Michalczyk, Łukasz (2020): An integrative description of Mesobiotus dilimanensis, a new tardigrade species from the Philippines (Eutardigrada: Macrobiotidae: furciger group). Raffles Bulletin of Zoology 68: 19-31, DOI: 10.26107/RBZ-2020-0003

Macrobiotus noongaris sp. nov. urn:lsid:zoobank.org:act: A7 BF 7 FF 6-451 F- 4382- A 842- CAC 1 EF 51 E 6 B 8 Figs 1–7 Etymology The name refers to the indigenous Australians who live in the region where the new species was found. These are the Noongar peoples, 14 different but related language groups that occupied these lands before western settlement, including the modern city of Perth where the sample was collected. In their languages, the term Noongar means ‘a person of the southwest of Western Australia’. Material examined 86 animals (including 31 simplex) and 57 eggs. Specimens mounted on microscope slides in Hoyer’s medium (72 animals + 47 eggs), fixed on SEM stubs (10+10) and processed for DNA sequencing (4+0). Holotype AUSTRALIA – Western Australia • ♀; Perth, Kings Park; 31°57′30″ S, 115°350′09″ E; 46 m a.s.l.; moss on soil in an urban park; IZiBB AU.031.12. Paratypes AUSTRALIA – Western Australia • 62 paratypes; same collection data as for holotype; IZiBB AU.031.06 to AU.031.14 • 32 eggs; same collection data as for holotype; IZiBB AU.031.02–05. Description Animals (measurements and statistics in Table 2) Body transparent in juveniles and white in adults but transparent after fixation in Hoyer’s medium (Fig. 1 A). Eyes present in live animals as well as in specimens mounted in Hoyer’s medium. Small round and oval cuticular pores (0.3–0.8 μm in diameter), visible under both PCM and SEM, scattered randomly on entire body (Fig. 1 B–C). Granulation present on all legs (Fig. 2 A–F). A patch of clearly visible granulation present on external surface of legs I–III (Fig. 2 A–B). A cuticular bulge/fold (pulvinus) present on internal surface of legs I–III, with a faint cuticular fold covered with faint granulation and paired muscles attachments just above the claws (Fig. 2 C–D). Both structures are visible only if legs are fully extended and properly oriented on slide (particularly in the case of the pulvinus and cuticular fold). Granulation on legs IV always clearly visible and consists of a single large granulation patch on each leg (Fig. 2 E–F). Claws stout, of hufelandi type (Fig. 3 A–D). Primary branches with distinct accessory points, a common tract, and with an evident stalk connecting claw to lunula (Fig. 3 A–D). Lunulae I–III smooth (Fig. 3 A, C), whereas lunulae IV clearly dentate (Fig. 3 B, D). Cuticular bars under claws absent. Double muscle attachments faintly marked under PCM but clearly visible under SEM (Fig. 3 A, C). Mouth antero-ventral followed by ten peribuccal lamellae and a circular sensory lobe (Figs 4 A, 5 A). Bucco-pharyngeal apparatus of Macrobiotus type (Fig. 4 A). Under PCM, oral cavity armature of the patagonicus type, i.e., with only 2 nd and 3 rd bands of teeth visible (Fig. 4 B–C). However, in SEM all three bands of teeth visible, with first band being situated at base of peribuccal lamellae and composed of a single row of small fused cone-shaped teeth connected to form a continuous, slightly serrated ring ridge around oral cavity (Fig. 5 B–C). Second band of teeth situated between ring fold and third band of teeth and comprises 3–6 rows of small cone-shaped teeth (Figs 4 B–C, 5 B–C). Teeth of third band located within posterior portion of oral cavity, between second band of teeth and buccal tube opening (Figs 4 B–C, 5 B–C). Third band of teeth discontinuous and divided into dorsal and ventral portions. Under PCM, dorsal teeth appear as three distinct transverse ridges, whereas ventral teeth appear as two separate lateral transverse ridges and a median tooth (Fig. 4 B–C). In SEM, both dorsal and ventral teeth also clearly distinct (Fig. 5 B–C). Under SEM, margins of medio-dorsal tooth slightly serrated (Fig. 5 B), whereas the medio-ventral tooth slightly anterior to lateral teeth (Fig. 5 C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small triangular microplacoid (Fig. 4 A, D–E). Macroplacoid length sequence 2 Eggs (measurements and statistics in Table 3) Laid freely, white, spherical or slightly ovoid (Fig. 6 A). Surface between processes is of the hufelandi type, i.e., covered with a reticulum (Figs 6 E, 7 B–D, F). Meshes of reticulum small (0.1–0.6 µm) and rounded, regular in size and with blurred rims in PCM (Fig. 6 E), irregular in size and with thick borders in SEM (meshes in SEM appear as pores; Figs 7 B–D, F). Interbasal meshes larger than peribasal meshes, but peribasal meshes do not form rings around process bases (Figs 6 E, 7 B–D, F). Eggs have 22–30 processes on circumference, 26 on average (Fig. 6 A). Processes are of inverted goblet shape, with slightly concave trunks and concave terminal discs (Figs 6 C–E, 7B–E). Terminal discs are round and strongly serrated (Fig. 7 C–E). Each terminal disc has a distinct concave central area which may contain some scattered granulation within, which is also always present on the margin (visible only under SEM; Fig. 7 C–E). Reproduction The new species is dioecious. No spermathecae filled with sperm have been found in gravid females on the freshly prepared slides. However, the testis in males, filled with spermatozoa, is clearly visible under PCM up to 24 hours after mounting in Hoyer’s medium (Fig. 6 F). The new species does not exhibit male secondary sexual dimorphism traits such as lateral gibbosities on legs IV. DNA sequences We obtained sequences for all four of the above mentioned DNA markers. All sequenced fragments were represented by single haplotypes except the ITS-2, in which two distinct haplotypes were present: The 18 S rRNA sequence (GenBank: MK 737069), 1010 bp long. The 28 S rRNA sequence (GenBank: MK 737063), 786 bp long. The ITS-2 haplotype 1 sequence (GenBank: MK 737065), 418 bp long. The ITS-2 haplotype 2 sequence (GenBank: MK 737066), 418 bp long. The COI sequence (GenBank: MK 737919), 658 bp long., Published as part of Coughlan, Kyle & Stec, Daniel, 2019, Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position, pp. 1-38 in European Journal of Taxonomy 573 on pages 6-15, DOI: 10.5852/ejt.2019.573, http://zenodo.org/record/3526912

Family: Macrobiotidae Thulin, 1928 Genus: Mesobiotus Vecchi, Cesari, Bertolani, Jönsson, Rebecchi & Guidetti, 2016, Published as part of Stec, Daniel, 2019, Mesobiotus datanlanicus sp. nov., a new tardigrade species (Macrobiotidae: Mesobiotus harmsworthi group) from Lâm Đ ồng Province in Vietnam, pp. 164-180 in Zootaxa 4679 (1) on page 168, DOI: 10.11646/zootaxa.4679.1.10, http://zenodo.org/record/3466234, {"references":["Thulin, G. (1928) Uber die Phylogenie und das System der Tardigraden. Hereditas, 11, 207 - 266. https: // doi. org / 10.1111 / j. 1601 - 5223.1928. tb 02488. x","Vecchi, M., Cesari, M., Bertolani, R., Jonsson, K. I., Rebecchi, L. & Guidetti, R. (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics, 30 (4), 303 - 322. https: // doi. org / 10.1071 / IS 15033"]}

Fractonotus verrucosus (Richters, 1900) n. comb. Macrobiotus ornatus var. verrucosus Richters, 1900: 41 (terra typica: Taunus, Germany). Macrobiotus scabrosus Murray, 1911: 10 (locus typicus: Clare Island, Ireland). Hypsibius verrucosus – Thulin 1911: 29 (Kiruna, Lapland, Sweden). — Marcus 1928: 180 (Vannsee, Berlin, Germany). — Cuénot 1932: 77 (the Vosges, France and Switzerland). — da Cunha 1947, 1948: 6, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal). Calohypsibius verrucosus – Thulin 1928: 239 (Sweden). Calohypsibius scabrosus Thulin, 1928: 239 (Sweden). Hypsibius scabrosus Cuénot, 1932: 77 (the Vosges, France and Switzerland). — da Cunha 1947, 1948: 6, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal). Hypsibius (Calohypsibius) verrucosus – Marcus 1936: 285 (Schwarzwald, Germany). — Franceschi 1951-1952: 12 (Val Camonica, Italy). — Mihelčič 1953: 247 (Tirol, Austria). — Fontoura 1981: 18 (Viseu, Arga, Amarante, Portugal). Hypsibius placophorus da Cunha, 1943: 1 (locus typicus: Cabril do Ceira, Portugal); 1947, 1948: 2, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal) n. syn. LOCALITIES. — Scotland. Creag Meagaidh (56°57’10’’ N, 4°30’35’’ W; 291 m a.s.l.; collection date: 1.X.2014), lichens from moorland rocks; Scotland, Hebrides, Isle of Lewis, Loch nan Muilne (58°21’08’’ N, 6°35’14’’ W; 27 m a.s.l.; collection date: 29.VII.2015), moss and lichen mix from stones on the lakeshores; Invermoriston, Loch Ness (57°12’39’’ N, 4°35’59’’ W; 20 m a.s.l.; 25.X.2015; Brian Blagden leg.), moss and lichen mix from stones on the lakeshores. MATERIAL EXAMINED. — 23 individuals, UJ (19 specimens, including one simplex, on slides GB.005.03-12, GB.008.01-3, GB.028.01- 2 and 4 specimens on two SEM stubs); 2 individuals, MNHN (slides GB.005.01-2); 3 individuals, NHMD (slides GB.008.04- 5); 2 individuals, UAM (slides GB.028.03-4); 1 individual, CU (slide GB.028.02). ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). — The name most likely refers to the rugged cuticular surface of the species (from Latin verruca = wart). DIFFERENTIAL DIAGNOSIS. — Fractonotus verrucosus n. comb. can be distinguished from F. caelatus and F. gilvus n. comb. (Fig. 2 A, B) by the presence of plaques (absent in the latter species). It also differs from F. gilvus n. comb. by shorter, stouter claws (anterior and posterior primary branches 4.1-6.4 μm [N =10] and 4.3-7.4 μm long [N =18], respectively, in Fractonotus verrucosus n. comb. vs 7.0- 13.0 μm [N =21] and 10.5-16.5 μm long [N =21], respectively, in F. gilvus n. comb.; compare Fig. 11 A-D). INTEGRATIVE DESCRIPTION Animals (see Table 3 for measurements) Body stubby, typically slightly rose in live animals, transparent in mounted specimens. Dorsum strongly sculptured from the first instar, although with substantial ontogenetic quantitative and qualitative variability in this trait (Fig. 1 A- F). Juveniles with ten transverse bands of numerous tu- bercles that increase in size towards the caudal end of the body, but fully formed plaques never present, legs covered with fine tubercles (Fig. 1 A). All ten bands not always easily identifiable under PCM in juveniles. In young adults, plaques present in bands 6-10, with the most prominent plaques in bands 8-10 (Fig. 1 B). In older adults, smooth spaces between the transverse bands becoming narrow and sometimes merge into larger areas (Fig. 1 C-F). Plaques larger and more numerous than in young adults, and typically developping in bands 4-10, but the most evident plaques present in the caudal part of the body (Fig.1 C-F). Tubercles more or less round or oval (Figs 3 A, B; 5 A, B), gradually increasing in size from juveniles to adults, and becoming scabrous with age (compare Figs 1 A-F; 5 A, B). Plaques, on the other hand, typically smooth and only sometimes slightly rough (Fig. 5 C, D, arrowheads); under stereomicroscope strongly opalescent. Plaques arranged symmetrically in respect to the longitudinal body axis, although deviations A from symmetry are not rare (Fig. 1 C, D). In adults, seven pairs of central plaques and four lateral plaque pairs. Central plaques triangular in shape, with their apices directed laterally and outwards. In rows where only central plaques are present, plaques slimmer and longer than in rows with lateral plaques. Central plaques present in bands aligned with legs I-III as well as in bands between those legs. First three pairs of lateral plaques in line with legs I-III and the last pair of double lateral plaques situated between legs III and IV (Fig. 1 E). Plaque configuration VII:4-2-4-2-4-2-6. Cephalic elliptical organs present but not easy to identify, given the rich cuticular sculpturing (Fig. 7 A). Eyes absent in live animals. Buccal apparatus of the Fractonotus - type (Fig. 7 B, C, E), i.e. with a long ventral AISM, and the dorsal AISM subdivided into the proximal, weakly developed thickening, and the distal, small blunt hook (Fig. 9 A). Mouth opening surrounded by six large and soft peribuccal lobes (visible only under SEM, Fig. 6 A). Oral cavity armature, visible only under SEM, consisting of a single row of minute conical teeth located on the ring fold (Fig. 8 A). Two distinct porous areas on the lateral sides of the buccal crown are visible in SEM only (Fig. 8 B). Stylet furcae of the modified Hypsibius shape, i.e. with very broad and trapezoid bases, thick arms and rounded apices (Figs 7 B, 8 D, 10 A). Buccal tube with slight lateral thickenings posterior to the stylets supports (Figs 7 B, C, E; 8 C). Round bulbus with large pharyngeal apophyses (almost as large as the placoids), and two granular macroplacoids (Figs 7 B, C, E; 8 E, F). In PCM, macroplacoids without constrictions, however slight central constrictions in both macroplacoids detectable under SEM (Fig. 8 E, F). Claws of the modified Isohypsibius - type (Figs 11 A-C; 12 A, B). Specifically, claw bases triangular, especially pronounced in claws IV (Figs 11 C, 12 B). Claw branches V-shaped, elongated and strongly curved. Apparent accessory points on the primary branches (Figs 11 A-C; 12 A, B). Weakly developed pseudolunulae present, particularly visible under the internal and anterior claws (Fig. 11 A, C). Claw septa and cuticular bars on legs absent. Eggs Roundish and smooth, deposited in exuviae (up to two eggs per exuvia recorded). MOLECULAR MARKERS The sequences for all DNA markers were of a good quality. The sequenced fragments were of the following lengths: 1.727 bp (18 S rRNA; MG 800855), 819 bp (28 S rRNA; MG 800856), and 499 bp (ITS-2; MG 800857). All markers, including the specimen without cuticular plaques, were represented by single haplotypes. The p-distances between 18S haplotypes of all available isohypsibioid species and Fractonotus verrucosus n. comb. ranged from 2.0% (I. prosostomus Thulin, 1928, EF 620404 from Denmark) to 7.1% (Hexapodibius micronyx Pilato, 1969, HQ 604915 from Italy), with an average distance of 5.2%. As our 28S rRNA primers obtain a different gene fragment to the one sequenced by previous authors, comparisons of this gene were not possible. Matrices with p-distances are provided in the Supplementary Material 2. REMARKS The vast part of the Richters Collection has been lost, thus the type material (if ever existed) is not available for examination. Moreover, no specimens from Germany were examined in this study, therefore the neotype series is not established. Hence, until the redescription from the terra typica in Germany is available, we propose to consider the description of the Scottish specimens only as the current perception of the species. PHYLOGENETIC POSITION OF FRACTONOTUS AMONG OTHER ISOHYPSIBIIDAE Both Bayesian Inference and Maximum Likelihood methods unreservedly located Fractonotus within Isohypsibioidea (Fig. 13), thus corroborating the phenotypic analysis (see above). The genus Isohypsibius s.s. (i.e. I. prosostomus and its closest relatives) appears paraphyletic with respect to Fractonotus. However, in general, all isohypsibioid lineages clearly remain in polytomy, with only the occasional sound Bayesian posterior probabilities characterising clades with morphologically similar taxa. Therefore, the exact relationships between different isohypsibioid clades remain unsolved.

Fractonotus gilvus (Biserov, 1986) n. comb. Isohypsibius gilvus Biserov, 1986: 984. REMARK Elliptical organs not always visible due to developed sculpturing in the cephalic portion of the body., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993."]}

Genus Microhypsibius Thulin, 1928 DIAGNOSIS. ��� Same as for the family Microhypsibiidae. ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� The name was most likely chosen to underline the minute size of the family members. COMPOSITION. ��� Microhypsibius bertolanii Kristensen, 1982, M. japonicus Ito, 1991, M. minimus Kristensen, 1982, M. truncatus Thulin, 1928 (type species). REMARKS See Kristensen (1982) for the most current depiction of the genus Microhypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 84, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","KRISTENSEN R. M. 1982. - New aberrant eutardigrades from homothermic springs on Disko Island, West Greenland. In: Nelson, D. R. (ed.), Proceedings of the Third International Symposium on the Tardigrada, 1980, 203 - 220."]}

Fractonotus verrucosus (Richters, 1900) n. comb. Macrobiotus ornatus var. verrucosus Richters, 1900: 41 (terra typica: Taunus, Germany). Macrobiotus scabrosus Murray, 1911: 10 (locus typicus: Clare Island, Ireland). Hypsibius verrucosus ��� Thulin 1911: 29 (Kiruna, Lapland, Sweden). ��� Marcus 1928: 180 (Vannsee, Berlin, Germany). ��� Cu��not 1932: 77 (the Vosges, France and Switzerland). ��� da Cunha 1947, 1948: 6, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal). Calohypsibius verrucosus ��� Thulin 1928: 239 (Sweden). Calohypsibius scabrosus Thulin, 1928: 239 (Sweden). Hypsibius scabrosus Cu��not, 1932: 77 (the Vosges, France and Switzerland). ��� da Cunha 1947, 1948: 6, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal). Hypsibius (Calohypsibius) verrucosus ��� Marcus 1936: 285 (Schwarzwald, Germany). ��� Franceschi 1951-1952: 12 (Val Camonica, Italy). ��� Mihelčič 1953: 247 (Tirol, Austria). ��� Fontoura 1981: 18 (Viseu, Arga, Amarante, Portugal). Hypsibius placophorus da Cunha, 1943: 1 (locus typicus: Cabril do Ceira, Portugal); 1947, 1948: 2, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal) n. syn. LOCALITIES. ��� Scotland. Creag Meagaidh (56��57���10������ N, 4��30���35������ W; 291 m a.s.l.; collection date: 1.X.2014), lichens from moorland rocks; Scotland, Hebrides, Isle of Lewis, Loch nan Muilne (58��21���08������ N, 6��35���14������ W; 27 m a.s.l.; collection date: 29.VII.2015), moss and lichen mix from stones on the lakeshores; Invermoriston, Loch Ness (57��12���39������ N, 4��35���59������ W; 20 m a.s.l.; 25.X.2015; Brian Blagden leg.), moss and lichen mix from stones on the lakeshores. MATERIAL EXAMINED. ��� 23 individuals, UJ (19 specimens, including one simplex, on slides GB.005.03-12, GB.008.01-3, GB.028.01- 2 and 4 specimens on two SEM stubs); 2 individuals, MNHN (slides GB.005.01-2); 3 individuals, NHMD (slides GB.008.04- 5); 2 individuals, UAM (slides GB.028.03-4); 1 individual, CU (slide GB.028.02). ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� The name most likely refers to the rugged cuticular surface of the species (from Latin verruca = wart). DIFFERENTIAL DIAGNOSIS. ��� Fractonotus verrucosus n. comb. can be distinguished from F. caelatus and F. gilvus n. comb. (Fig. 2 A, B) by the presence of plaques (absent in the latter species). It also differs from F. gilvus n. comb. by shorter, stouter claws (anterior and posterior primary branches 4.1-6.4 ��m [N =10] and 4.3-7.4 ��m long [N =18], respectively, in Fractonotus verrucosus n. comb. vs 7.0- 13.0 ��m [N =21] and 10.5-16.5 ��m long [N =21], respectively, in F. gilvus n. comb.; compare Fig. 11 A-D). INTEGRATIVE DESCRIPTION Animals (see Table 3 for measurements) Body stubby, typically slightly rose in live animals, transparent in mounted specimens. Dorsum strongly sculptured from the first instar, although with substantial ontogenetic quantitative and qualitative variability in this trait (Fig. 1 A- F). Juveniles with ten transverse bands of numerous tu- bercles that increase in size towards the caudal end of the body, but fully formed plaques never present, legs covered with fine tubercles (Fig. 1 A). All ten bands not always easily identifiable under PCM in juveniles. In young adults, plaques present in bands 6-10, with the most prominent plaques in bands 8-10 (Fig. 1 B). In older adults, smooth spaces between the transverse bands becoming narrow and sometimes merge into larger areas (Fig. 1 C-F). Plaques larger and more numerous than in young adults, and typically developping in bands 4-10, but the most evident plaques present in the caudal part of the body (Fig.1 C-F). Tubercles more or less round or oval (Figs 3 A, B; 5 A, B), gradually increasing in size from juveniles to adults, and becoming scabrous with age (compare Figs 1 A-F; 5 A, B). Plaques, on the other hand, typically smooth and only sometimes slightly rough (Fig. 5 C, D, arrowheads); under stereomicroscope strongly opalescent. Plaques arranged symmetrically in respect to the longitudinal body axis, although deviations A from symmetry are not rare (Fig. 1 C, D). In adults, seven pairs of central plaques and four lateral plaque pairs. Central plaques triangular in shape, with their apices directed laterally and outwards. In rows where only central plaques are present, plaques slimmer and longer than in rows with lateral plaques. Central plaques present in bands aligned with legs I-III as well as in bands between those legs. First three pairs of lateral plaques in line with legs I-III and the last pair of double lateral plaques situated between legs III and IV (Fig. 1 E). Plaque configuration VII:4-2-4-2-4-2-6. Cephalic elliptical organs present but not easy to identify, given the rich cuticular sculpturing (Fig. 7 A). Eyes absent in live animals. Buccal apparatus of the Fractonotus - type (Fig. 7 B, C, E), i.e. with a long ventral AISM, and the dorsal AISM subdivided into the proximal, weakly developed thickening, and the distal, small blunt hook (Fig. 9 A). Mouth opening surrounded by six large and soft peribuccal lobes (visible only under SEM, Fig. 6 A). Oral cavity armature, visible only under SEM, consisting of a single row of minute conical teeth located on the ring fold (Fig. 8 A). Two distinct porous areas on the lateral sides of the buccal crown are visible in SEM only (Fig. 8 B). Stylet furcae of the modified Hypsibius shape, i.e. with very broad and trapezoid bases, thick arms and rounded apices (Figs 7 B, 8 D, 10 A). Buccal tube with slight lateral thickenings posterior to the stylets supports (Figs 7 B, C, E; 8 C). Round bulbus with large pharyngeal apophyses (almost as large as the placoids), and two granular macroplacoids (Figs 7 B, C, E; 8 E, F). In PCM, macroplacoids without constrictions, however slight central constrictions in both macroplacoids detectable under SEM (Fig. 8 E, F). Claws of the modified Isohypsibius - type (Figs 11 A-C; 12 A, B). Specifically, claw bases triangular, especially pronounced in claws IV (Figs 11 C, 12 B). Claw branches V-shaped, elongated and strongly curved. Apparent accessory points on the primary branches (Figs 11 A-C; 12 A, B). Weakly developed pseudolunulae present, particularly visible under the internal and anterior claws (Fig. 11 A, C). Claw septa and cuticular bars on legs absent. Eggs Roundish and smooth, deposited in exuviae (up to two eggs per exuvia recorded). MOLECULAR MARKERS The sequences for all DNA markers were of a good quality. The sequenced fragments were of the following lengths: 1.727 bp (18 S rRNA; MG 800855), 819 bp (28 S rRNA; MG 800856), and 499 bp (ITS-2; MG 800857). All markers, including the specimen without cuticular plaques, were represented by single haplotypes. The p-distances between 18S haplotypes of all available isohypsibioid species and Fractonotus verrucosus n. comb. ranged from 2.0% (I. prosostomus Thulin, 1928, EF 620404 from Denmark) to 7.1% (Hexapodibius micronyx Pilato, 1969, HQ 604915 from Italy), with an average distance of 5.2%. As our 28S rRNA primers obtain a different gene fragment to the one sequenced by previous authors, comparisons of this gene were not possible. Matrices with p-distances are provided in the Supplementary Material 2. REMARKS The vast part of the Richters Collection has been lost, thus the type material (if ever existed) is not available for examination. Moreover, no specimens from Germany were examined in this study, therefore the neotype series is not established. Hence, until the redescription from the terra typica in Germany is available, we propose to consider the description of the Scottish specimens only as the current perception of the species. PHYLOGENETIC POSITION OF FRACTONOTUS AMONG OTHER ISOHYPSIBIIDAE Both Bayesian Inference and Maximum Likelihood methods unreservedly located Fractonotus within Isohypsibioidea (Fig. 13), thus corroborating the phenotypic analysis (see above). The genus Isohypsibius s.s. (i.e. I. prosostomus and its closest relatives) appears paraphyletic with respect to Fractonotus. However, in general, all isohypsibioid lineages clearly remain in polytomy, with only the occasional sound Bayesian posterior probabilities characterising clades with morphologically similar taxa. Therefore, the exact relationships between different isohypsibioid clades remain unsolved., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on pages 77-82, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","MURRAY J. 1911. - Clare Island Survey. 37: Arctiscoida. Proceedings of the Royal Irish Academy 31 (37): 1 - 16.","THULIN G. 1911. - Beitage zur Kenntnis der Tardigradenfauna Schwedens. Arkiv for Zoologi 7 (16): 1 - 60.","MARCUS E. 1928. - Spinnentiere oder Arachnoidea. IV: Bartierchen (Tardigrada). Tierwelt Deutschlands und der angrenzenden Meeresteile Jena 12: 1 - 230.","CUENOT L. 1932. - Tardigrades, in LECHEVALIER P. (ed.). Faune de France 24: 1 - 96.","CUNHA A. X. 1947 da. - Tardigrados da Fauna Portuguesa III. Memorias e estudos do Museu zoologico da Universidade de Coimbra 177: 1 - 9.","CUNHA A. X. DA 1948. - Tardigrados da Fauna Portuguesa IV. Memorias e estudos do Museu zoologico da Universidade de Coimbra 188: 1 - 8.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","MARCUS E. 1936. - Tardigrada. Das Tierreich, de Gruyter & Co., Berlin and Leipzig 66: 1 - 340.","FRANCESCHI T. 1951 - 1952. - Contributo alla conoscenza dei Tardigradi d'Italia. Bollettino dei Musei e degli Istituti Biologici dell'Universita di Genova 24 (149): 5 - 15.","MIHELCIC F. 1953. - Contribucion al conocimiento de los tardigrados con especial consideracion de los tardigrados de Osttirol (II). Anales de Edafologia y Fisiologia Vegetal 12 (5): 431 - 479.","FONTOURA A. P. 1981. - Contribution pour l'etude des tardigrades terrestres du Portugal, avec la description d'une nouvelle espece du genre Macrobiotus. Publicac o es do Instituto de Zoologia ' Dr Augusto Nobre', Faculdade de Ciencias do Porto 160: 1 - 24.","CUNHA A. X. DA 1943. - Un Tardigrade nouveau de Portugal: Hypsibius placophorus sp. n. Memorias e estudos do Museu zoologico da Universidade de Coimbra 155: 1 - 5.","MICHALCZYK L. & KACZMAREK L. 2005. - The first record of the genus Calohypsibius Thulin, 1928 (Eutardigrada: Calohypsibiidae) from Chile (South America) with a description of a new species Calohypsibius maliki. New Zealand Journal of Zoology 32: 287 - 292. https: // doi. org / 10.1080 / 03014223.2005.9518420","NELSON D. R. & MCGLOTHLIN K. L. 1996. - A new species of Calohypsibius (Phylum Tardigrada, Eutardigrada) from Roan Mountain, Tennessee-North Carolina, U. S. A. Zoological Journal of the Linnean Society 116: 167 - 174. https: // doi. org / 10.1006 / zjls. 1996.0014","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993.","KACZMAREK L., ZAWIERUCHA K., SMYKLA J. & MICHALCZYK L. 2012. - Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biology 35: 1013 - 1026. https: // doi. org / 10.1007 / s 00300 - 011 - 1149 - 0","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345."]}

Fractonotus gilvus (Biserov, 1986) n. comb. Isohypsibius gilvus Biserov, 1986: 984. REMARK Elliptical organs not always visible due to developed sculpturing in the cephalic portion of the body.

Genus Fractonotus Pilato, 1998 Fractonotus Pilato, 1998: 132. AMENDED DIAGNOSIS. ��� Small isohypsibiid (rarely exceeding 200 ��m, Fig. 1). Cephalic elliptical organs present (Fig. 7 A). Dorsum and limbs covered with densely arranged, blunt protuberances. Six peribuccal lobes present (Fig. 6 A). Apophyses for the insertion of stylet muscles (AISM) asymmetrical with respect to the frontal plane ��� the dorsal apophysis subdivided into two portions: the anterior portion in the shape of a slightly convex longitudinal thickening (and the posterior portion as weakly developed blunt hook); the ventral apophysis in the shape of a mild and long ridge (Fig. 9 A). Very large pharyngeal apophyses and placoids in the muscle pharynx. Stylet furcae of the Fractonotus - type, i.e. with broad, trapezoid base, thin arms and rounded apices (Figs 8 D, 10 A). Claws of the modified Isohypsibius - type, with triangular bases and strongly curved claw branches (Fig. 12 A, B). Accessory points symmetrical or occasionally asymmetrical. Smooth eggs laid in exuviae. DIFFERENTIAL DIAGNOSIS. ��� Fractonotus shares pronounced cuticular sculpturing with some species of six other parachelan genera: Calohypsibius Thulin, 1928, some Ramazzottius Binda & Pilato, 1986, Hypsibius Ehrenberg, 1848, Pilatobius Bertolani, Guidetti, Marchioro, Altiero, Rebecchi, Cesari, 2014, Doryphoribius Pilato, 1969 and Isohypsibius Thulin, 1928, but it can be readily distinguished from these genera by the morphology of the stylet furcae (square/trapezoid in Fractonotus vs narrower and more rectangular in the latter genera; compare Figs 7 B, D; 10 A-C). Furthermore, Fractonotus differs from Ramazzottius, Hypsibius and Pilatobius by having Isohypsibius -like claws (claws of the latter genera are of the Hypsibius or of the modified Hypsibius- type). Moreover, the genus differs specifically from: ��� Calohypsibius Thulin, 1928 (Hypsibioidea: Calohypsibiidae), by having a different type of cuticular sculpture (roundish or oval tubercles covering the entire dorsum and limbs with smooth dorsal pebble-shaped plaques in Fractonotus, Fig. 5 A-D vs multangular or star-like tubercles and occasional spines arranged less densely in Calohypsibius, Fig. 5 E, F), different structures surrounding the mouth opening (six soft and large peribuccal lobes in Fractonotus, Fig. 6 A vs six small well defined papulae in Calohypsibius, Fig. 6 B), a reversed morphology of the dorsal apophysis for the insertion of stylet muscles (an anterior thickening and a tiny posterior hook in Fractonotus, Fig. 7 E-G vs an anterior large blunt hook and a slight posterior thickening in Calohypsibius, Fig. 9 A, B), and by claw morphology (modified Isohypsibius - type claws with pseudolunulae, triangular bases, and elongated, strongly curved branches with conspicuous accessory points in Fractonotus, Figs 11 A-D; 12 A, B vs very small, rigid, with the base width equal to the sum of the primary and secondary branch widths, with the vertical septum between the two branches, and without pseudolunulae in Calohypsibius, Figs 11 E; 12 C, D). ��� Doryphoribius Pilato, 1969 (Isohypsibioidea: Isohypsibiidae), by the presence of elliptical organs on the head (absent in Doryphoribius), and by the absence of the ventral lamina on the buccal tube (ventral lamina present in Doryphoribius). ��� Isohypsibius Thulin, 1928 (Isohypsibioidea: Isohypsibiidae), by the presence of elliptical organs on the head (absent in Isohypsibius), a different shape of AISM (asymmetrical with respect to the frontal plane in Fractonotus, Fig. 7 E vs ridges symmetrical with respect to the frontal plane Isohypsibius, Figs 7 H, I; 9 A, C), and by the claw morphology (modified Isohypsibius - type claws with triangular bases, especially well-marked on the fourth pair of legs, in Fractonotus vs Isohypsibius - type claws with stalk-like bases in Isohypsibius, Figs 11 H, I; 12 E, F). COMPOSITION AND REMARKS Currently only three species, Fractonotus caelatus (the nominal taxon), F. verrucosus n. comb. and F. gilvus n. comb., are assigned to the genus. The three species are placed in the single genus because they share a number of taxonomically important traits: AISM shape, the presence of elliptical cephalic organs, two granular macroplacoids in the pharynx, and the type of cuticular sculpturing. On the other hand, Pilato (1998) described the claws of F. caelatus as of the Microhypsibius type, whereas claws in F. verrucosus n. comb. and F. gilvus n. comb. are closer to Isohypsibius type claws. Therefore, given the differences in claw morphology, there is a possibility that F. verrucosus n. comb. and F. gilvus n. comb. belong to a new isohypsibioid genus, and are only delusively similar to Fractonotus due to convergent evolution in the remaining traits. Nevertheless, the majority of traits suggest that all three species should be placed in Fractonotus. Biserov (1986) misinterpreted the AISM of F.gilvus n. comb. (Fig. 3 therein) as Isohypsibius - type AISM, but our observations of the type material confirm that the species has the AISM of the Fractonotus - type. However, there are more Isohypsibius and Hypsibius species, that exhibit cuticular sculpturing similar to that of Fractonotus. Thus, they may in fact belong to Fractonotus rather than Isohypsibius or Hypsibius. Nevertheless, we refrained from enacting more transfers, as a careful examination of individuals is needed to confirm whether these species, in addition to cuticular sculpturing, also exhibit other characteristics of Fractonotus., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 76, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993."]}

Genus Calohypsibius Thulin, 1928 Calohypsibius Thulin, 1928: 238. DIAGNOSIS. ��� Same as for the family Calohypsibiidae. ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� After Schuster et al. (1980), from Ancient Greek ����^��ς (k��llos) = beauty; derivatives calli-, callo- mean beautiful, pretty. Thulin most likely wanted to highlight the cuticular sculpturing, which is exceptionally complex, rich and unusual among Eutardigrada. COMPOSITION AND REMARKS Currently only three species, namely C. maliki Michalczyk & Kaczmarek, 2005 (Fig. 4 B), C. ornatus (Richters, 1900) (type species; Figs 3 C, D, 4 A), and C. schusteri Nelson & McGlothlin, 1996 (Fig. 4 C), are ascribed to the family. Nevertheless, Barto�� (1940) already described the remarkable variability within European records of the ornatus complex, which raises justifiable concerns as to whether C. ornatus encompasses only a single species. Further, as suggested by Pilato (1998), it is very likely that the genus comprises many more species than currently recognised. However, a systematic integrative study based on extensive sampling is needed to verify this hypothesis., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","SCHUSTER R. O., NELSON D. R., GRIGARICK A. A. & CHRISTENBERRY D. 1980. - Systematic criteria of the Eutardigrada. Transactions of the American Microscopical Society 99: 284 - 303.","MICHALCZYK L. & KACZMAREK L. 2005. - The first record of the genus Calohypsibius Thulin, 1928 (Eutardigrada: Calohypsibiidae) from Chile (South America) with a description of a new species Calohypsibius maliki. New Zealand Journal of Zoology 32: 287 - 292. https: // doi. org / 10.1080 / 03014223.2005.9518420","RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","NELSON D. R. & MCGLOTHLIN K. L. 1996. - A new species of Calohypsibius (Phylum Tardigrada, Eutardigrada) from Roan Mountain, Tennessee-North Carolina, U. S. A. Zoological Journal of the Linnean Society 116: 167 - 174. https: // doi. org / 10.1006 / zjls. 1996.0014","BARTOs E. 1940. - Uber die Variation der Art Hypsibius ornatus Richt. (Tardigrada). Zoologische Jahrbucher abteilung fur Systematik Okologie und Geographie der Tiere 73: 369 - 384.","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134."]}

TAXONOMIC ACCOUNT OF THE CALOHYPSIBIIDAE SENSU STRICTO Superfamily HYPSIBIOIDEA Pilato, 1969 (emended by Bertolani et al. 2014a) Family CALOHYPSIBIIDAE Pilato, 1969 (emended by Bertolani et al. 2014a) EMENDED DIAGNOSIS. ��� Very small eutardigrades (typically below 150 ��m) with elliptical organs on the head. Dorsum covered with irregular, multangular protuberances, and sometimes also with spines (Figs 3 C, D; 4; 5 E, F). Claws miniaturised, but not reduced, of the Calohypsibius - type, i.e. asymmetrical with respect to the sequence of primary and secondary branches (2-1-2-1), but similar in their size, with bases as large as the sum of the primary and secondary branch widths, but devoid of sutures. Pseudolunulae absent. Accessory points symmetrical (Figs 11 E; 12 C, D). Six peribuccal papulae present (Fig. 6 B). AISM asymmetrical with respect to the frontal plane, with the dorsal apophysis subdivided in two portions of different shape (Fig. 9 B). Stylet furcae of the Hypsibius - type (Fig. 10 B). Pharyngeal apophyses smaller than the tiny granular macroplacoids. Smooth eggs laid in exuviae. COMPOSITION. ��� A monotypic family, comprising the genus Calohypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BERTOLANI R., GUIDETTI R., MARCHIORO T., ALTIERO T., REBEC- CHI L. & CESARI M. 2014 a. - Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110 - 126. https: // doi. org / 10.1016 / j. ympev. 2014.03.006"]}

TAXONOMIC ACCOUNT OF THE MICROHYPSIBIIDAE SENSU STRICTO Superfamily HYPSIBIOIDEA Pilato, 1969 (emended by Bertolani et al. 2014a) Family MICROHYPSIBIIDAE Pilato, 1998 EMENDED DIAGNOSIS. ��� Very small eutardigrades (typically below 150 ��m in length) without elliptical organs on the head. Cuticle smooth. Claws minute and asymmetrical with respect to the sequence of primary and secondary branches (2-1-2-1), with thin bases continuous with the primary branches. External and internal, and anterior and posterior claws different in shape but similar in size. Pseudolunulae absent. Accessory points symmetrical (Fig. 11 G). Peribuccal papulae not visible under PCM. AISM asymmetrical with respect to the frontal plane, with the dorsal apophysis subdivided in two portions of different shapes (Fig. 9 A). Stylet furcae of the Hypsibius - type. Pharyngeal apophyses similar in size to macroplacoids. Smooth eggs laid in exuviae. COMPOSITION. ��� A monotypic family, comprising the genus Microhypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on pages 83-84, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BERTOLANI R., GUIDETTI R., MARCHIORO T., ALTIERO T., REBEC- CHI L. & CESARI M. 2014 a. - Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110 - 126. https: // doi. org / 10.1016 / j. ympev. 2014.03.006","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993.","MARCUS E. 1928. - Spinnentiere oder Arachnoidea. IV: Bartierchen (Tardigrada). Tierwelt Deutschlands und der angrenzenden Meeresteile Jena 12: 1 - 230.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","KACZMAREK L., ZAWIERUCHA K., SMYKLA J. & MICHALCZYK L. 2012. - Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biology 35: 1013 - 1026. https: // doi. org / 10.1007 / s 00300 - 011 - 1149 - 0"]}

Genus: Testechiniscus Kristensen, 1987 Amended genus diagnosis: Medium-sized echiniscids with black, crystalline eyes. Rigid buccal tube with large cuticular stylet supports. Appendaged, i.e. having both cephalic and trunk cirri. Two pairs of segmental plates, unpaired scapular and caudal plates. Three median plates. Cuticular sculpture composed of large true round or polygonal pores that gradually become reticulum. Incisions (notches) on caudal (terminal) plate. Eight rows of ventral plates. No pseudosegmental plates. Differential diagnosis. Phenotypic. Testechiniscus differs from Bryodelphax, Bryochoerus Marcus, 1936 and Echiniscus in having black eyes. Moreover, Testechiniscus can be separated from Bryodelphax and Bryochoerus by the presence of incisions on the caudal plate and cirri in positions other than A, and from Echiniscus by the presence of ventral armature covering the entire venter. Furthermore, Diploechiniscus has only two rows of ventral plates (subcephalic and genital) and double cuticular sculpture absent in Testechiniscus. Finally, Hypechiniscus Thulin, 1928 lacks trunk cirri (sometimes only an autapomorphic mediodorsal cirrus is present) and ventral plates; dorsal armature is very weakly sclerotised compared to large and strongly sclerotised plates in Testechiniscus. Genotypic. Based on the currently available sequences, the 18S rRNA p-distances within the genus Testechiniscus vary from 0.2% to 0.8%, and between Testechiniscus spp. and other currently recognised echiniscid genera they vary from 4.6% (E. granulatus (Doyère, 1840), MG016454) to 15.7% (Bryodelphax parvulus Thulin, 1928, HM193371, and B. maculatus Gąsiorek et al., 2017, KY609137). The corresponding comparisons for the 28S rRNA fragment yield higher minimal but lower maximal p-values between genera; respectively from 6.3% (E. trisetosus Cuénot, 1932 and E. canadensis Murray, 1910, FJ435781 and FJ435784, FJ435786) to 13.9% (Pseudechiniscus facettalis Petersen, 1951, FJ435788). Full p-distance matrices are provided in the Supplementary Materials (SM.2). Composition: Testechiniscus sensu stricto: T. spitsbergensis spitsbergensis, T. spitsbergensis tropicalis ssp. nov. and T. laterculus. Testechiniscus sensu lato includes T. macronyx and T. meridionalis (our analyses described below show that the two last species do not belong to the genus. However, their taxonomic status remains unchanged, pending formal taxonomic designations). Etymology: From Latin testa = shell, armour. The name refers to well-developed plates covering both dorsum and venter of animals (Kristensen 1987)., Published as part of Gąsiorek, Piotr, Stec, Daniel, Zawierucha, Krzysztof, Kristensen, Reinhardt Møbjerg & Michalczyk, Łukasz, 2018, Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus, pp. 261-297 in Zootaxa 4472 (2) on pages 265-266, DOI: 10.11646/zootaxa.4472.2.3, http://zenodo.org/record/1440175, {"references":["Kristensen, R. M. (1987) Generic revision of the Echiniscidae (Heterotardigrada), with a discussion of the origin of the family. In: Bertolani, R. (Ed.), Biology of Tardigrada. Selected Symposia and Monographs. U. Z. I. Mucci, Modena, pp. 261 - 335.","Marcus, E. (1936) Tardigrada. Das Tierreich, 66, 1 - 340.","Thulin, G. (1928) Uber die Phylogenie und das System der Tardigraden. Hereditas, 11, 207 - 266. https: // doi. org / 10.1111 / j. 1601 - 5223.1928. tb 02488. x","Doyere, M. L. (1840) Memorie sur les Tardigrades. Annales des Sciences Naturelles. Zoologie, 14, 269 - 362.","Cuenot, L. (1932) Tardigrades. In: Lechevalier, P. (Ed.), Faune de France, 24, pp. 1 - 96.","Murray, J. (1910) Tardigrada. British Antarctic Expedition 1907 - 1909. Reports on the Scientific Investigations, 1, Biology (Part V), 83 - 187.","Petersen, B. (1951) The Tardigrade Fauna of Greenland. Meddelelser om GrOnland, 150 (5), 1 - 94."]}

Autapomorphies of Testechiniscus meridionalis (Murray, 1906) and T. macronyx (Richters, 1907) (measurements and statistics of juveniles and adult specimens of both sexes of T. meridionalis in Tables 10–12) Both species assigned to the genus Testechiniscus by Kristensen (1987) and McInnes (1994a), respectively, exhibit unique phenotypic traits. Given that works on their systematic position are in progress (McInnes, personal communication), we do not designate them as new genera, but, instead, we present their autapomorphies, which exclude their affiliation within the revised Testechiniscus. Both species have brown lipoid or red eyes and are dioecious whereas Testechiniscus s.s. exhibits black crystalline eyes and parthenogenetic reproduction (although the presence of males was suggested in T. laterculus by Kathman & Dastych (1990)). Moreover, T. meridionalis resembles Testechiniscus s.s. in having eight rows of ventral plates, however it differs from Testechiniscus s.s. by: a smaller body size, i.e. with adults not exceeding 200 µm (compare Figs 1A–B, 6A–B, 10A–C and 12A–B, see Tables 10–11), whereas adults of Testechiniscus spp. are typically 300–450 µm long; smaller ventral plates (Figs 12C–D) with minute cuticular pillars that are more like in the Bryodelphax weglarskae group (see Dastych 1984, Kaczmarek et al. 2012) rather than in Testechiniscus spp.; the dorsal sculpture consisting solely of granules (Fig. 14E) and never polygonal pores typical for Testechiniscus (e.g. Fig. 14A); evident sexual dimorphism, i.e. cephalic papillae and primary clavae are significantly longer in males than in females (one-tailed Welch t -test for: cephalic papillae: t 3=4.07, p=0.013, and primary clavae: t 3=4.14, p=0.013, compare also Figs 12A, D, arrowheads). Finally, T. macronyx differs from the revised Testechiniscus by: a smaller body size (i.e. below 200 µm); the presence of only lateral, exceptionally long cirri A (Fig. 13A); nine (instead of eight) rows of small ventral plates (configuration IX:2-5-5-2-4-4-4-1-2, Fig. 13B); dorsal sculpture in the form of an irregular reticulum/pseudopores (see McInnes 1994a), that look like dark margins of minute bright depressions on the cuticle surface (Fig. 14F); and by considerably longer claws, curved slightly only in their terminal parts., Published as part of Gąsiorek, Piotr, Stec, Daniel, Zawierucha, Krzysztof, Kristensen, Reinhardt Møbjerg & Michalczyk, Łukasz, 2018, Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus, pp. 261-297 in Zootaxa 4472 (2) on page 285, DOI: 10.11646/zootaxa.4472.2.3, http://zenodo.org/record/1440175, {"references":["Murray, J. (1906) Scottish National Antarctic Expedition: Tardigrada of the South Orkneys. Transactions of the Royal Society of Edinburgh, 45 (12), 323 - 334. https: // doi. org / 10.1017 / S 0080456800022754","Richters, F. (1907) Antarktische Tardigraden. Zoologischer Anzeiger, 31, 915 - 916.","Kristensen, R. M. (1987) Generic revision of the Echiniscidae (Heterotardigrada), with a discussion of the origin of the family. In: Bertolani, R. (Ed.), Biology of Tardigrada. Selected Symposia and Monographs. U. Z. I. Mucci, Modena, pp. 261 - 335.","McInnes, S. J. (1994 a) Rediscovery of the species Echiniscus macronyx Richters, 1907 on South Georgia, South Atlantic, its new systematic position and redescription within the genus Testechiniscus. Bollettino di Zoologia, 61, 83 - 87. https: // doi. org / 10.1080 / 11250009409355863","Kathman, R. D. & Dastych, H. (1990) Some Echiniscidae (Tardigrada: Heterotardigrada) from Vancouver Island, British Columbia, Canada. Canadian Journal of Zoology, 68, 699 - 706. https: // doi. org / 10.1139 / z 90 - 102","Dastych, H. (1984) The Tardigrada from Antarctica with descriptions of several new species. Acta Zoologica Cracoviensia, 27 (19), 377 - 436.","Kaczmarek, L., Zawierucha, K., Smykla, J. & Michalczyk, L. (2012) Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biology, 35, 1013 - 1026. https: // doi. org / 10.1007 / s 00300 - 011 - 1149 - 0"]}

Mesobiotus romani sp. nov. (Tables 3���4, Figs 1���32) Material examined: Holotype and 30 paratypes (19 animals and 11 eggs). Specimens mounted on microscope slides in Hoyer���s medium, fixed on SEM stubs or processed for DNA sequencing. Description of the new species. Animals (measurements and statistics in Table 3). Body white in living specimens and transparent after fixation (Figs 1���3). Eyes absent after fixation in all studied specimens. Cuticle smooth, i.e. without gibbosities, papillae, spines, sculpturing or pores. Granulation present on external cuticle of all legs (Figs 4���9). Under SEM granulation visible as aggregates consisted of two to a dozen or so microgranules (Figs 6, 9). Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten peribuccal lamellae (Fig. 10). Mouth antero-ventral. The oral cavity armature well developed and with three bands of teeth (Figs 11���13). The first band of teeth comprises numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae (Fig. 11, arrowhead). The second band of teeth, situated between the ring fold and the third band of teeth, contains ridges parallel to the main axis of the buccal tube that are larger than in the granules of the first band (Fig. 12, arrow). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 12���13). The third band of teeth are divided into the dorsal and the ventral portion. Under PCM, dorsal teeth are visible as two lateral and one median transverse ridges (Fig. 12, indented arrowhead), whereas the ventral portion as two lateral ridges and two roundish median teeth (Fig. 13, empty arrowhead). In addition, on the ventral side some barely visible teeth (in shape of granules in LM) are present between second and third rows of teeth. Pharyngeal bulb spherical, with triangular apophyses, three rod���shaped macroplacoids, and a triangular microplacoid. Macroplacoid length sequence 3��1>2. The first macroplacoid narrower anteriorly, the second without constrictions and the third with a sub-terminal constriction (Fig. 14, arrowhead). Claws of the hufelandi type (Figs 15���18); internal, external, anterior and posterior identical in shape. Primary branches with distinct accessory points. Lunules under claws I���III smooth and dentate under claws IV (Figs 15��� 18). Thin cuticular bars under claws I���III present (Fig. 15, arrow). Other cuticular structures on legs absent. Eggs (measurements and statistics in Table 4). Laid freely, white, spherical and ornamented (Figs 19���20). Egg processes in the shape of wide, sharpened cones sometimes bifurcated at the tip or terminated by several short, thin and flexible filaments, visible both under PCM and SEM (Figs 25���32). The process surface is smooth with slight undulations poorly visible under PCM but clearer under SEM. Labyrinthine layer between process walls visible under PCM as a clear reticular pattern with the mesh (0.3���1.5 ��m in diameter), slightly increased in size from the tip to the base (Figs 25���28). In some processes, a slightly larger, bubble-mesh are present near the tip (Figs 25���28, arrowheads). Under SEM, clearly visible pores are present on the processes, but mainly toward the base (Fig. 24, arrowheads). Each process surrounded by a crown of thickenings, which form small ribs and then wrinkles on the egg surface (Figs 21, 22, 24, arrows). Under PCM, the surface between processes appears dotted or with small wrinkles (Figs 21���22), while under SEM, these are visible as small pores and ridges (Fig. 24). DNA sequences. The DNA was successfully extracted from only one of the three individuals used for the analysis. Nevertheless, from this one paragenophore we obtained sequences of very good quality for all four of the previously mentioned molecular markers, which are as follow: The 18S rRNA sequence (GenBank: MH197158), 1020 bp long; The 28S rRNA sequence (GenBank: MH197151), 808 bp long; The ITS-2 sequence (GenBank: MH197150), 486 bp long; The COI sequence (GenBank: MH195149), 658 bp long; Type locality: 00��45'34''N, 79��35'24W; 98 m asl: Tumbes-Choc��-Magdalena hotspot, Ecuador, Esmeraldas Province, next to E20 road to Quinind��, out of Chinca city, mixed moss and lichen on rock, collectors: Milena Roszkowska and Łukasz Kaczmarek. Etymology: The first author takes great pleasure in dedicating this new species to her friend���Roman Tarasewicz. Type depositories: Holotype: slide EC1319/6 (with six paratypes) and seven paratypes (two specimens and five eggs) (slides: EC1319/1, EC1319/2, EC1319/3, EC1319/8) are deposited at the Department of Animal Taxonomy and Ecology, Faculty of Biology, Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Umultowska 89, 61-614 Poznań, Poland; nine paratypes (six specimens and three eggs) (slides: EC1319/5, EC1319/7, EC1319/9) are deposited at the Museo Ecuatoriano de Ciencias Naturales, Secci��n de Entomolog��a, Rumipamba 341 y Av. de los Shyris, Quito, Ecuador. Phenotypic differential diagnosis. Based on the presence of reticulated, conical egg processes surrounded by crown of thickening and the absence of areolation on the egg surface, M. romani sp. nov. is most similar to the following 10 species: M. binieki (Kaczmarek, Gołdyn, Prokop & Michalczyk, 2011), M. coronatus (de Barros, 1942), M. dimentmani (Pilato, Lisi & Binda, 2010), M. patiens (Pilato, Binda, Napolitano & Moncada, 2000), M. perfidus (Pilato & Lisi, 2009), M. philippinicus Mapalo, Stec, Mirano-Bascos & Michalczyk, 2016, M. pseudoblocki Roszkowska, Stec, Ciobanu & Kaczmarek, 2016, M. pseudocoronatus (Pilato, Binda & Lisi, 2006), M. pseudopatiens Kaczmarek & Roszkowska, 2016, M. radiatus (Pilato, Binda & Catanzaro, 1991), M. rigidus (Pilato & Lisi, 2006), M. simulans (Pilato, Binda, Napolitano & Moncada, 2000) and M. wuzhishanensis (Yin, L. Wang & X. Li, 2011). Despite the similarities, M. romani sp. nov differs specifically from: M. binieki, only reported from the type locality in Bulgaria (Kaczmarek et al. 2011), by: the presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. binieki vs. 3��1> 2 in M. romani sp. nov. ), higher pt of: buccal tube external width, macroplacoid 2 length, microplacoid length, claw I���III primary and secondary external branches (see Tables 3 and 1 in Kaczmarek et al. (2011) for the exact differences), different shape of the egg processes (long, smooth flexible spines, with very wide bases in M. binieki vs. typically developed cones in M. romani sp. nov. ), presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, smaller egg diameter without processes (85.1���94.5 ��m in M. binieki vs. 62.0���85.0 ��m in M. romani sp. nov. ), longer egg processes (9.8���14.5 ��m in M. binieki vs. 14.6���21.4 ��m in M. romani sp. nov. ), wider egg process bases (6.5���9.0 ��m in M. binieki vs. 9.6���12.7 ��m in M. romani sp. nov. ) and smaller number of processes on the egg circumference (27���32 in M. binieki vs. 16���17 in M. romani sp. nov. ). M. coronatus, reported from a few localities in South America (de Barros 1942; Pilato et al. 2000; Kaczmarek et al. 2015), by: the absence of eyes*, presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. coronatus vs. 3��1> 2 in M. romani sp. nov. ), presence of several short, thin, and flexible filaments on the top of egg processes, larger egg diameter with and without processes (55.0���71.0 ��m, and 42.0���55.0 ��m respectively in M. coronatus vs. 95.4���116.1 ��m and 62.0���85.0 ��m respectively in M. romani sp. nov. ), longer egg processes (ca. 9.2 ��m in M. coronatus vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. dimentmani, reported from the type locality in Israel (Pilato et al. 2010), by: teeth of the third band visible as two lateral ridges and two roundish median teeth (three ridges in M. dimentmani), first macroplacoid narrower anteriorly (central narrowing in M. dimentmani), anterior and posterior claws IV of a clearly different length, shorter anterior and posterior claws IV, and lower pt of anterior and posterior primary and secondary branches of claws IV (see Tables 3 and 4 in Pilato et al. (2010) for the exact differences). M. patiens, recorded from a few localities in Italy (Pilato et al. 2000), by: the presence of dentate lunules IV, and presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip. M. perfidus, reported from three localities in the Seychelles (Pilato & Lisi 2009), by: the presence of first row of teeth in oral cavity, the absence of tubercles on dorsal cuticle, absence of eyes*, presence of granulation on legs I���III, presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, and higher number of processes on the egg circumference (11���13 in M. perfidus vs. 16���17 in M. romani sp. nov. ). M. philippinicus, reported from the type locality in Philippines (Mapalo et al. 2016), by: the absence of eyes*, no granulation visible under SEM, different macroplacoid length sequence (1>3> 2 in M. philippinicus vs. 3��1> 2 in M. romani sp. nov.), absence of granulation on the filaments at the tip of the egg processes, and longer egg processes (2.1���13.7 ��m in M. philippinicus vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. pseudoblocki, reported from the type locality in Argentina (Roszkowska et al. 2016), by: the absence of eyes*, presence of granulation on legs I���IV, different macroplacoid length sequence (1>3> 2 in M. pseudoblocki vs. 3��1> 2 in M. romani sp. nov.), presence of dentate lunules IV, larger internal secondary branch of claw III, higher pt of: stylet support insertion point, buccal tube external width, claw I���III external primary and internal secondary external branches, claw II���III external secondary branches (see Table 1 and 3 in Roszkowska et al. (2016) for the exact differences), larger egg diameter with processes (83.4���88.3 ��m in M. pseudoblocki vs. 95.4���116.1 ��m in M. romani sp. nov. ), longer egg processes (10.5���12.8 ��m in M. pseudoblocki vs. 14.6���21.4 ��m in M. romani sp. nov. ), wider egg process bases (5.8���7.6 ��m in M. pseudoblocki vs. 9.6���12.7 ��m in M. romani sp. nov. ), and smaller number of processes on the egg circumference (20���24 in M. pseudoblocki vs. 16���17 in M. romani sp. nov. ). M. pseudocoronatus, reported from the type locality on Seychelles (Pilato et al. 2006), by: the absence of tubercles on dorsal cuticle, absence of eyes*, higher number of processes on egg circumference (ca. 14 in M. pseudocoronatus vs. 16���17 in M. romani sp. nov. ), larger eggs with and without processes (ca. 82.3 and ca. 50.1 ��m respectively in M. pseudocoronatus vs. 95.4���116.1 and 62.0���85.0 ��m in M. romani sp. nov. ), and longer egg processes (10.9���12.7 ��m in M. pseudocoronatus vs. 14.6���21.4 ��m in M. romani sp. nov ). M. pseudopatiens, reported from the type locality in Costa Rica (Kaczmarek & Roszkowska 2016), by: the presence of first row of teeth in oral cavity, different macroplacoid length sequence (1>3> 2 in M. pseudopatiens vs. 3��1> 2 in M. romani sp. nov. ), presence of granulation on legs I���III, presence of dentate lunules IV, larger internal secondary branch of claw I and III, higher pt of: claw I internal secondary branches, claw II external primary and internal secondary branches, claw III external and internal secondary branches (see Table 1 and 3 in Kaczmarek & Roszkowska (2016) for the exact differences), higher number of processes on egg circumference (11���12 in M. pseudopatiens vs. 16���17 in M. romani sp. nov. ), and larger egg diameter with and without processes (80.4���88.0 and 55.5���59.3 ��m respectively in M. pseudopatiens vs. 95.4���116.1 and 62.0���85.0 ��m in M. romani sp. nov. ). M. radiatus, reported only from Tanzania, Democratic Republic of Congo and Kenya (Pilato et al. 1991, Stec et al. in review), by: smooth cuticle under SEM, absence of spurs on claws I���III, absence of pores on the top of egg processes, lack of microgranules on the filaments on the top of egg processes, higher number of processes on the egg circumference (10���12 in M. radiatus vs. 16���17 in M. romani sp. nov. ), and narrower egg processes (14.5���22.5 in M. radiatus vs. 9.6���12.7 in M. romani sp. nov. ). M. rigidus, reported from the type locality in New Zealand (Pilato & Lisi 2006), by: the presence of granulation on legs I���III, the presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, higher number of processes on egg circumference (ca. 12 in M. rigidus vs. 16���17 in M. romani sp. nov. ), and larger egg diameter with processes (ca. 91.0 ��m in M. rigidus vs. 95.4���116.1 ��m in M. romani sp. nov. ). M. simulans, recorded from a few localities in Italy and Israel (Pilato et al. 2000; Pilato et al. 2010), by: the absence of eyes*, presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, longer egg processes (up to 11 ��m in M. simulans vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. wuzhishanensis, reported from the type locality in China (Yin et al. 2011), by: the absence of eyes*, different macroplacoid length sequence (3>1> 2 in M. wuzhishanensis vs. 3��1> 2 in M. romani sp. nov. ), egg shell surface between processes dotted or with small wrinkles, and processes never trifurcated. *character uncertain; Hoyer���s medium has the potential to cause eyes to ���disappear���. Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances between the Mesobiotus romani sp. nov. and species of the genus Mesobiotus, for which sequences are available from GenBank (see Table 2 for details), are as follows (from the most to the least conservative): 18S rRNA: 1.1���5.9% (3.9% on average), with the most similar being M. philippinicus from Philippines (KX129793) and the least similar being M. cf. mottai from Antarctica (KT226072); 28S rRNA: 6.8���9.9% (8.5% on average), with the most similar being M. philippinicus from Philippines (KX129794) and the least similar being M. ethiopicus Stec & Kristensen, 2017 from Ethiopia (MF678792); COI: 19.6���23.4% (21.7% on average), with the most similar being M. insanis Mapalo, Stec, Mirano-Bascos & Michalczyk, 2017 from Philippines (MF441491) and the least similar being M. hilariae Vecchi, Cesari, Bertolani, J��nsoon, Rebecchi & Guidetti, 2016 from Antarctica (KT226108); ITS-2: 25.5���28.6% (27.1% on average), with the most similar being M. philippinicus from Philippines (KX129795) and the least similar being M. insanis from Philippines (MF441490)., Published as part of Roszkowska, Milena, Stec, Daniel, Gawlak, Magdalena & Kaczmarek, ��ukasz, 2018, An integrative description of a new tardigrade species Mesobiotus romani sp. nov. (Macrobiotidae: harmsworthi group) from the Ecuadorian Pacific coast, pp. 550-564 in Zootaxa 4450 (5) on pages 553-560, DOI: 10.11646/zootaxa.4450.5.2, http://zenodo.org/record/1445026, {"references":["Kaczmarek, L., Goldyn, B., Prokop, Z. M. & Michalczyk, L. (2011) New records of Tardigrada from Bulgaria with the description of Macrobiotus binieki sp. nov. (Eutardigrada: Macrobiotidae) and a key to the species of the harmsworthi group. Zootaxa, 2781, 29 - 39.","De Barros, R. (1942) Tardigrados de Estado de Sao Paulo, Brasil. II. Genero Macrobiotus. Revista Brasileira de Biologia, 2, 373 - 386.","Pilato, G., Lisi, O. & Binda, M. G. (2010) Tardigrades of Israel with description of four new species. Zootaxa, 2665, 1 - 28.","Pilato, G., Binda, M. G., Napolitano, A. & Moncada, E. (2000) The specific value of Macrobiotus coronatus De Barros 1942, and description of two new species of the harmsworthi group (Eutardigrada). Bollettino delle sedute della Accademia Gioenia di Scienze Naturali in Catania, 33, 103 - 120.","Pilato, G. & Lisi, O. (2009) Description of three new species of Tardigrada from the Seychelles. Zootaxa, 2005, 24 - 34.","Mapalo, M. A., Stec, D., Mirano-Bascos, D. & Michalczyk, L. (2016) Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines. Zootaxa, 4126 (3), 411 - 426. https: // doi. org / 10.11646 / zootaxa. 4126.3.6","Roszkowska, M., Stec, D., Ciobanu, D. A. & Kaczmarek, L. (2016) Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species. Zootaxa, 4105 (3), 243 - 260. https: // doi. org / 10.11646 / zootaxa. 4105.3.2","Pilato, G., Binda, M. G. & Lisi, O. (2006) Three new species of eutardigrades from the Seychelles. New Zealand Journal of Zoology, 33, 39 - 48. https: // doi. org / 10.1080 / 03014223.2006.9518429","Pilato, G., Binda, M. G. & Catanzaro, R. 1991. Remarks on some tardigrades of the African fauna with the description of three new species of Macrobiotus Schultze 1834. Tropical Zoology, 4, 167 - 178. https: // doi. org / 10.1080 / 03946975.1991.10539487","Yin, H., Wang, L. - H. & Li, X. - C. (2011) Two new species of genus Macrobiotus (Tardigrada: Macrobiotidae) from China. Proceedings of the Biological Society of Washington, 124 (3), 165 - 178. https: // doi. org / 10.2988 / 11 - 05.1","Stec, D. & Kristensen, R. M. (2017) An integrative description of Mesobiotus ethiopicus sp. nov. (Tardigrada: Eutradigrada: Parachela: Macrobiotidae: harmsworthi group) from the northern Afrotropic region. Turkish Journal of Zoology, 41, 800 - 811.","Mapalo, M. A., Stec, D., Mirano-Bascos, D. & Michalczyk, L. (2017) An integrative description of a limnoterrestrial tardigrade from the Philippines, Mesobiotus insanis, new species (Eutardigrada: Macrobiotidae: harmsworthi group). Raffles Bulletin of Zoology, 65, 440 - 454.","Vecchi, M., Cesari, M., Bertolani, R., Jonsoon, I. K., Rebecchi, L. & Guidetti, R. (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics, 30, 303 - 322. https: // doi. org / 10.1071 / IS 15033"]}

Macrobiotus canaricus sp. nov. urn:lsid:zoobank.org:act: AE3AAEA9-D20E-4917-8ECD-12B30DB514B6 Figs 1–7, Tables 5–6 Etymology The specific epithet refers to the Canary Islands, the place where the new species was found. Material examined (162 animals, 57 eggs) Specimens mounted on microscope slides in Hoyer’s medium (120 animals + 42 eggs), fixed on SEM stubs (20 + 15), processed for DNA sequencing (7 animals), and aceto-orcein staining (15 animals). Holotype SPAIN: Canary Islands, Gran Canaria, Fagajesto, 28°03′05″ N, 15°38′21″ W, moss on a tree trunk in a pine forest (slide IZiBB ES.004.04). Paratypes SPAIN: 127 specimens, same data as for holotype (slides IZiBB ES.004.01–24); 42 eggs, same data as for holotype (slides IZiBB ES.004.25–33). Description Animals (measurements and statistics in Table 5) Body white in adults, after fixation in Hoyer’s medium transparent (Fig. 1A). Eyes present both in live animals and in specimens mounted in Hoyer’s medium. Round and oval pores (0.4–0.7 μm in diameter), visible under PCM and SEM, scattered randomly on entire body cuticle (Fig. 2 A–F), including external and internal surface of all legs (Fig. 2 A–F). Extremely fine body granulation (granules 0.06–0.09 μm in diameter), visible only under SEM, present on the dorso-posterior cuticle (Fig. 2 E–F). Granulation patches on external surface of legs I–III clearly visible both under PCM and SEM (Fig. 3 A–B). Granulation patches on internal surface of legs I–III weakly visible under PCM but clearly visible under SEM (Fig. 3 C–D, empty indented arrowheads). Single, large, oval pore present at centre of each external patch on legs I–III (Fig. 3 A–B, filled flat arrowheads). Cuticular bulge, resembling pulvinus, present on internal surface of legs I–III (Fig 3 C–D, filled indented arrowheads). This structure is visible only if legs are fully extended and correctly oriented on slide. Cuticular granulation on legs IV present and always clearly visible both under PCM and SEM (Fig. 3 E–F). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes (Fig. 4 A–C). Under PCM, the oral cavity armature is of the maculatus type, i.e., only the third band of teeth is visible (Fig. 4A). Under SEM, the oral cavity is always composed of three bands of teeth (Fig. 4 B–C). The first band of teeth is composed of numerous extremely small cones arranged in one or two rows, situated anteriorly in the oral cavity, on the basal part of the peribuccal lamellae (Fig. 4 B–C, filled arrowhead). The second band of teeth is situated between the ring fold and the third band of teeth and consists of cones, clearly larger than those of the first band (Fig. 4 B–C, empty arrowhead). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4 B–C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a transversal ridge weakly divided into three teeth, whereas the ventral teeth appear as two separate lateral transverse ridges between which a roundish median tooth is visible (Fig. 4A). Under SEM, the dorsal teeth are divided into three separate teeth: one median and two lateral, the median tooth has a slightly serrated edge (Fig. 4B). The ventral teeth are also separated into one median and two lateral teeth (Fig. 4C). The medio-ventral tooth is much smaller than the medio-dorsal tooth (Fig. 4 B–C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small microplacoid (Fig. 4A). The first and the second macroplacoids have a fine central and a subterminal constriction, respectively. The macroplacoid length sequence is 2 Claws Y-shaped, of the hufelandi type (Fig. 5 A–D). Primary branches with distinct accessory points and with an evident stalk connecting the claw to the lunula (Fig. 5 A–D). Lunulae under all claws smooth (Fig. 5 A–D). Cuticular bars under claws absent but muscle attachments are visible under claws I–III (Fig. 5A, C, filled arrowhead). Eggs (measurements and statistics in Table 6) Laid freely, white, spherical or slightly oval (Figs 6 A–B, 7A). The surface between processes of the hufelandi type, i.e., covered by a reticulum with very thin walls (Figs 6 D–E, 7A–F). Peribasal meshes slightly larger and with slightly thicker walls compared to interbasal meshes (Figs 6 D–E, 7B–F). The mesh diameter is always larger then mesh walls and nodes/knots (Figs 6 D–E, 7B–F). The meshes are 0.3–1.0 μm in diameter, polygonal but with rounded edges. Under SEM, meshes deep and empty inside (Fig. 7 C–F). Processes in the shape of inverted goblets with concave conical trunks and well-defined terminal discs (Figs 6 C–F, 7A–F). Terminal discs strongly serrated, with a concave central area (Figs 6 C– F, 7B–F). Sparse ultragranulation on the edges of terminal discs visible only under SEM (Fig. 7 E–F). Three to five microgranules (0.25–0.30 μm in diameter), covered with ultragranulation, present in the centre of the terminal disc (visible only under SEM; Fig. 7 B–F, empty arrowheads). Reproductive mode The examined population is dioecious (gonochoristic). Males were identified using aceto-orcein staining, which revealed testicles filled with spermatozoa. However, no morphological secondary sexual dimorphism, such as gibbosities on hind legs in males, was identified. DNA sequences We obtained sequences for all four of the above-mentioned molecular markers. The two conservative nuclear markers (18S rRNA, 28S rRNA) were represented by single haplotypes, whereas ITS-2 and COI exhibited three and two haplotypes, respectively. The p-genetic distance between the ITS-2 haplotypes ranged from 0.5 to 1.1% and between COI haplotypes it was equal to 1.3%. The 18S rRNA sequence (GenBank: MH063925) was 1033 bp long. The 28S rRNA sequence (GenBank: MH063934) was 721 bp long. The ITS-2 haplotypes 1–3 were 413 bp long (GenBank: MH063928, MH063929 and MH063930, respectively). The COI haplotypes 1–2 were 658 bp long (GenBank: MH057765 and MH057766, respectively). Phenotypic differential diagnosis By the oral cavity armature of the maculatus type and hufelandi type of egg shell ornamentation, smooth lunules under claws of all legs and granulation at least on legs IV, the new species is similar to M. almadai Fontoura et al., 2008, M. humilis Binda & Pilato, 2001, and M. rawsoni Horning et al., 1978, but can be differentiated specifically from: Macrobiotus almadai, known only from the Azores (Fontoura et al. 2008), by the presence of the external and the internal patch of granulation on legs I–III (legs I–III smooth in M. almadai) and by the presence of a single large pore in the centre of the external patch on legs I–III (occasionally, regular cuticular pores may be present on some legs, but such pores are small and never present on all legs in the same place in M. almadai). Macrobiotus humilis, reported only from its type locality in Sri Lanka (Binda & Pilato 2001), by the presence of three separated dorsal teeth of the third band (dorsal teeth fused into a single transversal ridge in M. humilis), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. humilis), more posteriorly inserted stylet supports (pt = 74.3– 76.8 in the new species vs pt = 71.1–71.3 in M. humilis), slightly higher pt of the second macroplacoid length (pt= 14.6–19.6 in the new species vs pt = 12.5–14.4 in M. humilis) and by irregularly serrated edges of the terminal discs on egg processes (edges of terminal discs regularly indented in M. humilis). Macrobiotus rawsoni, known only from its type locality in New Zealand (Horning et al. 1978; Kaczmarek & Michalczyk 2017a), by the presence of granulation on all legs (granulation present only on legs IV in M. rawsoni), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. rawsoni), the absence of cuticular bars under the claws on legs I–III (thin paired bars present in M. rawsoni), more anteriorly inserted stylet supports (pt = 74.3– 76.8 in the new species vs pt= 77.0– 77.1 in M. rawsoni), a different morphology of reticulation on the egg surface between processes (several lines of mesh between neighbouring egg processes in the new species vs two lines of mesh between neighbouring egg processes in M. rawsoni) and by a smaller mesh size in the chorion reticulum (0.3–1.0 μm in diameter in the new species vs 1.8–2.5 μm in diameter in M. rawsoni). Genotypic differential diagnosis The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, for which sequences are available from GenBank, are as follows: • 18S rRNA: 0.5–3.7% (2.0% on average), being most similar to two undetermined species of the M. hufelandi group from Spain (FJ435738 –9) and to M. macrocalix from Poland (MH063926) and the least similar to M. polypiformis Roszkowska et al., 2017 from Ecuador (KX810008) • 28S rRNA: 1.9–13.2% (6.1% on average), being most similar to three undetermined species of the M. hufelandi complex from Spain (FJ435751 and FJ435754 –5) and the least similar to M. polypiformis from Ecuador (KX810009) • ITS-2: 5.3–27.8% (17.0% on average), with the most similar being M. macrocalix from Poland (MH063931) and the least similar being M. polypiformis from Ecuador (KX810010) • COI: 17.2–24.7% (19.2% on average), with the most similar being M. hannae Nowak & Stec, 2018 from Poland (MH057764) and the least similar being M. papei Stec et al., 2018 from Tanzania (MH057763)

Macrobiotus cf. recens Cu��not, 1932 Figs 8���14, Tables 7���8 Material examined (114 animals, 48 eggs) SPAIN: Canary Islands, Gran Canaria, Presa de Lugarejos, 28��02���38��� N, 15��40���22��� W, 885 m a.s.l., lichen on a stone wall. Specimens mounted on microscope slides in Hoyer���s medium (87 animals + 38 eggs), fixed on SEM stubs (8+10), processed for DNA sequencing (4 animals) and used for acetoorcein staining (15 animals). Slide depositories: 87 animals (slides: ES.006.*, where the asterisk can be substituted by the following numbers 1���4, 10���12, 14���17) and 38 eggs (slides: ES.006.*: 5���9, 13) (IZiBB). Description of the population from Gran Canaria Animals (measurements and statistics in Table 7) Body white in juveniles and slightly yellowish in adults, after fixation in Hoyer���s medium transparent (Fig. 8A). Eyes present in live animals and in specimens mounted in Hoyer���s medium. Elliptical and sometimes roundish pores (1.0���1.8 ��m in diameter), visible under PCM and SEM, scattered randomly on entire body cuticle (Fig. 8 B���E), including the external and internal surface of all legs (Fig. 9 A���I). Inside pores several granules, visible only under SEM, always present (Fig. 8E). Granulation patch on external and internal surfaces of legs I���III present (Fig. 9 A���E). Single pore present at centre of each external granulation patch (Fig. 9 A���C). Granulation patch on external surface larger and more distinct than the one on internal surface (Fig. 9 A���E). Faint cuticular fold present on external surface of legs I��� III just above claws (Fig. 9 A���B, empty arrowhead), whereas on internal surface of legs I���III there is a cuticular bulge resembling pulvinus (Fig. 9 D���E, filled arrowhead). Both external fold and internal bulge visible only if legs are fully extended and correctly oriented on slide (particularly cuticular fold above claws). Granulation on legs IV always clearly visible and consists of two granulation patches: the distal patch with densely distributed granules situated just above claws and the proximal patch being wider with more sparsely distributed granules located immediately above distal patch (Fig. 9 G���I). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 10 A���C), with ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes. Under PCM, oral cavity armature of the hufelandi type, i.e., with all three bands of teeth always visible (Fig. 10 B���C). First band of teeth composed of numerous very small cones arranged in four to six rows situated anteriorly in oral cavity, just behind bases of peribuccal lamellae (Figs 10 B���C, 11A���B, filled arrowhead). Second band of teeth situated between ring fold and third band of teeth and comprises 4���5 rows of small cones, slightly larger than those of first band (Figs 10 B���C, 11A���B, empty arrowhead). Teeth of the third band located within posterior portion of oral cavity, between the second band of teeth and buccal tube opening (Figs 10 B���C, 11A���B). Third band of teeth discontinuous and divided into dorsal and ventral portions. Under PCM, dorsal teeth seen as three distinct transversal ridges, whereas ventral teeth appear as two separate lateral transversal ridges and a roundish median tooth (Fig. 10 B���C). Under SEM, both dorsal and ventral teeth clearly distinct (Fig.11 A���B). Medio-ventral tooth rarely divided into two or three smaller teeth (Fig. 11B). Under SEM, margins of dorsal and latero-ventral teeth slightly serrated (Fig. 11 A���B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and one big rod-shaped microplacoid (Fig. 10 D���E). Macroplacoid length sequence 2 hufelandi type (Fig. 12 A���D). Primary branches with distinct accessory points and with an evident stalk connecting claw to lunula (Fig. 12 A���D). Lunulae I���III smooth (Fig. 12A, C), whereas lunulae IV slightly crenulated (Fig. 12B, D). Faint cuticular bars under claws I���III present, more visible in larger specimens (Fig. 12A, C). Horseshoe-shaped structure connects anterior and posterior lunules (Fig. 12B). Eggs (measurements and statistics in Table 8) Laid freely, white/light yellow, spherical or slightly oval (Figs 13 A���B, 14A). Surface between processes of the hufelandi type, i.e., chorion surface between processes covered by reticulum with very small meshes (Figs 13 C���D, 14B���E). Under PCM, surface between processes seems to be covered by dark dots (Fig. 13C) and only sometimes a clear reticulation is visible (Fig. 13D). Several rows of meshes between egg processes (usually 7���8). Mesh borders and nodes/knots thick and sometimes wider than mesh diameter (Fig. 14 B���E). Meshes circular or slightly oval (0.4���0.9 ��m in diameter) and under SEM all pores empty inside (Fig. 14 C���D). Mesh diameter decreases gradually from peribasal to interbasal meshes (Fig. 14 C���D). Short thickenings radiating from process bases are often visible under PCM and always visible under SEM; thickenings may create a crown around process bases (Figs 13C, 14 C���D, filled arrowheads). Processes in the shape of high and thin cones with straight conical trunks, devoid of terminal discs and sometimes bifurcated (Figs 13 A���F, 14A���F). Trunks of processes slightly undulated. Undulations covered by numerous granules composed of microgranule aggregations. Undulations and granules poorly visible under PCM (Fig. 13 C���F). Undulations, granules and microgranules always clearly visible under SEM (Fig. 14B, E���F). Reproductive mode The examined population is dioecious (gonochoristic). Males were identified using aceto-orcein staining, which revealed testicles filled with spermatozoa. However, no morphological secondary sexual dimorphism, such as gibbosities on hind legs in males, was identified. DNA sequences We obtained sequences for all four of the above-mentioned molecular markers. The two conservative nuclear markers (18S rRNA, 28S rRNA) were represented by single haplotypes, whereas both ITS-2 and COI exhibited two haplotypes. The p-genetic distance between the ITS-2 as well as between the COI haplotypes was 1.1%. The 18S rRNA sequence (GenBank: MH063927) was 1033 bp long, the 28S rRNA sequence (GenBank: MH063936) was 725 bp long, the ITS-2 haplotype 1 and 2 sequences (GenBank: MH063932 and MH063933, respectively) were 420 bp long; the COI haplotype 1 and 2 sequences (GenBank: MH057768 and MH057769, respectively) were 658 bp long. Genotypic differential diagnosis The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, for which sequences are available from GenBank, are as follows: ��� 18S rRNA: 0.4���4.0% (2.0% on average), with the most similar being M. macrocalix from Poland (MH063926) and the least similar being M. polypiformis from Ecuador (KX810008) ��� 28S rRNA: 1.3���13.6% (6.5% on average), with the most similar being M. macrocalix from Poland (MH063935) and the least similar being M. polypiformis from Ecuador (KX810009) ��� ITS-2: 3.7���26.7% (16.9% on average), with the most similar being M. macrocalix from Poland (MH063931) and the least similar being M. polypiformis from Ecuador (KX810010) ��� COI: 16.4���24.7% (19.1% on average), with the most similar being M. macrocalix from Italy (FJ176203 ���7 and FJ176213 ���7) and the least similar being M. papei from Tanzania (MH057763) Molecular phylogeny Phylogenetic analyses conducted on macrobiotid 18S rRNA sequences as well as on the concatenated macrobiotid data set unambiguously confirmed that the two studied species represent the M. hufelandi group (Figs 15���16). The phylogeny based on the COI sequences of the hufelandi group also corroborated these results, since none of the two species were recovered external to the species of the hufelandi group (Fig. 17). In all analyses, two clades within the hufelandi group were present, although the species composition varied slightly between phylogenies based on different markers. One clade grouped exclusively species that exhibit modified egg processes (M. paulinae Stec et al., 2015, M. polypiformis, M. papei, M. shonaicus Stec et al., 2018a, M. scoticus Stec et al., 2017b and M. kristenseni Guidetti, Peluffo, Rocha, Cesari & Moly de Peluffo, 2013); ���the kristenseni clade��� henceforth. The other clade comprised mostly species with typical inverted goblet-shaped egg processes (���the hufelandi clade��� hereafter). In contrast to our predictions, M. cf. recens, with its atypical egg processes, was always embedded within the hufelandi clade. The two clades were well supported in phylogenies based on the concatenated data set and on COI sequences, but weakly supported in the 18S rRNA tree (Figs 15���17). Moreover, in the 18S rRNA analysis the kristenseni clade, in addition to the majority of species with modified egg processes, comprised M. sapiens Binda & Pilato, 1984 (DQ839601) and undetermined species of the M. hufelandi group (HQ604971), of which at least the first species exhibits the typical egg morphology. In contrast to other analyses, the 18S rRNA phylogeny recovered a clade, with X. pseudohufelandi (Iharos, 1966) and M. polonicus Pilato, Kaczmarek, Michalczyk & Lisi, 2003, that was in a sister relationship to all other species of the hufelandi group, suggesting that the hufelandi group is polyphyletic or that Xerobiotus belongs to the hufelandi group (Fig. 15)., Published as part of Stec, Daniel, Krzywa��ski, ��ukasz & Michalczyk, ��ukasz, 2018, Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae), pp. 1-36 in European Journal of Taxonomy 452 on pages 17-26, DOI: 10.5852/ejt.2018.452, http://zenodo.org/record/3814676, {"references":["Stec D., Smolak R., Kaczmarek L. & Michalczyk L. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052 (5): 501 - 526. https: // doi. org / 10.11646 / zootaxa. 4052.5.1","Stec D., Arakawa K. & Michalczyk L. 2018 a. An integrative description of Macrobiotus shonaicus sp. nov. (Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS One 13 (2): e 0192210. https: // doi. org / 10.1371 / journal. pone. 0192210","Stec D., Morek W., Gasiorek P., Blagden B. & Michalczyk L. 2017 b. Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: hufelandi group) from Scotland by means of integrative taxonomy. Annales Zoologici 67 (2): 181 - 197. https: // doi. org / 10.3161 / 00034541 ANZ 2017.67.2.001","Guidetti R., Peluffo J. R., Rocha A. M., Cesari M. & Moly de Peluffo M. C. 2013. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). Journal of Natural History 47 (37 - 38): 2409 - 2426. https: // doi. org / 10.1080 / 00222933.2013.800610","Binda M. G. & Pilato G. 1984. Macrobiotus sapiens, nuova specie di Eutardigrado di Sicilia. Animalia 11: 85 - 90."]}

Macrobiotus papei sp. nov. (Tables 3���4, Figures 1���7) Material examined: 131 animals (including 10 specimens in simplex stage), and 81 eggs. Specimens mounted on microscope slides in Hoyer���s medium (49 animals + 66 eggs), fixed on SEM stubs (20+15), and processed for DNA sequencing (6+0), aceto-orcein staining (50+0), and single individual culturing (6+0). Description of the new species. Animals (measurements and statistics in Table 3). Body white in juveniles and slightly yellowish in adults, after fixation in Hoyer���s medium transparent (Fig. 1A). Eyes present in all live animals (dissolved in 80% of specimens mounted in Hoyer���s medium). Small round and oval pores (0.6���1.1 ��m in diameter), visible under PCM and SEM, scattered randomly over the entire body cuticle (Fig. 1B���E), including the external and internal surface of all legs (Fig. 2B���E). Two cuticular granulation patches, one on the external and the other on the internal surface, are present on legs I���III (Fig. 2A���D). Granulation on the external surface (Fig. 2A���B) is bigger and more distinct than the on the internal surface (Fig. 2C���D). A cuticular bulge/fold, resembling a pulvinus, is present on the internal surface of legs I���III (Fig 2C���D, filled arrowhead), whereas a faint cuticular fold is present just above the claws (Fig. 2C���D, flat empty arrowhead). Both structures are visible only if the legs are fully extended and well oriented on the slide (particularly in the case of the cuticular fold above the claws). Cuticular granulation on legs IV is always clearly visible and consists of two granulation patches: the distal patch with densely distributed granules situated just above the claws and the proximal patch being wider with more sparsely distributed granules located just above the first patch (Fig. 2E���F). Sometimes muscle attachments are also visible under claws I���III (Fig. 2C���D, arrow) Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes (Figs 3A and 4A���C). An irregular ring of pores, clearly visible using SEM and occasionally under PCM, is present around the mouth opening, immediately behind the peribuccal sensory lobes (Figs 3B and 4A, arrow). Under PCM, the oral cavity armature is of the patagonicus type (only the second and third band of teeth visible under light microscopy (LM) in the majority of specimens (Fig. 3B���C) but in smaller individuals the oral cavity armature is of the maculatus type (only the third band of teeth visible under LM) (Fig. 3D���E). However, under SEM the oral cavity comprises three bands of teeth, i.e. under PCM only the third band or only the second and the third band of teeth are visible (Fig. 3B���E), whereas all three bands are always detectable in SEM (Fig. 4B���C). The first band of teeth consists of numerous extremely small cones arranged in one to two rows situated anteriorly in the oral cavity, just behind the base of the peribuccal lamellae (Fig. 4B���C, flat filled arrowhead). The second band of teeth are situated between the ring fold and the third band of teeth and comprises 4���5 rows of small cones, slightly bigger than those of the first band (Fig. 4B���C, empty flat arrowhead). Under PCM, only the larger teeth of second band are visible in larger specimens and often appear as very weakly developed (Fig. 3B���C, empty flat arrowhead). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4B���C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a single transverse ridge with obvious thickenings, whereas the ventral teeth appear as two separate lateral transverse ridges between which a roundish median tooth is visible (Fig. 3B���E). The medio-ventral tooth is occasionally divided into two smaller rounded teeth. Under SEM, the dorsal teeth form a single ridge with two larger lateral peaks and several smaller median peaks and indentations (Fig. 4B) which correspond to thickenings visible under LM (Fig. 3B). The ventral teeth are separated into one median and two lateral teeth (Fig. 4C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular small microplacoid (Fig. 3A). The macroplacoid length sequence 2hufelandi type (Fig. 5A���D). Primary branches with distinct accessory points, a long common tract, and with an evident stalk connecting the claw to the lunula (Fig. 5A���D). Lunulae I���III smooth (Fig. 5A, C), whereas lunulae IV sparsely dentate (Fig. 5B, D). Cuticular bars under claws absent. Eggs (measurements and statistics in Table 4). Laid freely, white/light yellow, spherical or slightly oval (Figs 6A���B and 7A). The surface between processes of an intermediate type between the hufelandi and the maculatus type, i.e. chorion surface covered numerous small pores that form a reticulum with thick walls (Figs 6B���D and 7A��� F). Pores are similar in size and uniformly scattered over the entire surface, i.e. there no peribasal rings of elongated pores/bigger mesh around the processes. There are several rows of pores between processes and the mesh bars and nodes are often wider than the pore diameter (Figs 6C���D and 7B���F). The pores in the reticulum are circular or slightly oval (0.3���0.6 ��m in diameter) and under SEM almost all pores are empty inside (Fig. 7C���E). Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs (Figs 6E���F and 7A���F). Terminal discs are cog-shaped, with a concave central area and with 10���15 small irregular teeth (Figs 6E���F and 7B���F). Almost all teeth on the terminal disc are elongated into thin flexible filaments, less than 0.3 ��m in diameter and 2���7 ��m in length (Figs 6E���F, filled arrowhead and 7B���F). The filaments are hair-like under PCM (Fig. 6E���F) and under SEM are completely smooth as is the surface of terminal discs (Fig. 7D���F). Under PCM, the filaments are clearly visible, however the filaments are very thin and could be overlooked and/or misinterpreted as debris attached to the eggs, if close attention is not paid during examination. Reproductive mode. Staining 50 adults of the new species with aceto-orcein did not reveal any individuals with a testicle filled with spermatozoa (males), an ovotestis with spermatozoa and oocytes (hermaphrodites), or with spermatozoa in a spermatheca (inseminated females). Only females with oocytes in the ovary or specimens of an undetermined sex were observed. Moreover, both PCM and SEM observations showed no morphological secondary sexual dimorphism such as gibbosities on legs IV (e.g. Rebecchi & Nelson 1998). Furthermore, to test whether females are capable of parthenogenetic reproduction, we isolated eggs and observed the full cycle of hatchlings maturing to adults, laying the next generation of eggs still in isolation, and the emergence of the second generation, also from individually isolated eggs (i.e. there was no possibility of fertilisation). Thus, all lines of evidence show the type population of M. papei sp. nov. comprises only females capable of parthenogenetic reproduction. DNA sequences. We obtained very good quality sequences for all four molecular markers from all analysed specimens (paragenophores). DNA sequences of all markers were represented by single haplotypes: The 18S rRNA sequence (GenBank: MH063881), 905 bp long: TAGATCGTAATTTTACACGGATAACTGTGGTAATTCTAGAGCTAATACGTGCAACCAGCTCGTTCCCTTGTGGAGCGAGC GCAGTTATTAGAACAAGACCAATCCGGCCTTCGGGTCGGTACAATTGGTGACTCTGAATAACCGAAGCGGAGCGCATGGT CTCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTTCAACGGG TAACGGGGTATCAGGGTCCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAA ATTACCCACTCCTAGCACAGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCTAATAGCTTCTCGTAATCGGAATGGGT ACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCG TATATTAAAGTTGCTGCGGTTAAAAGCTCGTAGTTGGATCTGGGCTTCTGAATGGATGGTTCACTTTACGGTGTAACTGT TCGTTTGGTGCCACAAGCCGGCCATGTCTTGCATGCCCTTTACTGGGTGTGCATGGCGACCGGAACGTTTACTTTGAAAA AATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGT TGGTTTTCGGAACTCGAGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGG ATCGTCGCAAGACGAACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAG GCGATCAGATACCGCCCTAGTTCTA The 28S rRNA sequence (GenBank: MH063880), 787 bp long: TACTAAGCGGAGGAAAAGAAACCAACGGGGATGCCGACAGTAACTGCGAGTGAAATCGGCCAAGCCCAGCGCCGAATCCT GTTGCTGGTAACGGTGGTAGGAACTGTGGCGTGAAGAACGTCCTTACCGGTACGGTTTGCGTGCGTAAGTTCTCCTGAGT GAGGCTCCATTCCAAGGAGGGTGCAAGACCCGTATCGCGTGCAACCGGTATCGGTGTAAGATGTTCGGAGAGTCGCCTTG TTTGTGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGAACAAGTACC GTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAAATGGGGCCTC GAAGGCAAGGCAGCGAATTCAGCTGGTGGTCTGCGTGGCTGGCCGGTTAAGTGATCTTAACGACTCTTGCCGGTTATGTC TAGCGTAGGTGCCAGTGCACTTTCGTTGCTTGTACGCCACCGCCGTTGAGTGGGCATCCGTCGGGTTGGTAACGCGAAGC CTTACGCCTTCACGGGCGTAGGTGCTTGCAGCCGACTTTGTACGCGTTTGCACTTCAACCGGTCATGTTTGCATGTGCCA GCATTTGCGTTGGATTGGCTCGCTCTGCCGTTTGTCGTGAGATGACGAGCTTGCTCGGCTCTTCGGCATCTATGGTAGAC TCGTGTCGGTTTTCAACGTGGGCACATTGTTAATTCGGTGGCGAGTAGATGGCTGCCCATTTAACCC The ITS-2 sequence (GenBank: MH063921), 397 bp long: TTTGTGAACGTTAATTCTTCGAACGCACATTGCGGCTTCGGGTTAACTGAAGCCATGCCTGGTTGAGGGTCAGTTGAAGA AAAAAATCGTAATCGCGCATTGATTACGGAGTGTCTGGTTAATGGCTCGTCCGTTTCCAGATGAAGTATAGACCAGATGT GTGCGCTCATTTGACCGGTGCAAGCAACGCTTTGCCGAGTTGGAGCATTCGGCTTTCTTAGCCGTGCGCCGCAGTTGCAC GATGGCTAAGTTGGCTACCAACAATGGCGAAGTAAGACCGGTTCAGAGGTGCGCAACGCAATAGGCACATCTGTGTACCA AAAAGAACGTACGGTCGCGGTGTTTCGACCGATGCGGACTTAACTCATTCTTTTGACCTCAGCTCAGACAAGATTAC The COI sequence (GenBank: MH057763), 745 bp long: ACTGCCTCTGTGGGAACGTCCTTAAGATTTCTAATTCGGAGGGAATTAAGCCAACCAGGGCTTCTTCTCTCCGACGAACA AATATATAATGTGATTGTAACAAGCCACGCATTTATTATAATTTTTTTTTTCGTGATACCAATTTTAATCGGGGGATTCG GGAACTGACTGGTCCCCCTTATAATTAGAGCACCAGACATAGCTTTTCCACGAATAAATAATTTAAGCTTCTGGATACTG CCCCCCTCTTTTTTCCTAATTACTTTAAGCTCGATAACTGAACAGGGGGCCGGAACCGGATGAACTGTTTACCCACCCCT TTCTCATTTTTTTGCTCACAGGGGCCCTAGAGTAGATCTTACAATTTTTTCACTTCATGTGGCGGGAATTTCATCAATTT TAGGGGCTATTAATTTCATTTCTACAATTCTAAATATGCGAGTACCCCACCTAACCTTAGAAAAAATACCTCTCTTTGTG TGATCCGTTTTTTTAACAGCTATTTTATTACTTCTGGCCCTCCCAGTATTGGCAGGAGGTATTACTATGCTATTACTGGA CCGAAACTTTAATACTTCTTTTTTTGACCCTGCGGGGGGGGGAGACCCTATTTTATACCAACACCTATTTTGGTTTTTTG GCCACCCCGAAGTATATATTTTAATCTTACCAGGCTTTGGAATTATCTCACAAATCGTTATTCACTTCAGAGGAAAATCT CTCACATTCGGACATTTAGGAATAA Type locality: 7��49'25''S, 36��49'32''E; 2050 m asl: Tanzania, Morogoro Region, Udzungwa Mts. National Park, Mwanihana Peak; lichen on branches of a bush; coll. 16.08.2016 by Thomas Pape. Etymology: We take great pleasure in dedicating this new species to the colleague and friend of the first and the second authors, an established taxonomist of Diptera, Thomas Pape, Head of Section of Biosystematics of the Natural History Museum of Denmark, University of Copenhagen. Type depositories: Holotype (slide TZ.027.01 with 2 paratypes) and 34 paratypes (slides: TZ.027.*, where the asterisk can be substituted by any of the following numbers 02���06, 0 8, 22) and 56 eggs (slides: TZ.027.*: 10���16, 18, 19, 21) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Krak��w, Poland and 12 paratypes (slides: TZ.027.*: 0 7, 09) and 10 eggs (slides: TZ.027.*: 17, 20) are deposited in the Zoological Museum, Natural History Museum of Denmark, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen ��, Denmark., Published as part of Stec, Daniel, Kristensen, Reinhardt M��bjerg & Michalczyk, ��ukasz, 2018, Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania), pp. 273-291 in Zootaxa 4446 (2) on pages 277-287, DOI: 10.11646/zootaxa.4446.2.7, http://zenodo.org/record/1444173, {"references":["Rebecchi, L. & Nelson, D. R. (1998) Evaluation of a secondary sex character in eutardigrades. Invertebrate Biology, 117, 194 - 198."]}

Taxonomic key to the dujardini group species Definitiοn: Hypsibius spp. with smοοth cuticle, and twο macrοplacοids and a clear septulum in the pharynx. Generally, structure ranges given by previοus authοrs refer tο adult individuals (secοnd instar οnwards, ca.> 200 µm in bοdy length). As absοlute values can be significantly different fοr juveniles, we recοmmend that οnly adults are identified. Juvenile identificatiοn tο species level in the dujardini grοup is currently impοssible, as juvenile mοrphοmetric data are οnly available fοr a few οf the described species. 1. Cuticular bars on legs I–III present.................................................................... 2 - Cuticular bars on legs I–III absent..................................................................... 4 2(1). Septulum longer than 1.5 µm........................................................................ 3 - Septulum no longer than 1.0 µm............................................. H. heardensis Miller et al., 2005 3(2). The pt of SSIP higher than 64.0%............................................ H. septulatus Pilato et al., 2004 - The pt of SSIP lower than 62.5%......................................... H. conwentzii Kaczmarek et al., 2018 4(1). The pt of SSIP higher than 65.5%.................................................... H. exemplaris sp. nov. - The pt of SSIP lower than 64.5%..................................................................... 5 5(4). The pt of SSIP higher than 57%...................................................................... 6 - The pt of SSIP lower than 56%............................................... H. pallidoides Pilato et al., 2011 6(5). External and posterior primary claw branches longer than 14 µm.................... H. valentinae Pilato et al., 2012 - External and posterior primary claw branches shorter or equal to 14 µm....................................... 7 7(6). The pt of the external buccal tube width higher than 6.5%, pt of the septulum length below 7%............................................................................................ H. dujardini s.s. (Doyère, 1840) - The pt of the external buccal tube width lower than 6.5%, pt of the septulum length above 7%........................................................................................... H. seychellensis Pilato et al., 2006, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on page 69, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Miller, W. R., McInnes, S. J. & Bergstrom, D. (2005) Tardigrades of the Australian Antarctic: Hypsibius heardensis (Eutardigrada: Hypsibiidae: dujardini group) a new species from sub-Antarctic Heard island. Zootaxa, 1022, 57 - 64.","Pilato, G., Binda, M. G., Napolitano, A. & Moncada, E. (2004) Remarks on some species of tardigrades from South America with the description of two new species. Journal of Natural History, 38 (9), 1081 - 1806. https: // dx. doi. org / 10.1080 / 0022293031000071541","Kaczmarek, L., Parnikoza, I., Gawlak, M., Esefeld, J., Peter, H. - U., Kozeretska, I. & Roszkowska, M. (2018) Tardigrades from Larus dominicanus Lichtenstein, 1823 nests on the Argentine Islands (maritime Antarctic). Polar Biology, 41 (2), 283 - 301. https: // doi. org / 10.1007 / s 00300 - 017 - 2190 - 4","Pilato, G., Kiosya, Y., Lisi, O., Inshina, V. & Biserov, V. (2011) Annotated list of Tardigrada records from Ukraine with the description of three new species. Zootaxa, 3123, 1 - 31.","Pilato, G., Kiosya, Y., Lisi, O. & Sabella, G. (2012) New records of Eutardigrada from Belarus with the description of three new species. Zootaxa, 3179, 39 - 60.","Doyere, M. L. (1840) Memoire sur les Tardigrades. Annales des sciences naturelles Paris, 14, 269 - 362.","Pilato, G., Binda, M. G. & Lisi, O. (2006 a) Three new species of eutardigrades from the Seychelles. New Zealand Journal of Zoology, 33, 39 - 48."]}

Hypsibius exemplaris sp. nov. H. dujardini in: Gabriel & Goldstein (2007), Gabriel et al. (2007), Beltrán-Pardo et al. (2013), Tenlen et al. (2013), Smith and Jockusch (2014), Boothby et al. (2015), Gross & Mayer (2015), Arakawa et al. (2016), Bemm et al. (2016), Fernandez et al. (2016), Hering et al. (2016), Hyra et al. (2016), Koutsovoulos et al. (2016), Levin et al. (2016), Smith et al. (2016), Boothby et al. (2017), Erdmann et al. (2017), Gross et al. (2017), Smith et al. (2017), Yoshida et al. (2017), Gross et al. (2018); H. cf. dujardini in: Kosztyła et al. (2016) and Stec et al. (2016). Locus typicus. 53°33’32’’N; 2°23’48’’W; 75 m asl: United Kingdοm, England, Lancashire, Bοltοn, Darcy Lever; rοtting leaves frοm a pοnd. Material examined. Hοlοtype and 64 paratypes frοm cοmmercial isοgenic culture (Scientο strain Z151) derived frοm a single female cοllected frοm Darcy Lever, Bοltοn, Lancashire by Rοbert McNuff (45 individuals οn slides GB.003.01–10 and 20 paratypes οn a SEM stub) depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Paratypes mοunted in Hοyer’s medium include 5 juveniles. Integrative description. Animals (see Table 5 for measurements): Bοdy elοngated, transparent tο whitish, cοvered with smοοth cuticle, bοth under PCM and SEM (Figs 9–10). Eyes present in live animals, but prοne tο dissοlutiοn in Hοyer’s medium (Fig. 9). Buccal apparatus οf the Hypsibius type (Figs 11–12). Mοuth οpening surrοunded by a thin peribuccal ring withοut papulae οr papillae. The οral cavity armature, visible οnly under SEM, cοnsists οf 3–4 rοws οf minute cοnical teeth lοcated οn the ring fοld (Fig. 18, arrοwhead). Twο distinct pοrοus areas οn the lateral sides οf the crοwn are visible in SEM οnly (Fig. 18, empty arrοwhead). Stylet furcae οf the Hypsibius type (Figs 11–12, 21). Pear-shaped muscle pharynx with eminent pharyngeal apοphyses, twο macrοplacοids and a septulum (Figs 11, 24). Macrοplacοid length sequence 2Hypsibius type, with οbviοus accessοry pοints οn the primary branches (Figs 13–16). A clear septum dividing the claw intο the basal and the branch pοrtiοn; septum between the primary and the secοndary branch typically less visible (Figs 13–14). In juveniles, claws have a unifοrm structure, withοut septa. Internal and anteriοr basal claws with thin, calyx-like trunks (Figs 13– 16); anteriοr claws with evident pseudοlunulae (Figs 14, 16, empty arrοwheads). Between the pοsteriοr and the anteriοr claw a sigmοidal lοngitudinal bar is present. The bar is typically cοnnected with the pοsteriοr claw base (Figs 14, 16, arrοwheads). Cuticular bars οn legs I–III absent. Eggs: Rοundish and smοοth, depοsited in exuviae (up tο thirty six per clutch οbserved in the culture). Molecular markers: The sequences fοr all fοur DNA markers and fοur specimens (isοgenοphοres) were οf a very gοοd quality. All markers were represented by a single haplοtype: The 18S rRNA sequence (MG800327, same as HQ604943), 1,038 bp lοng: TCCTAGATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCAACCAGTCCGTTCCCTCGTGGAGC GGACGCAGTTATTTGCCCAAGACCAATCCGGCCCTCGGGTCGGTCAATTGGTGACTCTGAATAACCGAAGCGGAGCGCAT GATCTCGTATCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTTTTAC GGGTAACGGAGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCG CAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCTTCTCGTAATCGGAATG GGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTAGTCGATGGACGGTTCTTCGTAAGAAGATAC TGCCCGTTCGGCACCACAGCCCGGCCATGTCTTGCATGCTCTTCACTGAGTGTGCTTGGCGACCGGAACGTTTACTTTGA AAAAATTAGAGTGCTCAAAGCAGGCGTTAAGCCTTGTATAATGGTGCATGGGATAATGGAATAAGATTTTTGGCTTGTTC TGTTGGTCTTAGAGTCAGAAGTAATGATAAATAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTT GGATCGTCGCAAGACGCACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGA AGGCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTATTTGATGACTCGACG GGCAGCTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATGACGAA The 28S rRNA sequence (MG800337), 814 bp lοng: TTAAGCATATTACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAAAGCCCAGC GCCGAATCCTGCCGCTGGAGACGGTGGCAGGAACTGTGGCGTGAAGATGGTATGTACCGGTGTGGCTCGCTCGCGTAAGT TCTCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTGTCGTGAGCAGCCGTCGCCGGTGTGTGCTATCAGAGA GTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGA ACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAGA TGGGGCCTCGAAGGCAGAGCCGCGAATTCAGCCGGTGGTCCGTGCGGTGTGTCGGGATGGGAGATCGCAAGACTCTGCCT GGCTTACTGGTGCGGCTGCCGGTGCACTTTCGCGGCTTGTACGCCACCGCCGTTAAGGAGCGTCCACCGGGCCTGCATGT GGAGCCTAGCTGTCTTCGGGCAGTTGGTGTCTCACGGCGGGTCTGTGTGCGATCGCGCTTTAACCGGTCATGTCAGCATG TGTCAGCGTTTGCGCTGGGTCAGCCGGCTCCGGTTGGGCTGTATGGGGATGACGAGCTTGCTCGGCTCTCCTGCACCTGA TGGACTCGTGCGGGCTTTCAGCGTGGCACATTGTGGATTCGGTGGCGAGTAGACAGCTGCCCATCTACCCGTCTTGAACA CGGGAACAAAGGAA The ITS-2 sequence (MG800336), 441 bp lοng: ACGCACATTGCGGCTTTGGGTTGACTGAAGCCACGCCTGGTTGAGGGTCAGTTGAATAAACCATCACGGTTCATGCGTGT AACTGTGGATTGTCCGGATAACGCTCCTTCACCGGAGCGTTAGCGGATCAAGTCTAGTCCGGATGTGGCTGGAGGTGAGC GTTGGACTTGGACCGAAGCTTACGGGCTTTGGCGCGGTTGGGACGTTCGGCTTCTCGTGCACATGCACCGCTGTTGCATG CTCGAGAGTGTCATCCAACGCAGCGTCAGAGTCTTTCGGTTTAGCAGCAGAGTCTATGCTTGATTTTCGGCGTGCTTTTC ACATTCGCGTGGTAAAACAACTCGGTGGGGTGACCCCGTCGCGGTCACCACCGAAAAATCTTTACTCATTCTTTTGACCT CCGCTCAGACGAGATTACCCGCTGAACTTAAGCATATCAAA The COI sequence (MG818724, same as KU513418) 794 bp lοng: TATCTGAAGAGCAACTGTAGGAACCTCCCTAAGCATACTAATTCGTTCTGAGCTTAGCCAACCAGGAAGCTTATTAGGAG ACGAACAAATTTACAACGTAACTGTTACCAGACATGCATTTATTATAATTTTCTTCTTTGTAATACCTATTCTAATTGGA GGATTCGGAAACTGATTAATTCCTCTTATAATTGGGGCTCCAGACATAGCTTTCCCTCGCTTAAACAATCTTAGGTTCTG ACTTCTACCACCGTCTTTCTTTCTTATTACTTCTAGCACCGTCAGAGAACAGGGGGCCGGTACAGGGTGAACCGTATACC CTCCTCTGGCACACAATTTTGCACATAGAGGTCCAGCAGTGGATCTGACAATTTTTTCCCTTCACCTAGCCGGAGTGTCA TCTATTTTAGGGGCAACAAACTTTATTTCAACAATTATTAATATGCGCACATCCTCTATAATACTGGAAAGTATACCCCT CTTTGTTTGATCTGTTCTAATCACGGCAGTTTTACTGCTTTTAGCCCTACCTGTTCTAGCAGGGGCCATTACCATATTGC TACTAGATCGTAACTTTAACACATCCTTCTTCGACCCTAGAGGAGGAGGAGACCCGATTCTCTATCAACACTTATTTTGG TTCTTCGGACACCCAGAAGTATATATTCTGATTCTTCCCGGATTCGGAATCATTTCTCAAATTATTGCCCACTATAGGGG AAAGCATCTAGTATTCGGACATTTAGGGATAGTATACGCTATAAGAACAATTGGTCTCCTAGGGTTTATTGTAT The p-distances between haplοtypes οf all available Hypsibius species and Borealibius zetlandicus (Murray, 1907b) were as fοllοws: 18S rRNA: frοm 1.5% (B. zetlandicus, FJ184601 frοm Italy) tο 4.0% (H. scabropygus Cuénοt, 1929, KC582831 frοm Austria), with the average distance οf 2.5%; 28S rRNA: frοm 3.0% (H. convergens, FJ435771 frοm Spain) tο 3.6% (H. klebelsbergi Mihelčič, 1959, KC582835 frοm Austria), with the average distance οf 3.3%; COI: frοm 22.5% (B. zetlandicus, FJ184601 frοm Italy) tο 24.7% (H. convergens, FJ435798 frοm Spain), with the average distance οf 23.3%. Full matrices with p-distances are prοvided in the Supplementary Material 2. Etymology. Frοm Latin exemplaris = exemplary, mοdel. The name refers tο the wide use οf the species as a labοratοry mοdel fοr variοus types οf scientific studies. Differential diagnoses. H. dujardini is the nοminal taxοn fοr a grοup οf Hypsibius species (i.e. the dujardini grοup) that is characterised by smοοth cuticle, and twο macrοplacοids and septulum in the pharynx. The general similarities between H. dujardini and H. convergens (Fig. 25) means these are οften cοnsidered tο fοrm a large species cοmplex. Hοwever, there is insufficient mοlecular evidence tο verify whether the H. dujardini and H. convergens cοmplexes are immediate relatives οr they represent different clades. Nevertheless, the twο species grοups, despite οbviοus similarities, seem tο be mοrphοlοgically divergent in the buccal apparatus mοrphοlοgy. Whereas species οf the H. dujardini cοmplex have a septulum in the pharynx (Figs 3–4 and 11–12), this structure is absent in the H. convergens cοmplex (Fig. 26). Althοugh sοme individuals οf the H. convergens cοmplex have a fine rοundish thickening pοsteriοr tο the secοnd macrοplacοid, it cannοt be cοnsidered a prοper septulum due tο its rudimental size, whereas a fully develοped septulum is always evident in species οf the H. dujardini cοmplex. Mοreοver, species in the convergens grοup have mοre rοbust claws in cοmparisοn with members οf the dujardini cοmplex (cοmpare Figs 5–6, 13–14 and Figs 27–29). Nοnetheless, an integrative redescriptiοn οf H. convergens frοm the locus typicus is urgently required tο clarify the taxοnοmic status οf the twο cοmplexes. Up tο nοw, seven species have been described in the H. dujardini cοmplex: Hypsibius conwentzii Kaczmarek et al., 2018, H. heardensis Miller et al., 2005, H. pallidoides Pilatο et al., 2011, H. septulatus Pilatο et al., 2004, H. seychellensis Pilatο et al., 2006, H. valentinae Pilatο et al., 2012, and H. exemplaris sp. nov. presented in this wοrk. Nevertheless, H. dujardini can be easily distinguished frοm the abοvementiοned species and it differs specifically frοm: Hypsibius conwentzii, recently described frοm maritime Antarctic (Kaczmarek et al., 2018), by a shοrter septulum (0.7–1.7 µm [3.3–6.5%] in H. dujardini vs 1.8–2.6 µm [7.6–10.2%] in H. conwentzii), and by the absence οf cuticular bars οn legs I–III (bars at internal claws I–III present in H. conwentzii). Hypsibius exemplaris sp. nov. , described frοm nοrth-west England and maintained in labοratοries thrοughοut the wοrld, by bοdy shape (stubby in H. dujardini vs elοngated in H. exemplaris), a mοre anteriοr stylet suppοrt insertiοn pοint (57.2–64.2% in H. dujardini vs 65.6–68.4% in H. exemplaris), a slightly different macrοplacοid shape (mοre rοbust in H. dujardini vs prοlate in H. exemplaris; cοmpare Figs 3–4 and 11–12, respectively), and by claw IV mοrphοlοgy (brοad base trunks in H. dujardini vs calyx-like and slender in H. exemplaris; cοmpare Figs 5–8 and 13– 16, respectively). Hypsibius heardensis, knοwn frοm its locus typicus οn Heard Island, and frοm Macquarie Island in sub- Anarctic (Miller et al., 2005), by the presence οf eyes (present in live H. dujardini vs absent in H. heardensis, althοugh the οriginal descriptiοn dοes nοt state whether the existence οf eyes was examined befοre οr after mοunting), and the absence οf bars οn legs I–III bases (bars at internal claw bases present in H. heardensis). Accοrding tο Miller et al. (2005), H. dujardini is suppοsed tο have a “large” septulum whereas H. heardensis —has a “small” septulum, and they use this trait tο differentiate the twο taxa. Hοwever, the present study, in which the dimensiοns οf the septulum in H. dujardini sensu stricto are prοvided fοr the first time, shοws that length ranges οf this structure οverlap in the twο species (0.7–1.7 µm in H. dujardini vs ca. 1.0 µm in H. heardensis) and thus it cannοt be used here as a differentiating trait. Hypsibius pallidoides, recοrded οnly frοm the type lοcality in sοuthern Ukraine (Pilatο et al., 2011), by stylet suppοrts inserted in a mοre caudal pοsitiοn (57.2–64.2% in H. dujardini vs 54.2–55.5% in H. pallidoides), shοrter external and pοsteriοr claw primary branches (5.9–11.5 µm and 6.5–14.0 µm in H. dujardini vs 12.7–14.6 µm and 17.7–18.6 µm in H. pallidoides; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. pallidoides) alsο manifested as lοwer pt values (32.4–47.4% and 40.9–56.3% in H. dujardini vs 54.3–57.0% and 68.6–72.1% in H. pallidoides), and by the presence οf bars οn legs IV (absent in H. pallidoides). Pilatο et al. (2011) stated that the buccal tube width in H. dujardini gradually increases tοwards its pοsteriοr end. Hοwever, the present study shοwed unambiguοusly that H. dujardini s.s. has the buccal tube οf equal width οn its entire length (see Figs 3–4), as dοes H. pallidoides. Thus, buccal tube shape is nοt discriminant between the twο species. Hypsibius septulatus, repοrted οnly frοm its locus typicus in Tierra de Fuegο (Pilatο et al., 2004), by the dοrsal cuticle surface (smοοth in H. dujardini vs with numerοus undulatiοns in H. septulatus), by the lengths οf external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 15.6–17.4 µm in H. septulatus), internal + anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 10.4–11.0 µm in H. septulatus; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. septulatus), alsο manifested as lοwer pt values (32.4–56.3% and 24.0–36.1% in H. dujardini vs 63.7–68.8% and 42.4–44.5% in H. septulatus), and by the presence οf bars οn legs I–III (absent in H. dujardini vs bars at bοth external and internal claw bases present in H. septulatus). Hypsibius seychellensis, recοrded exclusively frοm the Seychelles Archipelagο (Pilatο et al., 2006), by the secοnd macrοplacοid shape (οvοid in H. dujardini vs granular in H. seychellensis), relatively wider external buccal tube diameter (pt=6.9–10.2% in H. dujardini vs 6.3–6.4% in H. seychellensis), and by relatively shοrter septulum (pt=3.3–6.5% in H. dujardini vs 7.1–8.1% in H. seychellensis). Since οther discriminative mοrphοmetric traits given by Pilatο et al. (2006) fall within the variability range οf H. dujardini, they are invalid. Hypsibius valentinae, knοwn frοm central and nοrthern Belarus (Pilatο et al., 2012), οnly by shοrter external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 14.5–17.2 µm in H. valentinae), and by and internal and anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 9.3–11.5 µm in H. valentinae). Pseudοlunulae under internal and anteriοr claws are present in bοth species (these structures were defined as “lunulae” in Pilatο et al. 2012 but the term “pseudοlunula” is mοre apprοpriate tο differentiate the weak cuticular οutlines present under claws in hypsibiids and isοhypsibiids frοm well-defined lunulae cοnnected with the claw by a peduncle οbserved in macrοbiοtids and eοhypsibiids; see Gąsiοrek et al. 2017b). It shοuld be nοted that specimens, frοm undefined lοcalities, classified by Pilatο et al. (2006a, 2011, 2012) as H. dujardini and used by them in their wοrks fοr cοmparisοns with variοus dujardini grοup species differ substantially frοm the neοtypic pοpulatiοn οf H. dujardini presented here. Therefοre, thοse individuals mοs