Search

Aims Tobacco (Nicotiana tabacum) is an economically important crop. Root rot caused by Fusarium oxysporum has become a damaging disease in N. tabacum crops grown in Henan province of China. Therefore, the objectives of this study were to screen bacterial isolates against F. oxysporum from rhizosphere soils of tobacco growing areas and to evaluate their antifungal activities, biocontrol effects, and effects on plant growth. Methods and results Nineteen strains with antifungal inhibition effects of >60% against F. oxysporum were obtained using the method of flat confrontation; the strain Ba-0321 was the strongest, with an antifungal effect of 75%. Moreover, this strain had broad spectrum antimicrobial activity to eight additional tobacco pathogens. The strain was identified as Bacillus velezensis by morphology and the 16S rDNA sequence. The B. velezensis strain Ba-0321 had strong UV resistance as well as tolerance to high temperatures and low nutrition. The bacteria inhibited spore germination and mycelial growth of F. oxysporum under in vitro co-culture conditions. In vivo assays demonstrated that the Ba-0321 strain significantly reduced the pathogenicity of F. oxysporum , resulting in a control effect on tobacco root rot of 81.00%. Simultaneously, the bacteria significantly promoted root development and the growth of tobacco plants. Conclusion Our results confirmed that the B. velezensis strain Ba-0321 has a strong antifungal effect and stress resistance that enable it to be used as a biological control agent for tobacco root rot caused by F. oxysporum. Significance and impact of the study Tobacco root rot caused by F. oxysporum has become a damaging disease in China. The B. velezensis strain Ba-0321 has promising application value for controlling tobacco root rot diseases, and it could provide a new biocontrol agent against root rot caused by F. oxysporum in other plant species. [ABSTRACT FROM AUTHOR]

To solve the wax deposition problem of high-pour-point and high-waxy oil wells, a new acoustic cavitation and magnetic coupling shaft wax control technology was proposed. Experimental research and field tests were conducted. This wax control technology can achieve the purpose of freezing point depression, viscosity reduction by emulsification, and wax control through the combined effect of cavitation, acoustic vibration, and magnetic intensification. Laboratory experiments showed that after acoustic cavitation and magnetic coupling treatment, the viscosity reduction ratio of high-pour-point oil was over 25.5% at 30°C; the freezing point was decreased from 32°C to 27°C, a 15.6% reduction; the wax crystal structure of the oil samples was changed from crude, thick, and dense to fine, thin, and sparse. Field tests showed that the acoustic cavitation and magnetic coupling wax control device can significantly extend the well's wax deposit cycle by more than 30 days and reduce the wax thickness (Yumen Oilfield). Using this technology, the flushing period was extended more than two times, with a maximum up to nine times, and the normal production time was also prolonged (Zhundong Oilfield in Xinjiang). The results are useful for the popularization and application of the new shaft wax control technology for high-freezing-point and high-waxy oil wells. [ABSTRACT FROM AUTHOR]

Clin Microbiol Infect 2010; 16: 1639-1643 The emergence of multidrug-resistance Mycobacterium tuberculosis is an increasing threat to tuberculosis control programmes. Susceptibility testing of Mycobacterium tuberculosis complex isolates by traditional methods requires a minimum of 14 days. This can be reduced significantly if molecular analysis is used. DNA sequencing is a good method for detecting mutation, but cannot be used routinely because of its relatively high cost. A sensitive and specific microarray has been designed to detect mutations in the rifampin resistance determining region of rpoB and loci in katG and inhA associated with isoniazid (INH) resistance. A panel of Mycobacterium tuberculosis isolates containing 13 different rpoB genotypes, two mutation genotypes within codon 315 of katG and one mutation genotypes at inhA was used to validate the microarray. The results obtained indicate that 100% of rifampicin-resistant M. tuberculosis strains isolated in Chongqing had rpoB mutations, with 531-Ser and 526-His being the most common positions substituted. Of the total 50 INH resistant isolates, 82% had a katG315 mutation and 18% had an inhA mutation. All the mutations detected by the microarray method were also confirmed by conventional DNA sequencing. It is demonstrated that the microarray is an efficient, specialized technique and can be used as a rapid method for detecting rifampin and isoniazid resistance. [ABSTRACT FROM AUTHOR]

Quantifying critical conditions of rill formation can be useful for a better understanding of soil erosion processes. Current studies lack a consensus and related rationale on how to describe these conditions. This study was based on the concepts that (1) the shear stress available for erosion at any given point is a function of the runoff rate, the slope steepness, and hydraulic characteristics of the surface; (2) rill incision begins when overland flow shear stress exceeds soil critical shear stress; and (3) the distance from the top of the slope to the point where rills form can be measured and analyzed as length to rill initiation and decreases with increase in slope and rainfall intensity. These concepts were tested with a representative silty-clay soil from the Loess Plateau in northwestern China on a large sloping indoor plot (8 x 3 m), with five different slopes using simulated rainfall at three rainfall intensities. Values of several hydraulic parameters at rill initiation were determined from the experimental data. The results showed relationships among slope steepness, rainfall intensity, and location of rill initiation. It was found that slope was relatively more important than rainfall intensity in determining the location of rill initiation. Soil critical shear stress determined in this study ranged from 1.33 to 2.63 Pa, with an average of 1.94 Pa. Soil critical shear stress was inversely related to slope and was not influenced by rainfall intensity. The results of this study were comparable with those of previous investigators. [ABSTRACT FROM AUTHOR]

The aim of the study was to assess the adjunctive effects of orlistat on weight loss and the influence of weight reduction on glycaemic control in overweight Chinese female type 2 diabetic patients. A randomised, placebo-controlled, double-blind, 12-week study was conducted. Chinese female type 2 diabetic patients, overweight (body mass index > 25 kg/m2), poorly controlled glucose levels [glycosylated haemoglobin (HbA1c) > 8%], were randomly assigned to two groups. In addition to their oral hypoglycaemic agents (maximal doses of sulphonylureas and metformin), one group ( n = 30) received a placebo and the other ( n = 30) received orlistat 120 mg t.i.d. for 12 weeks. Comparing the changes that occurred after 12 weeks in the orlistat and placebo groups, the former showed significantly greater reduction in bodyweight (2.5 vs. 0.4 kg; p < 0.05), fasting plasma insulin level (p < 0.01), 2-h postprandial blood glucose after glucose challenge (p < 0.01), insulin resistance (p < 0.01), HbA1c (p < 0.05), total cholesterol and triglyceride levels (p < 0.05, respectively). No significant differences were found between treatment groups in blood pressure and heart rate. The addition of orlistat to oral hypoglycaemic agents resulted in a significant weight reduction and improvement of metabolic control in overweight Chinese female type 2 diabetic patients. [ABSTRACT FROM AUTHOR]

As a typical ecologically fragile area, the Wudong Coal Mine region in Xinjiang generates large accumulations of coal gangue each year, which, in the alkaline soil environment, can easily lead to significant leaching and accumulation of As. This study developed a stabilizer (CFD) using cement, fly ash, and desulfurized gypsum to modify in-situ soil in the Xinjiang mining area, resulting in a modified solidified soil with excellent geotechnical performance and As stabilization capability. The study results showed that when CFD content exceeded 14.5% (H8), the unconfined compressive strength was above 350 kPa. The adsorption capacity of the solidified soil for As could exceed 90%. Leaching experiments revealed that the As leaching amount from solidified soil-coal gangue was below 0.01 mg/L, meeting China's Class III groundwater standard, thereby effectively reducing ecological and environmental risks. The modified solidified soil prepared in this study expanded the application scenarios for cement, providing a technical basis for the large-scale in-situ disposal of coal gangue in Xinjiang mining areas. It reduced the disposal costs of coal gangue and offered insights into its resource utilization and harmless use., Competing Interests: Declarations. Conflict of interest: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2025. The Author(s), under exclusive licence to Springer Nature B.V.)

Objective: To evaluate whether the immunomodulatory drug thymosin α1 reduces mortality in adults with sepsis., Design: Multicentre, double blinded, placebo controlled phase 3 trial., Setting: 22 centres in China, September 2016 to December 2020., Participants: 1106 adults aged 18-85 years with a diagnosis of sepsis according to sepsis-3 criteria and randomly assigned in a 1:1 ratio to receive thymosin α1 (n=552) or placebo (n=554). A stratified block method was used for randomisation, and participants were stratified by age (<60 and ≥60 years) and centre., Interventions: Subcutaneous injection of thymosin α1 or placebo every 12 hours for seven days unless discontinued owing to discharge from the intensive care unit, death, or withdrawal of consent., Main Outcome Measure: The primary outcome was 28 day all cause mortality after randomisation. All analyses were based on a modified intention-to-treat set, including participants who received at least one dose of study drug., Results: Of 1106 adults with sepsis enrolled in the study, 1089 were included in the modified intention-to-treat analyses (thymosin α1 group n=542, placebo group n=547). 28 day all cause mortality occurred in 127 participants (23.4%) in the thymosin α1 group and 132 (24.1%) in the placebo group (hazard ratio 0.99, 95% confidence interval 0.77 to 1.27; P=0.93 with log-rank test). No secondary or safety outcome differed statistically significantly between the two groups. The prespecified subgroup analysis showed a potential differential effect of thymosin α1 on the primary outcome based on age (<60 years: hazard ratio 1.67, 1.04 to 2.67; ≥60 years: 0.81, 0.61 to 1.09; P for interaction=0.01) and diabetes (diabetes: 0.58, 0.35 to 0.99; no diabetes: 1.16, 0.87 to 1.53; P for interaction=0.04)., Conclusions: This trial found no clear evidence to suggest that thymosin α1 decreases 28 day all cause mortality in adults with sepsis., Trial Registration: ClinicalTrials.gov NCT02867267., Competing Interests: Competing interests: All authors have completed the ICMJE uniform disclosure form at https://www.icmje.org/disclosureof-interest/ and declare: support from the Sun Yat-sen University Clinical Research Program 5010, the Guangdong Clinical Research Center for Critical Care Medicine, and SciClone Pharmaceuticals for the submitted work; XG, JW, WL, ZH, Y Li, DZ, MZ, JY, WC, MD, ZW, and QL received grants from SciClone Pharmaceuticals; WL, JZ, and LK received consultancy fees from SciClone Pharmaceuticals, Jiangsu Nhwa Pharmaceutical, and Nutrici; no financial relationships with any organisations that might have an interest in the submitted work in the previous three years; no other relationships or activities that could appear to have influenced the submitted work., (© Author(s) (or their employer(s)) 2019. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

Paddy soil is recognized as a hotspot for mercury (Hg) transformation. Soil acid-base property (expressed as pH) plays a crucial role in Hg methylation and accumulation in paddy systems. However, it is challenging to study this process in soils with varying pH values due to the rarity of a single soil type spanning a wide pH range. Purple paddy soil, vital for rice cultivation in southwestern China, occurs naturally in three types based on pH: acidic, neutral, and calcareous. This variation makes purple paddy soil an ideal subject for these studies. Thus, this study investigated Hg transformation and bioaccumulation across these three purple soil types. The results showed that during the rice growing seasons, both methylmercury (MeHg) concentration and methylation potential were higher in acidic purple paddy soil than in neutral and calcareous types. In addition, total mercury (THg) and MeHg concentrations in plant tissues grown in acidic purple paddy soil were significantly higher than in other two purple soil types. These results suggest that acidic purple paddy soil was conducive to Hg methylation and accumulation in rice plants. Given that soil acidification is becoming a serious global issue, the findings could offer fundamental data on the potential risk of Hg exposure due to soil acidification., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Purpose: The current study aimed to examine the short-term outcomes and multidimensional factors associated with preoperative sedentary behavior among Chinese older adults with gastric cancer., Method: An observational study was conducted among older adults with gastric cancer in a tertiary hospital in Jiangsu, China. A total of 393 participants were enrolled by convenience sampling. Sedentary behavior was assessed using the International Physical Activity Questionnaire-Short Form (IPAQ-SF). Logistic regression was applied to explore the relationship between preoperative sedentary behavior and short-term outcomes. Univariate and multivariate analyses were used to determine the factors associated with participants' sedentary behavior., Results: Preoperative sedentary behavior was related to multiple outcomes, including total complications, prolonged length of stay, and increased hospitalization costs. Two or more comorbidities and depression were risk factors for sedentary behavior. High-density lipoprotein; female sex; and high school, middle school, and primary school and below educational levels were protective factors for sedentary behavior., Conclusion: Health care professionals need to simultaneously concentrate on multidimensional aspects linked to sedentary behavior to successfully administer behavioral interventions for enhancing older adults' overall prognosis. [ Journal of Gerontological Nursing, 51 (1), 32-41.]., Competing Interests: Disclosure: The authors have disclosed no potential conflicts of interest, financial or otherwise.

Background: Insulin resistance (IR) is an independent predictor of atrial fibrillation (AF), but the specific utility of the triglyceride-glucose (TyG) index as a predictive marker for the incidence of AF in the acute coronary syndrome (ACS) population has not yet been explored., Objective: To explore the correlation between TyG index and the risk of AF in ACS patients and to establish a predictive model., Methods: A retrospective study was conducted on 613 ACS patients admitted to the Department of Cardiovascular Medicine at the First Teaching Hospital of Tianjin University of Traditional Chinese Medicine from January 2022 to September 2024. Patients were divided into four groups based on quartiles of TyG index. Patients were further divided into two groups based on the occurrence of AF: the AF group and the non-AF group. Patient information was collected through the hospital's HIS system. Variable selection was completed using LASSO regression algorithms. Multivariate logistic bidirectional stepwise regression analysis was used to explore the correlation between the TyG index and the risk of AF in ACS patients and to construct a regression model. Three different models were constructed by adjusting for confounding factors and restricted cubic spline plots were drawn to validate the significance of the TyG index combined with AF further. The predictive value of the LASSO-multivariate logistic bidirectional stepwise regression model and the TyG index alone for predicting AF in ACS patients was analyzed using the receiver operating characteristic curve., Results: The LASSO-multivariate logistic bidirectional stepwise regression algorithm showed that coronary heart disease (CHD), valvular heart disease (VHD), TyG, age (AGE), and diastolic blood pressure (DBP) were risk factors for AF in ACS. The restricted cubic spline model demonstrated a significant linear relationship between a higher TyG index and an increased risk of AF in the ACS patient population. The area under the curve (AUC) for predicting AF in ACS patients using the TyG index and the LASSO-multivariate logistic bidirectional stepwise regression model was 0.65(95%CI = 0.58 ~ 0.73) and 0.71(95%CI = 0.65 ~ 0.77) respectively. Additionally, the correlation between the TyG index and AF was consistent across different subgroups., Conclusion: In ACS patients, the TyG index is a stable and independent predictor of AF, with specific clinical value in identifying the occurrence of AF in this population., Competing Interests: Declarations. Ethics approval and consent to participate: The study involving human participants was reviewed and approved by the Ethical Review Committee of the First Teaching Hospital of Tianjin University of Traditional Chinese Medicine. We have notified all patients regarding the pertinent details of this study and have obtained informed consent from all participants. Furthermore, all participants have agreed to participate through verbal consent, adhering to the approved ethical guidelines and procedures. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests., (© 2024. The Author(s).)

Background: Zishen Yutai Pill exhibited clinical benefit to infertile women undergoing fresh embryo transfer cycles, improving their pregnancy outcomes. However, as the endometrial environment in frozen embryo transfer (FET) is different from fresh cycles, the effects of ZYP on fresh embryo transfer could not be generalized to FET., Objective: We aimed to explore the effects of ZYP on live birth rate in women's FET cycles., Methods: This multicentre, double-blind, placebo-controlled, randomized study was conducted at 11 reproductive medical centres in China. Women were recruited and randomly assigned to ZYP or placebo intervention (5 g once, 3 times per day) around the time of FET. The live birth rate was set as the primary outcome. Secondary outcomes included implantation rate, biochemical pregnancy rate, clinical pregnancy rate, pregnancy loss rates. Data was analyzed based on the intention-to-treat principle, with per protocol analysis as sensitivity analysis., Results: Between December 2017 and April 2019, 934 women were screened, of whom 880 met all eligibility criteria and were allocated to ZYP (n=441) or placebo (n=439). In ITT analysis, the live birth rates were 38.32% (169/441) in ZYP group and 32.57% (143/439) (absolute difference 5.75%, 95%CI [-0.57%, 12.00%], OR 1.29, 95%CI [0.98, 1.70], P=0.08). The intervention of ZYP did not result in significantly differences in all secondary outcomes compared with placebo (all P>0.05). Similar trends were observed in PP analysis. In post hoc analysis, ZYP resulted in higher rates of live birth than placebo among women in specific subgroups, i.e., with miscarriage history (39.23% vs. 26.45%, P=0.01) or advanced maternal age (33.93% vs. 21.85%, P=0.04)., Conclusion: In infertile women undergoing FET cycle, intervention with ZYP led to a trend of live birth rate increment compared with placebo, but without statistical significance. However, women with miscarriage history and advanced age could experience possible benefits from ZYP intervention., Registration: ChiCTR-INR-17010809 (http://www.chictr.org.cn)., Competing Interests: Declaration of competing interest This study was supported by the Guangdong Provincial Bureau of Traditional Chinese Medicine (Grant No. 20174002), Guangzhou International Science and Technology Cooperation Project (Grant No. 201807010044). Guangzhou Baiyunshan Zhongyi Pharmaceutical Co. Ltd. donated the study drugs, including Zishen Yutai Pill and the placebo for this research, but had no role in the data acquisition, statistical analysis and writing of this article. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier GmbH.)

In the general population, there is limited evidence for the associations between hand eczema (HE) and lifestyle factors, and between the severity of HE and quality of life. This study aimed to estimate the risk factors for the incidence of HE in the general population and the risk factors for the severity of HE. A cross-sectional questionnaire was administered to 121 HE patients in a hospital from December 2018 to December 2019 in Wuhan. The severity of HE was significantly associated with working with wet hands more than 5 h per day and chapped skin. Sixty-seven patients have positive patch test results. Working with wet hands for more than 5 h per day and chapped skin were the most common and significant risk factors for HE. Working hours with wet hands per day was an independent risk factor for the hand eczema severity index and dermatology life quality index, and there was a significant positive correlation between chapped skin and the severity of hand eczema and higher transepidermal water loss (TEWL). The results also revealed a significant positive correlation between the severity of HE and the impact on quality of life and the severity of TEWL. Prolonged wet hand work can lead to a higher rate of severe hand eczema in the general population. HE can be relieved by reducing the wet hand working time and hand moisturizing., Competing Interests: Declarations. Competing interests: The authors declare no competing interests., (© 2024. The Author(s).)

Available evidence suggests that air pollutants can cause stroke, but little research has investigated the confounding effects of urban-rural differences. Here, we investigated the urban-rural difference in the correlation between particulate matter (PM 2.5 and PM 10 ) exposure and stroke. This cohort study was based on a prospective multi-city community-based cohort (Guizhou Population Health Cohort Study (GPHCS)) in Guizhou Province, China. A total of 7988 eligible individuals (≥18 years) were enrolled with baseline assessments from November 2010 to December 2012, and follow-up was completed by June 2020. Two major particulate matters (PMs, including PM 2.5 and PM 10 ) were assessed monthly from 2000 by using satellite-based spatiotemporal models. The risk of stroke was estimated using a Cox proportional hazard regression model. The association between particulate matters' exposure and stroke in different areas (total, urban, and rural) and the potential modification effect of comorbidities (hypertension, diabetes, and dyslipidemia) and age (≤65/>65 years) were examined using stratified analyses. The risk of stroke increased for every 10 μg/m 3 increase in mean PMs' concentrations during the previous 1 year at the residential address (HR: 1.26, 95%CI: 1.24, 1.29 (PM 2.5 ); HR: 1.13, 95%CI: 1.11, 1.15 (PM 10 )). The presence of diabetes and dyslipidemia increased the risk of PM 10 -induced stroke in whole, urban, and rural areas. Specifically, people living in rural areas were more likely to experience the effects of PMs in causing a stroke. The risk of stroke due to PMs was statistically increased in the young and older populations living in rural areas. In conclusion, long-term exposure to PMs increased the risk of stroke and such association was more pronounced in people living in rural areas with lower income levels. Diabetes and dyslipidemia seemed to strengthen the association between PMs and stroke., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

This study aimed to elucidate the effects of coastal environmental stress on the composition of sediment bacterial communities and their cooccurrence patterns in fishing harbors around the Bohai Economic Circle, China. Compared with the natural sea area, fishing harbors contained higher levels of organic pollution (organic pollution index = 0.12 ± 0.026) and considerably reduced bacterial richness and evenness. The distributions of sediment microbial communities clustered along the pollutant concentration gradients across fishing harbors. Betaproteobacteria dominated (76%) organically polluted fishing harbors, which were mostly disturbed by anthropogenic activities. However, the harbors also revealed the absence of numerous pathogenic (Coxiella and Legionella) and photosynthetic (Synechococcus and Leptolyngbya) bacteria. Abundant genera, including Thiobacillus and Arenimonas, exhibited a positive correlation with total phosphorus and a negative correlation with total nitrogen in sediments. Meanwhile, Sulfurovum, Psychrobacter, and Woeseia showed the opposite trend. Pollutant accumulation and anthropogenic activities caused the decrease in the sediment microbial diversity and dispersal ability and promoted convergent evolution. Severely polluted harbors with simplified cooccurrence networks revealed the presence of destabilized microbial communities. In addition, the modularity of bacterial networks decreased with organic pollution. Our results provide important insights into the adjustment mechanism of microbial communities to community organization and functions under environmental pollution stress. Overall, this study enhanced our understanding of how microbial communities in coastal sediments adapted and survived amidst anthropogenic activities like oily effluent discharges from large ships, wash water, domestic sewage, garbage, and fisheries wastes. It also examined their resilience to future contamination., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Inc. All rights reserved.)

Background: Quality assessment of the prevalence and distribution of human papillomavirus (HPV) genotypes could support additional targeted HPV vaccinations. However, the characteristics of HPV infection in Wuhan city are limited in the past decade. We aimed to assess the epidemiology of HPV infection among women and provide a reference for the prevention and treatment of cervical cancer in this region., Methods: A retrospective study employing 105,679 women attending Wuhan Medical and Health Center for Women and Children for cervical cancer screening from January 2015 to December 2022 was conducted. The HPV genotype was detected by polymerase chain reaction (PCR) and diversion hybridization. The overall incidence and age-specific type distribution of HPV infection and the relationship between HPV infection and cervical cytology were analyzed., Results: The overall HPV infection rate was 16.87% in Wuhan city, and the prevalence rates of high-risk, low-risk and mixed high- and low-risk HPV infections were 13.64%, 1.77% and 1.46%, respectively. The five most prevalent genotypes were HPV52 (4.24%), HPV58 (2.42%), HPV16 (2.34%), HPV53 (1.87%), and HPV39 (1.66%). The prevalence of HPV in women exhibited a "two-peak" pattern, the peaks of which were observed in the < 21 years group (37.4%) and the 61-65 years group (41.72%). Logistic regression analysis revealed no significant difference in the rate of high-grade lesion positivity between single and multiple high-risk HPV infections. Among patients with a high-grade squamous intraepithelial lesion+ (HSIL+) ThinPrep cytologic test (TCT) diagnosis, HPV58 was the most common type, followed by HPV52, HPV16, HPV39 and HPV53., Conclusions: HPV types 52, 58, 16, 53, and 39 were the most common types in the general female population in Wuhan, and the prevalence of HPV infection varied among different age groups. This study provides a comprehensive overview of the epidemiological characteristics of HPV infection in women, which could support the development of targeted prevention and control strategies for cervical cancer in the region., (© 2024. The Author(s).)

Background: Hot flashes are a common side effect of endocrine therapy (ET) that contribute to poor quality of life and decreased treatment adherence., Methods: Patients with breast cancer wo were receiving ET and experiencing hot flashes were enrolled through three parallel, randomized trials conducted in the United States, China, and South Korea. Participants were randomized to either immediate acupuncture (IA) or delayed acupuncture control (DAC). IA participants received 20 acupuncture sessions over 10 weeks, whereas DAC participants received usual care, then crossed over to acupuncture with a reduced intensity. The primary end point was a change in score on the endocrine symptom subscale of the Functional Assessment of Cancer Therapy (FACT)-Endocrine Symptoms between baseline and week 10. Secondary end points included the hot flash score and the FACT-Breast score. A planned pooled analysis of individual patient data was performed using longitudinal mixed models., Results: In total, 158 women with stage 0-III breast cancer were randomized (United States, n = 78; China, n = 40; South Korea, n = 40). At week 10, IA participants reported statistically significant improvements in the endocrine symptom subscale score (mean change ± standard error: 5.1 ± 0.9 vs. 0.2 ± 1.0; p = .0003), the hot flash score (-5.3 ± 0.9 vs. -1.4 ± 0.9; p < .003), and the FACT-Breast total score (8.0 ± 1.6 vs. -0.01 ± 1.6; p = .0005) compared with DAC participants. The effect of the acupuncture intervention differed by site (p = .005)., Conclusions: Acupuncture led to statistically and clinically meaningful improvements in hot flashes, endocrine symptoms, and breast cancer-specific quality of life in women undergoing ET for breast cancer in the United States, China, and South Korea., (© 2024 American Cancer Society.)

Objectives: To identify the barriers and facilitators to the successful implementation of imaging-based diagnostic artificial intelligence (AI)-assisted decision-making software in China, using the updated Consolidated Framework for Implementation Research (CFIR) as a theoretical basis to develop strategies that promote effective implementation., Design: This qualitative study involved semistructured interviews with key stakeholders from both clinical settings and industry. Interview guide development, coding, analysis and reporting of findings were thoroughly informed by the updated CFIR., Setting: Four healthcare institutions in Beijing and Shanghai and two vendors of AI-assisted decision-making software for lung nodules detection and diabetic retinopathy screening were selected based on purposive sampling., Participants: A total of 23 healthcare practitioners, 6 hospital informatics specialists, 4 hospital administrators and 7 vendors of the selected AI-assisted decision-making software were included in the study., Results: Within the 5 CFIR domains, 10 constructs were identified as barriers, 8 as facilitators and 3 as both barriers and facilitators. Major barriers included unsatisfactory clinical performance (Innovation); lack of collaborative network between primary and tertiary hospitals, lack of information security measures and certification (outer setting); suboptimal data quality, misalignment between software functions and goals of healthcare institutions (inner setting); unmet clinical needs (individuals). Key facilitators were strong empirical evidence of effectiveness, improved clinical efficiency (innovation); national guidelines related to AI, deployment of AI software in peer hospitals (outer setting); integration of AI software into existing hospital systems (inner setting) and involvement of clinicians (implementation process)., Conclusions: The study findings contributed to the ongoing exploration of AI integration in healthcare from the perspective of China, emphasising the need for a comprehensive approach considering both innovation-specific factors and the broader organisational and contextual dynamics. As China and other developing countries continue to advance in adopting AI technologies, the derived insights could further inform healthcare practitioners, industry stakeholders and policy-makers, guiding policies and practices that promote the successful implementation of imaging-based diagnostic AI-assisted decision-making software in healthcare for optimal patient care., Competing Interests: Competing interests: JZ is an employee of MSD R&D (China). LL is affiliated with Merck Sharp & Dohme, a subsidiary of Merck & Co., Rahway, New Jersey, USA, which funded the study and monitored the conduct of the study., (© Author(s) (or their employer(s)) 2024. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

Gender differences in the onset age of schizophrenia have been reported in many studies, but differences in the age of the first hospitalization and associated factors have not been explored. The present study investigated gender differences and clinical correlates in the age of the first hospitalization in drug-naïve schizophrenia (DNS). A total of 144 DNS patients and 67 health controls were included. Demographic information, duration of untreated psychosis (DUP), Positive and Negative Symptom Scale (PANSS) scores, the Brief Psychiatric Rating Scale (BPRS) scores, Global Assessment of Functioning (GAF) scores, and MATRICS Consensus Cognitive Battery (MCCB) scores were collected and analyzed. The age of the first hospitalization was significantly earlier in males than in females (P < 0.01). In addition, there were significant differences in the age of the first hospitalization in terms of marital status, occupation, family ranking, suicide attempt, and place of residence (all P < 0.05). After Bonferroni correction, only DUP had a positive correlation with the age of the first hospitalization (P Bonferroni  < 0.05/6 = 0.0083). Multivariate linear regression analysis showed that gender (β = 0.141, t = 2.434, P = 0.016), marital status (β = 0.219, t = 3.463, P = 0.001), family ranking (β = 0.300, t = 4.918, P < 0.001), suicide attempt (β = 0.348, t = 5.549, P < 0.001), and DUP (β = 0.190, t = 2.969, P < 0.004) positively predicted the age of the first hospitalization. The age of the first hospitalization in male DNS was earlier than in females. In addition, gender, marital status, suicide attempt, DUP, and family rank were independent risk factors for the age of the first hospitalization., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany.)

This study aims to investigate sex differences and risk factors for self-reported suicide attempts among Chinese Han middle-aged patients with first-episode drug-naïve (FEDN) anxious depression (AD). A total of 1796 patients with FEDN major depressive disorder were enrolled in this study, including 341 middle-aged patients with AD. We compared the prevalence, demographics, and clinical characteristics of suicide attempts between male and female patients with FEDN middle-aged AD. We also explored the risk factors for self-reported suicide attempts in this population using binary logistic regression analysis. The male/female ratio was 91/250 and the age of onset was 51.50 ± 4.13. Our results showed that there were no significant sex differences in the prevalence of self-reported suicide attempts in middle-aged patients with FEDN AD. However, we did find significant differences in several demographic and clinical characteristics between self-reported suicide attempters and non-suicide attempters. Moreover, severe anxiety, measured by the Hamilton Anxiety Rating Scale score, was identified as a risk factor for self-reported suicide attempts in female middle-aged AD patients. Additionally, elevated thyroid peroxidase antibody (TPOAb) levels were linked to self-reported suicide attempts in male AD patients. Our findings suggest that there are no significant sex differences in the prevalence of self-reported suicide attempts in this population, but there may be sex-specific risk factors for self-reported suicide attempts in middle-aged AD. Clinical psychiatrists need to pay attention to thyroid hormone levels in middle-aged anxious depression., (© 2024. The Author(s), under exclusive licence to Springer-Verlag GmbH Austria, part of Springer Nature.)

Background: Anticipating the postoperative pathological stage and potential for adverse features of prostate cancer (PCa) patients before radical prostatectomy (RP) is crucial for guiding perioperative treatment., Methods: A cohort consisting of three sub-cohorts with a total of 709 patients has been enlisted from two major tertiary medical centres in China. The primary assessment parameters for adverse pathological features in this study are the pathological T stage, the AJCC prognostic stage groups and perineural invasion (PNI). Logistic regression analyses were performed to investigate the relationship between prostate specific antigen (PSA), its derivatives (incluing Prostate Health Index, phi and phi density, phiD), and the pathological outcomes after RP., Results: Both phi and phiD showed a significant association with pathologic T stage of pT3 or above (phi, adjusted OR, AOR = 2.82, 95% confidence interval, 95% CI: 1.88-4.23, p < 0.001; phiD, AOR = 2.47, 95% CI: 1.76-3.48, p < 0.001) and PNI (phi, AOR = 2.15, 95% CI: 1.39-3.32, p < 0.001; phiD, AOR = 1.94, 95% CI: 1.38-2.73, p < 0.001). In a subgroup analysis with a total PSA value <10 ng/mL, phi and phiD continued to show a significant correlation with pT3 or above (phi, AOR = 4.70, 95% CI: 1.29-17.12, p = 0.019; phiD, AOR = 3.44, 95% CI: 1.51-7.85, p = 0.003), and phiD also maintained its predictive capability for PNI in this subgroup (AOR = 2.10, 95% CI: 1.17-3.80, p = 0.014). Sensitivity analysis indicated that the findings in the combined cohort are mainly influenced by one of the sub-cohorts, partially attributable to disparities in sample sizes between sub-cohorts. Combined analysis of phi(D) and multiparametric MRI (mpMRI) data yielded similar results., Conclusions: Preoperative measurement of serum phi and phiD is valuable for predicting the occurrence of adverse pathological features in Chinese PCa patients after RP., (© 2024 The Author(s). Cancer Medicine published by John Wiley & Sons Ltd.)

Alkaline lakes are extreme environments inhabited by diverse microbial extremophiles. However, large-scale distribution patterns, environmental adaptations, community assembly, and evolutionary dynamics of microbial communities remain largely underexplored. This study investigated the characteristics of microbial communities on rare and abundant taxa in alkaline lake sediments in west and northwest China. We observed that abundant taxa varied significantly with geographical distance, while rare taxa remained unaffected by regional differences. The assembly process of abundant taxa was influenced by dispersal limitation, whilst rare taxa were predominantly driven by heterogeneous selection. Network analysis indicated that rare taxa as core species for community interactions and community stability. Rare taxa exhibited higher speciation and transition rate than abundant taxa, serving as a genetic reservoir and potential candidates to become abundance taxa, highlighting their crucial role in maintaining microbial diversity. These insights underscore the significant influence of rare taxa on ecosystem biodiversity and stability in alkaline lakes., (© 2024. The Author(s).)

Importance: Previous studies have shown that Jinlida (JLD) granules, an approved treatment for type 2 diabetes in China, can reduce blood glucose level, reduce glycated hemoglobin (HbA1c), and improve insulin resistance in people with type 2 diabetes., Objective: To evaluate the effect of long-term administration of JLD vs placebo on the incidence of diabetes in participants with impaired glucose tolerance (IGT) and multiple metabolic abnormalities., Design, Setting, and Participants: This multicenter, double-blind, placebo-controlled randomized clinical trial (FOCUS) was conducted across 35 centers in 21 cities in China from June 2019 to February 2023. Individuals aged 18 to 70 years with IGT and multiple metabolic abnormalities were enrolled., Intervention: Participants were randomly allocated 1:1 to receive JLD or placebo (9 g, 3 times per day, orally). They continued this regimen until they developed diabetes, withdrew from the study, were lost to follow-up, or died., Main Outcomes and Measures: The primary outcome was the occurrence of diabetes, which was determined by 2 consecutive oral glucose tolerance tests. Secondary outcomes included waist circumference; fasting and 2-hour postprandial plasma glucose levels; HbA1c; fasting insulin level; homeostatic model assessment for insulin resistance (HOMA-IR); total cholesterol, low-density lipoprotein cholesterol, and triglyceride levels; ankle-brachial index; and carotid intima-media thickness., Results: A total of 889 participants were randomized, of whom 885 were in the full analysis set (442 in the JLD group; 443 in the placebo group; mean [SD] age, 52.57 [10.33] years; 463 [52.32%] female). Following a median observation period of 2.20 years (IQR, 1.27-2.64 years), participants in the JLD group had a lower risk of developing diabetes compared with those in the placebo group (hazard ratio, 0.59; 95% CI, 0.46-0.74; P < .001). During the follow-up period, the JLD group had a between-group difference of 0.95 cm (95% CI, 0.36-1.55 cm) in waist circumference, 9.2 mg/dL (95% CI, 5.4-13.0 mg/dL) in 2-hour postprandial blood glucose level, 3.8 mg/dL (95% CI, 2.2-5.6 mg/dL) in fasting blood glucose level, 0.20% (95% CI, 0.13%-0.27%) in HbA1c, 6.6 mg/dL (95% CI, 1.9-11.2) in total cholesterol level, 4.3 mg/dL (95% CI, 0.8-7.7 mg/dL) in low-density lipoprotein cholesterol level, 25.7 mg/dL (95% CI, 15.9-35.4 mg/dL) in triglyceride levels, and 0.47 (95% CI, 0.12-0.83) in HOMA-IR compared with the placebo group. After 24 months of follow-up, the JLD group had a significant improvement in ankle-brachial index and waist circumference compared with the placebo group., Conclusions and Relevance: The findings suggest that JLD can reduce the risk of diabetes in participants with IGT and multiple metabolic abnormalities., Trial Registration: Chinese Clinical Trial Register: ChiCTR1900023241.

Anemia in pregnancy (AIP) is associated with multiple severe maternal and perinatal adverse outcomes. However, there is a lack of evidence on the association between environmental factors and AIP. Aim to explore the association between ambient temperature and the risk of AIP, and identify susceptible exposure windows, we conducted a matched case-control study from 2013 to 2016 in Xi'an, China, which included 710 women with AIP and 1420 women without AIP. The conditional logistic regression model was used to evaluate the association between ambient temperature and AIP at different gestational weeks and gestational months. The association between extreme temperature and AIP was evaluated using the distributed lag nonlinear model (DLNM). We conducted stratified analyses of age, parity, and season of conception, and estimated the interaction between ambient temperature and air pollutants on AIP. Ambient temperature was significantly positively associated with the risk of AIP, and the susceptible exposure windows were 2-25 gestational weeks and 1-6 gestational months, respectively. The strongest effect was observed in the week 8 and month 2, for each 1 °C increase in weekly and monthly mean temperature, the odds ratio (OR) for AIP was 1.038 (95 % confidence interval (CI): 1.022, 1.055) and 1.040 (95 % CI: 1.020, 1.060), respectively. Extreme heat may increase the risk of AIP. Stratified analyses showed that there was no significant difference among different age, parity, and season of conception groups. No significant interaction effect of ambient temperature with air pollution on AIP was found. In summary, high ambient temperature may increase the risk of AIP, and the first and second trimesters may be susceptible exposure windows. Understanding the effect of temperature on pregnant women will be beneficial to reduce the occurrence of AIP., Competing Interests: Declaration of competing interest The authors declare that they have nothing to disclose., (Copyright © 2024 Elsevier B.V. All rights reserved.)

Background: Bovine coronavirus (BCoV) is implicated in severe diarrhea in calves and contributes to the bovine respiratory disease complex; it shares a close relationship with human coronavirus. Similar to other coronaviruses, remarkable variability was found in the genome and biology of the BCoV. In 2022, samples of feces were collected from a cattle farm. A virus was isolated from 7-day-old newborn calves. In this study, we present the genetic characteristics of a new BCoV isolate. The complete genomic, spike protein, and nucleocapsid protein gene sequences of the BCoV strain, along with those of other coronaviruses, were obtained from the GenBank database. Genetic analysis was conducted using MEGA7.0 and the Neighbor-Joining (NJ) method. The reference strains' related genes were retrieved from GenBank for comparison and analysis using DNAMAN., Results: The phylogenetic tree and whole genome consistency analysis showed that it belonged to the GIIb subgroup, which is epidemic in Asia and America, and was quite similar to the Chinese strains in the same cluster. Significantly, the S gene was highly consistent with QH1 (MH810151.1) isolated from yak. This suggests that the strain may have originated from interspecies transmission involving mutations of wild strains. The N gene was conserved and showed high sequence identity with the epidemic strains in China and the USA., Conclusions: Genetic characterization suggests that the isolated strain could be a new mutant from a wild-type lineage, which is in the same cluster as most Chinese epidemic strains but on a new branch., (© 2024. The Author(s).)

Background: The prevalence of neoplastic polyps in gallbladder polyps (GPs) increases sharply with age and is associated with gallbladder carcinoma (GBC). This study aims to predict neoplastic polyps and provide appropriate treatment strategies based on preoperative ultrasound features in patients with different age level., Methods: According to the age classification of WHO, 1523 patients with GPs who underwent cholecystectomy from January 2015 to December 2019 at 11 tertiary hospitals in China were divided into young adults group (n=622), middle-aged group (n=665) and elderly group (n=236). Linear scoring models were established based on independent risk variables screened by the Logistic regression model in different age groups. The area under ROC (AUC) to evaluate the predictive ability of linear scoring models, long- and short- diameter of GPs., Results: Independent risk factors for neoplastic polyps included the number of polyps, polyp size (long diameter), and fundus in the young adults and elderly groups, while the number of polyps, polyp size (long diameter), and polyp size (short diameter) in the middle-aged groups. In different age groups, the AUCs of its linear scoring model were higher than the AUCs of the long- and short- diameter of GPs for differentiating neoplastic and non-neoplastic polyps (all P<0.05), and Hosmer-Lemeshow goodness of fit test showed that the prediction accuracy of the linear scoring models was higher than the long- and short- diameter of GPs (all P>0.05)., Conclusion: The linear scoring models of the young adults, middle-aged and elderly groups can effectively distinguish neoplastic polyps from non-neoplastic polyps based on preoperative ultrasound features., (© 2024. The Author(s).)

Background: More is to be explored between dietary patterns and sleep quality in the Chinese adult population., Methods: A cross-sectional study including 7987 Shanghai suburban adults aged 20-74 years was conducted. Dietary information was obtained using a validated food frequency questionnaire. Adherence to a priori dietary patterns, such as the Chinese Healthy Eating Index (CHEI), Dietary Approaches to Stop Hypertension (DASH) diet and Mediterranean diet (MD), was assessed. Sleep quality was assessed from self-reported responses to the Pittsburgh Sleep Quality Index (PSQI) questionnaire. Logistic regression models adjusting for confounders were employed to examine the associations., Results: The overall prevalence of poor sleep (PSQI score ≥ 5) was 28.46%. Factor analysis demonstrated four a posteriori dietary patterns. Participants with a higher CHEI (OR Q4 vs. Q1 : 0.81, 95% CI: 0.70-0.95), DASH (OR Q4 vs. Q1 : 0.70, 95% CI: 0.60-0.82) or MD (OR Q4 vs. Q1 : 0.75, 95% CI: 0.64-0.87) had a lower poor sleep prevalence, while participants with a higher "Beverages" score had a higher poor sleep prevalence (OR Q4 vs. Q1 : 1.18, 95% CI: 1.02-1.27)., Conclusions: In Shanghai suburban adults, healthier dietary patterns and lower consumption of beverages were associated with better sleep quality.

Purpose: This study aimed to investigate the imaging repeatability of self-service fundus photography compared to traditional fundus photography performed by experienced operators., Design: Prospective cross-sectional study., Methods: In a community-based eye diseases screening site, we recruited 65 eyes (65 participants) from the resident population of Shanghai, China. All participants were devoid of cataract or any other conditions that could potentially compromise the quality of fundus imaging. Participants were categorized into fully self-service fundus photography or traditional fundus photography group. Image quantitative analysis software was used to extract clinically relevant indicators from the fundus images. Finally, a statistical analysis was performed to depict the imaging repeatability of fully self-service fundus photography., Results: There was no statistical difference in the absolute differences, or the extents of variation of the indicators between the two groups. The extents of variation of all the measurement indicators, with the exception of the optic cup area, were below 10% in both groups. The Bland-Altman plots and multivariate analysis results were consistent with results mentioned above., Conclusions: The image repeatability of fully self-service fundus photography is comparable to that of traditional fundus photography performed by professionals, demonstrating promise in large-scale eye disease screening programs., (© 2024. The Author(s).)

Objective: During the COVID-19 pandemic, people posted help-seeking messages on Weibo, a mainstream social media in China, to solve practical problems. As viruses, policies, and perceptions have all changed, help-seeking behavior on Weibo has been shown to evolve in this paper., Methods: We compare and analyze the help-seeking messages from three dimensions: content categories, time distribution, and retweeting influencing factors. First, we crawled the help-seeking messages from Weibo, and successively used CNN and xlm-roberta-large models for text classification to analyze the changes of help-seeking messages in different stages from the content categories dimension. Subsequently, we studied the time distribution of help-seeking messages and calculated the time lag using TLCC algorithm. Finally, we analyze the changes of the retweeting influencing factors of help-seeking messages in different stages by negative binomial regression., Results: (1) Help-seekers in different periods have different emphasis on content. (2) There is a significant correlation between new daily help-seeking messages and new confirmed cases in the middle stage (1/1/2022-5/20/2022), with a 16-day time lag, but there is no correlation in the latter stage (12/10/2022-2/25/2023). (3) In all the periods, pictures or videos, and the length of the text have a significant positive effect on the number of retweets of help-seeking messages, but other factors do not have exactly the same effect on the retweeting volume., Conclusion: This paper demonstrates the evolution of help-seeking messages during different stages of the COVID-19 pandemic in three dimensions: content categories, time distribution, and retweeting influencing factors, which are worthy of reference for decision-makers and help-seekers, as well as provide thinking for subsequent studies., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Jiang, Yao and Song.)

Objectives: This study aimed to measure the prevalence of resistance to antimicrobial agents, and explore the risk factors associated with drug resistance by using nontuberculous Mycobacteria (NTM) isolates from China., Methods: A total of 335 NTM isolates were included in our analysis. Broth dilution method was used to determine in vitro drug susceptibility of NTM isolates., Results: Clarithromycin (CLA) was the most potent drug for Mycobacterium intracellulare (MI). The resistance rate of 244 MI isolates to CLA was 21%, yielding a minimum inhibitory concentrations (MIC) 50 and MIC 90 of 8 and 64 mg/L, respectively. 51% of 244 MI isolates exhibited resistance to amikacin (AMK). For 91 Mycobacterium abscessus complex (MABC) isolates, 6 (7%) and 49 (54%) isolates were categorized as resistant to CLA at day 3 and 14, respectively. The resistance rate to CLA for Mycobacterium abscessus subspecies abscessus (MAA) was dramatically higher than that for Mycobacterium abscessus subspecies massiliense (MAM). Additionally, the percentage of patients presenting fever in the CLA-susceptible group was significantly higher than that in the CLA-resistant group., Conclusions: Our data demonstrate that approximate one fifth of MI isolates are resistant to CLA. We have identified a higher proportion of CLA-resistant MAA isolates than MAM. The patients caused by CLA-resistant MI are at low risk for presenting with fever relative to CLA-susceptible group., (© 2024. The Author(s).)

With increasing environmental degradation, green finance and green innovation have attracted the attention of policymakers and industries. However, the impact of green finance on corporate green innovation is still unexplored. Based on signal theory, this study analyzes the mixed effect of green finance on green innovation in enterprises. We use data from 31 provinces (333 cities in total) in China in 2021 and use a fuzzy set qualitative comparative analysis method. Green finance factors include green credit, green bond, green investment, green insurance, and green subsidy. Our research findings are as follows: Firstly, green innovation in businesses is not a product of a single antecedent situation but rather the interaction of several antecedent conditions. Green insurance and green subsidy are the core prerequisites for high green innovation in enterprises, and green credit plays an auxiliary role. Secondly, when there is a lack of green insurance, green bonds and green subsidies play a key role, leading to a high level of green innovation in businesses. Thirdly, the impact of various antecedents on the level of green innovation performance in enterprises is asymmetric. Policymakers should fully leverage the effect of green subsidy signals and minimize the risks of green innovation by expanding financing channels. Our findings enrich the literature on green innovation and finance and provide beneficial practical insights for green innovation in enterprises., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered., Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β CD59 ) and HBB: c.382&#95;402delCAGGCTGCCTATCAGAAAGTG (termed β CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β 0 -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major., Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis., (© 2023. The Author(s).)

The rat tapeworm Hymenolepis diminuta is a parasite that usually uses rats as a definitive host. It also infects humans and non-human primates. Human infections have been reported in 80 countries worldwide, including China. Nevertheless, nearly all the literature on human infections in China by the rat tapeworm is in Chinese journals, which are very difficult to access by readers outside China. The main aim of the current manuscript was to systematically review human infections by the rat tapeworm in China for readers inside and outside the country. Chinese characters for H. diminuta were used to search several databases, including Google Scholar. In total, 511 infections were reported in 24 Chinese provinces/autonomous regions, which surpassed 320 in Costa Rica as the country with the highest number of infections. Furthermore, three nationwide surveys on parasitic infections in the past 3 decades revealed detailed prevalence of this parasite along with that of roundworm, whipworm, hookworm and pinworm in Chinese populations. These data contribute to better understanding of this greatly neglected zoonosis in the world's most populated country., (© The Author(s) 2023. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene.)

Objective: Striking innovations and advancements have been achieved with the use of artificial intelligence and healthcare information technology being integrated into clinical real-world data. The current scoping review aimed to provide an overview of the current status of artificial intelligence-/information technology-based clinical decision support tools in China., Methods: PubMed/MEDLINE, Embase, China National Knowledge Internet, and Wanfang data were searched for both English and Chinese literature. The gray literature search was conducted for commercially available tools. Original studies that focused on clinical decision support tools driven by artificial intelligence or information technology in China and were published between 2010 and February 2022 were included. Information extracted from each article was further synthesized by themes based on three types of clinical decision-making., Results: A total of 37 peer-reviewed publications and 13 commercially available tools were included in the final analysis. Among them, 32.0% were developed for disease diagnosis, 54.0% for risk prediction and classification, and 14.0% for disease management. Chronic diseases were the most popular therapeutic areas of exploration, with particular emphasis on cardiovascular and cerebrovascular diseases. Single-center electronic medical records were the mainstream data sources leveraged to inform clinical decision-making, with internal validation being predominately used for model evaluation., Conclusions: To effectively promote the extensive use of real-world data and drive a paradigm shift in clinical decision-making in China, multidisciplinary collaboration of key stakeholders is urgently needed., (© 2023 The Authors. Journal of Evidence-Based Medicine published by Chinese Cochrane Center, West China Hospital of Sichuan University and John Wiley & Sons Australia, Ltd.)

To establish a high-quality, easy-to-use, and effective risk prediction model for hepatic encephalopathy, to help healthcare professionals with identifying people who are at high risk of getting hepatic encephalopathy, and to guide them to take early interventions to reduce the occurrence of hepatic encephalopathy. Patients (n = 1178) with decompensated cirrhosis who attended the First Affiliated Hospital of Guangxi University of Chinese Medicine between January 2016 and June 2022 were selected for the establishment and validation of a nomogram model for risk prediction of hepatic encephalopathy. In this study, we screened the risk factors for the development of hepatic encephalopathy in patients with decompensated cirrhosis by univariate analysis, LASSO regression and multifactor analysis, then established a nomogram model for predicting the risk of getting hepatic encephalopathy for patients with decompensated cirrhosis, and finally performed differentiation analysis, calibration analysis, clinical decision curve analysis and validation of the established model. A total of 1178 patients with decompensated cirrhosis who were hospitalized and treated at the First Affiliated Hospital of Guangxi University of Chinese Medicine between January 2016 and June 2022 were included for modeling and validation. Based on the results of univariate analysis, LASSO regression analysis and multifactor analysis, a final nomogram model with age, diabetes, ascites, spontaneous peritonitis, alanine transaminase, and blood potassium as predictors of hepatic encephalopathy risk prediction was created. The results of model differentiation analysis showed that the AUC of the model of the training set was 0.738 (95% CI 0.63-0.746), while the AUC of the model of the validation set was 0.667 (95% CI 0.541-0.706), and the two AUCs indicated a good discrimination of this nomogram model. According to the Cut-Off value determined by the Jorden index, when the Cut-Off value of the training set was set at 0.150, the sensitivity of the model was 72.8%, the specificity was 64.8%, the positive predictive value was 30.4%, and the negative predictive value was 91.9%; when the Cut-Off value of the validation set was set at 0.141, the sensitivity of the model was 69.7%, the specificity was 57.3%, the positive predictive value was 34.5%, and the negative predictive value was 84.7%. The calibration curve and the actual events curve largely overlap at the diagonal, indicating that the prediction with this model has less error. The Hosmer-Lemeshow test for goodness of fit was also applied, and the results showed that for the training set, χ 2  = 1.237587, P = 0.998, and for the validation set, χ 2  = 31.90904, P = 0.0202, indicating that there was no significant difference between the predicted and actual observed values. The results of the clinical decision curve analysis showed that the model had a good clinical benefit, compared with the two extreme clinical scenarios (all patients treated or none treated), and the model also had a good clinical benefit in the validation set. This study showed that aged over 55 years, complications of diabetes, ascites, and spontaneous bacterial peritonitis, abnormal glutamate aminotransferase and abnormal blood potassium are independent risks indicators for the development of hepatic encephalopathy in patients with decompensated cirrhosis. The nomogram model based on the indicators mentioned above can effectively and conveniently predict the risk of developing hepatic encephalopathy in patients with decompensated cirrhosis. The nomogram model established on this study can help clinical healthcare professionals to timely and early identify patients with high risk of developing hepatic encephalopathy., (© 2023. The Author(s).)

Centralized vs. decentralized sewage treatment is one of the key issues in the planning of rural sewage treatment (RST) in China due to the country's diverse regional characteristics. There are very limited comprehensive evaluation models for selecting regionally suitable schemes and facilities, particularly for national or provisional scale planning. As a scenario-based multi-attribute decision-making (MADM) issue, this paper develops a novel RST suitability evaluation model by integrating the multi-attribute analytic hierarchy process (AHP) with the technique for order preference by similarity to an ideal solution (TOPSIS). The suitability evaluation model sets up 3 small-centralized and 4 decentralized RST facilities as candidates and includes 12 evaluation indicators that cover economic cost, life cycle environmental impacts, technical features and operations management. Eight generic scenarios are classified for Chinese rural areas based on differences in three major characteristic factors, i.e., population density (PD), the economic development level (EDL), and topographic slope (TS). The universal evaluation results show that a centralized sewage treatment scheme is more suitable for areas with a high PD/high EDL/low TS, while a decentralized scheme is more suitable for areas with a low PD/low EDL/high TS. Sensitivity analysis shows that in regions with a high PD/low EDL, the indicator weight of the construction investment cost in the model has a great influence on the facility suitability ranking. However, in regions with a high PD/high EDL, the ranking is the most sensitive to the indicator weights of the global warming potential and sewage treatment effect. Furthermore, as a spatial decision issue, an RST suitability map of Hunan Province in China is produced at the county level of resolution, and the map is generally consistent with our field knowledge of several counties in Hunan Province. The presented evaluation framework can be integrated into environmental decision support systems in the future to help local and central governments, water utilities, design institutes and other stakeholders scientifically plan RST projects., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Enhancing green total factor productivity (GTFP) is essential for achieving the objective of green development, and the effect of environmental protection tax (EPT), a crucial instrument for addressing environmental challenges, on green TFP is crucial. Based on provincial panel data from 2004 to 2020 in China, this study uses inter-provincial differences in environmental protection tax rates as a quasi-natural experiment and utilizes a synthetic control method to assess the impact of the "changing sewage charge to tax" on regional GTFP. The empirical results suggest that EPT can help enhance GTFP, a finding that still holds after regional placebo tests, time placebo tests, and difference-in-differences robustness tests. The mechanism test demonstrates that EPT influences GTFP via the industrial structure impact and the green technological innovation effect. According to heterogeneity research, regions with a high level of marketization and financial growth are more significantly affected by environmental protection tax policy. This paper offers crucial empirical data for assessing the efficacy of environmental protection tax policy and enhancing the environmental tax system., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

The study on the "Technology Innovations in Supply Chains: Unlocking Sustainability and SDG Advancement," offers a thorough examination of the intricate connections between technological innovation, supply chain management, sustainability development, and the advancement of the Sustainable Development Goals (SDGs) in various Chinese cities. The study explores how developments in artificial intelligence (A.I.), the Internet of Things (IoT), and big data have changed supply chain practices and their consequent effects on environmental and sustainability results. It does this by utilizing a substantial dataset spanning a decade. The findings showed that different patterns of technological adoption and their impacts might be seen in the assessed cities. While it is clear that technology innovation is essential for improving supply chain effectiveness and encouraging sustainability, not all regions see the same advantages. Variations in supply chain complexity, city size, technology advancement, and environmental legislation are all blamed for these discrepancies. The report also offers detailed knowledge of the connection between the development of modern supply chains and the advancement of the SDGs. Even though many cities showed high relationships, others showed less alignment, pointing to the importance of additional economic, sociopolitical, and environmental factors. The report concludes by highlighting the potential of technology to advance sustainability and the SDGs while emphasizing the necessity for a deliberate and context-specific approach to technology integration. Additionally, it emphasizes how crucial supportive regulations are in maximizing the advantages. These findings significantly impact business executives, educators, and legislators who want to use technology to advance sustainability and the SDGs., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Chest tightness variant asthma (CTVA) was first reported and named by Chinese scholars in 2013. It is a new clinical type of asthma characterized by chest tightness as the only or primary symptom, without typical asthma manifestations such as recurrent wheezing and shortness of breath, and without wheezing sounds heard during lung auscultation. The overall epidemiological data on CTVA is currently unavailable. Its pathogenesis is similar to that of typical asthma, involving eosinophilic airway inflammation. Due to the lack of typical clinical manifestations, insufficient knowledge of this disease in some clinicians and some other reasons, CTVA is susceptible to misdiagnosis or missed diagnosis. Currently, the diagnostic criteria for CTVA are: chest tightness as the only or primary symptom, without typical asthma symptoms and signs such as wheezing and shortness of breath, and with any one of the objective indicators of variable airflow limitation. Effective anti-asthma treatment is required, and other diseases that cause chest tightness, such as cardiovascular, digestive, nervous, muscular, and mental diseases should be excluded. CTVA treatment follows that of typical asthma, but the specific treatment duration is uncertain and may require long-term management. Traditional Chinese medicine has shown some therapeutic effects on CTVA. Most CTVA patients have a good prognosis after active anti-asthma treatment. This paper analyzes and summarizes the research of CTVA in China from 2013 and provides new perspectives for further exploration of CTVA.

Parkinson's disease (PD) is the second most common human neurodegenerative disorder, and the pathogenesis of it remains poorly understood. Limited studies have shown that both long- and short-term exposure to air pollutants may be associated with increased risk of PD while lacking evidence on the effects of intermediate-term exposure. In this study, over-dispersed Poisson generalized additive models (GAMs) were applied to explore the association between intermediate-term sulfur dioxide (SO 2 ) exposure and outpatient visits for PD in Chongqing, China, and further stratified analyses were performed by age and gender. A total of 39,984 PD cases from January 1, 2014, to December 31, 2019 (2191 days) were included. The association of intermediate-term SO 2 exposure with outpatient visits for PD was statistically significant: per 1 μg/m 3 increase of SO 2 corresponded to 2.34% (95% CI: 0.88%, 3.80%) elevation in monthly PD outpatient visits at lag 0 (the concurrent month). Stratified analyses showed that the associations between SO 2 and PD outpatient visits were stronger in younger (≤ 60 years) and female patients. In conclusion, intermediate-term SO 2 exposure can be associated with an increased risk of PD outpatient visits. Our results highlight the importance of recognizing the role of intermediate-term SO 2 exposure in the development of PD. In addition to focusing on the effects of long-term or short-term air pollutants, it is necessary to pay more attention to the health effects of intermediate-term exposure time windows of air pollutants, which will facilitate policy formulation and public health interventions for health risks., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

While significant reductions in certain air pollutant concentrations did not induce obvious mitigations of health risks, a shift from air quality management to health risk prevention and control might be necessary to protect public health. This study thus constructed an Air Quality Health Index (AQHI) for respiratory (Res-AQHI), cardiovascular (Car-AQHI), and allergic (Aller-AQHI) risk groups using mixed exposure under multi-air pollutants and portrayed their distribution and variation at multiple spatiotemporal scales using spatial analysis in GIS with the medical big data and air pollution remote sensing data by taking Hunan Province in China as a case. Results showed that the AQHIs constructed for specific health-risk groups could better express their risks than common AQHI and AQI. Moreover, based on the spatiotemporal association of health and environmental information, the allergic risk group in Hunan provided the highest health risk mainly affected by O 3 . The following cardiovascular and respiratory risk groups can be significantly attributed to NO 2 . Moreover, the spatiotemporal heterogeneity of AQHIs within regions was also evident. On the annual scale, the population in the air health risk hotspots for respiratory and cardiovascular risk decreased, while allergic risks increased. Meanwhile, on seasonal scale, the hotspots for respiratory and cardiovascular risks expanded significantly in winter while completely disappearing for allergic risk. These findings suggest that disease specific AQHIs effectively disclose the health effects of multi-air pollutants and their subsequently varied spatiotemporal distribution patterns., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023. Published by Elsevier Inc.)

The aim of this study is to analyze the research hotspots and development trends in the field of pathogenesis of diabetic nephropathy in China from 2013 to 2022. Based on China National Knowledge Infrastructure, Wanfang Data Knowledge Service Platform, China Science and Technology Journal Database, China Biology Medicine disc, Web of Science core collection and PubMed database, the related literatures in the field of pathogenesis of diabetic nephropathy in China from 2013 to 2022, were retrieved to establish the database, and the VOSviewer software was used for bibliometric analysis. A total of 1 664 Chinese and 2 149 English literatures are included in this study. The scientific research results from 2013 to 2022 have shown an overall increasing trend. The research hotspots in the field of pathogenesis of diabetic nephropathy in China are mainly concentrated in Podocytes, Oxidative stress, Inflammation, Renal fibrosis, Urine protein, etc. The frontier hotspots in this field include Biomarkers, Nrf2, Gut microbiota, NLRP3 inflammasome, Apoptosis, MicroRNA, etc. Through visual analysis, the research hotspots and frontier trends of the pathogenesis of diabetic nephropathy in China can be visually presented, and then provide new ideas and directions for the further in-depth research on the pathogenesis of diabetic nephropathy.

Objective: To analyze the morbidity and mortality trends of thyroid cancer in China from 1990 to 2019, explore the causes of the trends, and predict morbidity and mortality in the future. Methods: The morbidity and mortality data of thyroid cancer in China from 1990 to 2019 were collected from the 2019 Global Burden of Disease database. The Joinpoint regression model was used to describe the change trends. Based on the morbidity and mortality data from 2012 to 2019, a grey model GM (1,1) was constructed to predict the trends in the next ten years. The model was tested by the posterior error method and residual test method. Results: In all populations, men and women, the AAPC values of the crude morbidity rates were 4.15% (95% CI : 3.86%-4.44%, P <0.001), 5.98% (95% CI : 5.65%-6.31%, P <0.001) and 3.23% (95% CI : 2.94%-3.53%, P <0.001) respectively, the AAPC values of age-standardized morbidity rates were 2.47% (95% CI : 2.12%-2.83%, P <0.001), 3.98% (95% CI : 3.68%-4.29%, P <0.001), 1.65% (95% CI : 1.38%-1.93%, P <0.001), the AAPC values of crude mortality rates were 2.09% (95% CI : 1.92%-2.25%, P <0.001), 3.68% (95% CI : 3.45%-3.90%, P <0.001), 0.60% (95% CI : 0.50%-0.71%, P <0.001). The age-standardized mortality rates in men showed a fluctuating trend of first decrease (1990-1994), then increase (1994-2012), and then decrease (2012-2019) (AAPC=1.35%, 95% CI : 1.16%-1.53%, P <0.001). The age-standardized mortality rate in women continuously decreased (AAPC=-1.70%, 95% CI : -1.82%- -1.58%, P <0.001). The GM (1,1) models can be used for medium and long-term predictions. The results of the residual test show that the average relative error values of all models are less than 10.00%, the prediction accuracy values are more than 80.00%, and the prediction effects are good. The results of the posterior error method show that all the prediction results are good except the qualified prediction of the age-standardized morbidity rate in men. In 2029, the crude morbidity rates would increase to 3.57/100 000, 2.78/100 000, and 4.40/100 000, respectively, and the age-standardized incidence rates would increase to 2.38/100 000, 1.89/100 000, and 2.88/100 000, respectively, the crude mortality rates would increase to 0.57/100 000, 0.62/100 000 and 0.53/100 000, and the age-standardized mortality rates would decrease to 0.33/100 000, 0.42/100 000 and 0.27/100 000 in all population, men and women in China. Conclusions: The overall, gender- specific age-standardized mortality rates showed downward trends in the last decade or so, and the prediction results showed that it might further decline. However, the crude morbidity rates, age-standardized and crude mortality rates have been on the rise, and the population aging is becoming increasingly serious in China, which requires close attention and targeted prevention and control measures.

Growing evidence indicates that short-term ozone (O 3 ) exposure has substantial health consequences, but the relationship between short-term ambient O 3 and insomnia, a common sleep disorder, is not clear. This study aimed to investigate the short-term effects of ambient O 3 exposure on outpatient visits for adult insomnia and to explore the potential modifiers. A large-scale multihospital-based study was carried out in Chongqing, the largest city in Southwest China. Daily data on outpatient visits for adult insomnia, average concentrations of ambient air pollutants and meteorological factors were collected. We conducted quasi-Poisson regression with generalized additive model to assess the association between ambient O 3 and outpatient visits for adult insomnia in varied windows of exposure. Subgroup analyses were applied to identify its modifiers. Totally, 140,159 adult insomnia outpatient visits were identified. The daily maximum 8-h average concentration of O 3 was 69 μg/m 3 during the study period, which greatly below the updated Chinese and WHO recommended limits (daily maximum 8-h average, O 3 : 100 μg/m 3 ). Short-term O 3 exposure was significantly negatively associated with outpatient visits for adult insomnia in different lag periods and the greatest decrease of outpatient visits for adult insomnia was found at lag 02 [0.93% (95% CI: 0.48%, 1.38%)]. Additionally, stronger links between O 3 and adult insomnia outpatient visits were presented in cool seasons, and we did not observe any significant modified effects of gender and age. Moreover, the negative O 3 -insomnia association remained robust after controlling for other common air pollutants and comorbidities. In summary, short-term exposure to lower level of ambient O 3 , was associated with reduced daily outpatient visits for adult insomnia and such association showed to be more obvious in cool seasons., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Ltd. All rights reserved.)

Background: The Xpert MTB/RIF (Xpert) assay has been widely used to diagnose suspected active tuberculosis (TB) and rifampicin-resistant TB cases. Despite its excellent performance record, false-positive Xpert rifampicin (RIF) resistance results are obtained for specimens with extremely low bacterial loads., Objective: We aimed to study the feasibility of repeat Xpert testing as a strategy for reducing the odds of obtaining false-positive results when testing paucibacillary TB patients., Methods: We enrolled previously tested TB patients with very low initial bacterial loads from May 2016 to February 2022 for Xpert retesting. A total of 251 TB patients were retested using the Xpert assay., Results: RIF resistance was noted in 65 (25.9 %) patients when tested by Xpert at initial diagnosis. Only 107 (42.6 %) of 251 patients tested positive for MTB when retested via Xpert. The majority (98.6 %) of RIF-susceptible cases were still susceptible to RIF when retested. Initial Xpert testing yielded 35 positive results for MTB in the RIF-resistant group, of whom 25 (71.4 %) still exhibited RIF resistance when retested. All culture-positive MTB isolates in the RIF-susceptible group were also RIF-susceptible by phenotypic DST. In the RIF-resistant group, 10 of 14 culture-positive MTB isolates exhibited RIF resistance, of which 4 isolates were deemed RIF-susceptible by phenotypic DST. The proportion of double mutations within the MTB rpoB RRDR sequence, as detected by hybridization of Xpert D and E probes, was significantly higher in the RIF-susceptible group than in the RIF-susceptible group., Conclusions: Our results demonstrated that initial RIF-susceptible results were more accurate than RIF-resistant results. Additionally, patients with double mutations that delayed probe D/E hybridization were more likely to have false-positive Xpert results. Our findings emphasize that repeat Xpert MTB/RIF testing is necessary for TB patients with extremely low bacterial loads who are at high risk for RIF-resistant TB., Competing Interests: Declaration of Competing Interest The authors declare that there are no competing financial interests., (Copyright © 2023 The Authors. Published by Elsevier Ltd.. All rights reserved.)

Context: Sudden deafness (SSHL) belongs to the category of diseases causing neurological hearing loss with a sudden and unknown etiology. The pathogenesis and mechanism of SSHL aren't clear at present. Gene polymorphisms may be associated with increased or reduced risk of hearing impairment., Objective: The study intended to investigate the association between susceptibility to SSHL and single nucleotide polymorphisms (SNPs) at the rs2228612 locus of the DNA methyltransferase (DNMT1) gene and at the rs5570459 locus of the gap junction protein Beta 2 (GJB2) gene, to provide a basis for the prevention and treatment of the SSHL., Design: The research team performed a case-control study., Setting: The study took place at Tangshan Gongren Hospital in Tangshan, China., Participants: Participants were 200 SSHL patients admitted to the hospital between January 2020 and June 2022, the study group, and 200 people with normal hearing, the control group., Outcome Measures: The research team: (1) performed the Hardy-Weinberg Balance Test to determine the frequency distribution of the data for the rs2228612 locus of the DNMT1 gene and for the RS5570459 locus of the GJB2 gene for the groups, (2) analyzed the relationships between the genotypes and SSHL susceptibility, (3) determined the relationship between gene frequencies and gender and the SSHL susceptibility of males and females with different genotypes, (4) determined the relationship between gene frequencies and smoking and the SSHL susceptibility of smokers and nonsmokers with different genotypes, and (5) determined the relationship between gene frequencies and drinking alcohol and the SSHL susceptibility of drinkers and nondrinkers with different genotypes., Results: The numbers of participants in the study group with the CC genotype and the C allele at the rs2228612 locus of the DNMT1 gene were significantly lower than the numbers in the control group (P < .05). The CC and C alleles were significant protective factors against SSHL (P < .05).The numbers of participants in the study group with the GG genotype and the G allele at the rs5570459 locus of the GJB2 gene were significantly higher than the numbers in the control group (P < .05), and the GG genotype and the G allele significantly increased SSHL susceptibility (P < .05). The TC+CC genotype at the rs2228612 locus of the DNMT1 gene was a protective factor against SSHL in male and smoking participants (P < .05). The AG+GG genotype at the rs5570459 locus of the GJB2 gene increased the susceptibility of females, smokers, and drinkers to SSHL (P < .05)., Conclusions: The TC+CC genotypes at the rs2228612 locus of the DNMT1 gene were significant protective factors against SSHL. The SSHL susceptibility was higher in participants carrying the AG+GG genotype at the rs5570459 locus of the GJB2 gene. In addition, gender and drinking can affect SSHL susceptibility.

As global climate change intensifies, people are paying increasing attention to the impact of temperature changes on adverse mental health outcomes, especially depression. While increasing attention has been paid to the effect of temperature, there is little research on the effect of humidity. We aimed to investigate the association between humidex, an index combining temperature and humidity to reflect perceived temperature, and outpatient visits for depression from 2014 to 2019 in Chongqing, the largest and one of the most hot and humid cities of China. We also aimed to further identify susceptible subgroups. A distributed lag non-linear model (DLNM) was used to explore the concentration-response relationship between humidex and depression outpatient visits. Hierarchical analysis was carried out by age and gender. A total of 155,436 visits for depression were collected from 2014 to 2019 (2191 days). We found that depression outpatient visits were significantly associated with extremely high humidex (≥40). The significant positive single-lag day effect existed at lag 0 (RR = 1.029, 95%CI: 1.000-1.059) to lag 2 (RR = 1.01, 95%CI: 1.004-1.028), and lag 12 (RR = 1.013, 95%CI: 1.002-1.024). The significant cumulative adverse effects lasted from lag 01 to lag 014. Hierarchical analyses showed that females and the elderly (≥60 years) appeared to be more susceptible to extremely high humidex. The attributable numbers (AN) and fraction (AF) of extremely high humidex on depression outpatients were 1709 and 1.10%, respectively. Extremely high humidex can potentially increase the risk of depression, especially in females and the elderly. More protective measures should be taken in vulnerable populations., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2023 Elsevier Inc. All rights reserved.)

Origin verification of high-value saffron is essential for fair trade and to protect consumers' interests and rights. A traceability method using elemental content (% C and % N) and stable isotopes (δ 13 C, δ 2 H, δ 18 O, and δ 15 N) combined with chemometrics was developed to discriminate saffron from Iran and China and classify major domestic production areas in China. Results showed that Iranian samples had lower % C and % N contents but higher δ 13 C values than Chinese origin saffron, with δ 13 C acting as an important variable for origin discrimination. Moreover, δ 2 H and δ 13 C isotopes were found to be important variables to classify Chinese regional saffron origin. Two supervised pattern recognition models (PLS-DA) developed to classify Iranian and Chinese saffron, and regional Chinese saffron had a discrimination accuracy of 85.0 % and 80.2 %, respectively. These models provide the basis for a new regulatory inspection procedure to verify saffron origin and label claims, minimizing fraudulent mislabeling and adding value to saffron from specific regions., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

With the ongoing urbanization in developing regions, integrating regional waste disposal capability is challenging due to unbalanced economic development and rising environmental issues. This research proposed a multi-dimensional symbiotic integration of waste disposal capability. Applying data from the Yangtze River Delta (YRD) in China, we first explore the waste flows and interactions between cities to identify the possibility of inter-municipal collaboration based on the augmented gravity model. We then employ social network analysis to categorize the cities in the collaborative network of waste disposal into subgroups by functionalities. Finally, we proposed the top-down framework of symbiotic networks for waste disposal. Our findings indicate that YRD cities can be classified into four types according to their waste density and disposal efficiency: High-High, Low-High, Low-Low, and High-Low. We also identify three types of inter-municipal collaborative relationships: between high-density and high-efficiency cities, between high-density cities, and between high-efficiency cities. The city subgroups can be categorized into "high-efficiency clusters," "high-density clusters," and "hub clusters," which pave the way for a shared or complementary urban symbiosis in the waste recycling industry. The division of roles among subgroups enables symbiotic activities within the city cluster. This paper extends the spatial scope of industrial symbiosis literature and has practical implications for transitioning to a circular economy in waste management of developing countries., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

A comprehensive understanding of the mobility of both nitrogen (N) and phosphorus (P) and the inter-relationships between P, N, and iron (Fe) in sediments is important for controlling the "internal loadings" of nutrients in lakes. In this research, diffusive gradients in thin film (DGT) assemblies with binding layers (ZrO-AT, chelex, and ZrO) were designed for PO 4 -P, Fe, ammonium (NH 4 -N), and nitrate (NO 3 -N) at sediment/water interface (SWI) in Western Lake Taihu (China). The biogeochemical processes of N and P related to the physicochemical properties, the dynamic P transfer, the distribution characteristics of P microniches, and the estimation of the release risks in sediments in Western Lake Taihu were simultaneously revealed by the passive sampling technique-DGT with the high spatial resolutions (millimeter and sub-millimeter). Based on DGT concentration (C DGT ) related to physicochemical properties in sediments, (1) P biogeochemical reactions included P release from Fe-bound P during Fe reduction, algae biomass decomposition, and phosphatase enzyme activity increased by NH 4 -N; (2) denitrification and dissimilatory nitrate reduction to ammonium (DNRA) led to exchangeable ammonium (NH 4 ex) enrichment and NH 4 -N release; anammox depleted NH 4 -N transfer; organic matter (OM) mineralization favored NH 4 -N release; and (3) aerobic nitrification led to NO 3 -N remobilization; denitrification and DNRA reduced NO 3 -N release. Redox status, OM, Fe, aluminum, or calcium influenced mobilization of nutrients. The numerical model of DGT-induced fluxes in sediments was used for dynamic P transfers with resupply types ("slow" ~ "fast") controlled by labile P pool, resupply constant, response time, and Dspt rate. The formation of P microniches in two dimensions was revealed. Sediment P release risk index (0.49 ~ 36.85 [lg (nmol cm -3 d -1 )]) with "light" ~ "high" risks and diffusive fluxes across SWI (µg m -2 d -1 ) of 15.0 ~ 639 (PO 4 -P), - 1403 ~ 5010 (NH 4 -N), and - 1395 ~ 149 (NO 3 -N) were derived and lake management strategies were provided. The DGT technique provides the characterization of the mobilization of nutrients and evidence for biogeochemical processes at the fine spatial scales for control of internal loadings in sediments., (© 2023. The Author(s), under exclusive licence to Springer-Verlag GmbH Germany, part of Springer Nature.)

Background: Ambient air pollution has been linked to gestational complications. However, the evidence on the relationship between air pollution and fetal distress is limited., Objectives: To investigate the relationship between maternal short-term air pollution exposure and fetal distress, and to identify a potential susceptible population., Methods: This matched case-control study, involving 313 pregnancy women with fetal distress was conducted in Xi'an, the largest city in Northwest China from 2013 to 2016. Each woman with fetal distress was randomly matched with four women without fetal distress of the same age, same gestational week, and registration in the same period (n = 1252). Inverse distance-weighted (IDW) interpolation was applied to estimate maternal air pollution exposure based on the residential addresses. We employed conditional logistic regression model to evaluate the relationship between air pollutants and fetal distress. Distributed lag nonlinear model (DLNM) was performed to examine the exposure-response relationship between air pollutants and fetal distress., Results: Maternal short-term exposure to PM 10 , PM 2.5-10 (PMc), SO 2 , NO 2 , and CO was associated with increased risk of fetal distress. Each 10 μg/m 3 increment in PM 10 , PMc, SO 2 at lag 014, and NO 2 at lag 010, the odds ratio (ORs) of fetal distress were 1.027 (95 % confidence interval (CI): 1.004, 1.050), 1.058 (95 % CI: 1.014, 1.105), 1.140 (95 % CI: 1.029, 1.264), and 1.158 (95 % CI: 1.046, 1.283), respectively. Similarly, with a 0.1 mg/m 3 increment in CO at lag 014, the OR of fetal distress was 1.029 (95 % CI: 1.002, 1.058). Stratified analyses showed that the estimate associations of PM 10 , PM 2.5 and CO appeared to be stronger, although not statistically significantly, among women with gestational complications., Conclusion: Maternal short-term exposure to ambient air pollution may increase the risk of fetal distress. Understanding the detrimental role of air pollution in fetal distress can help us better develop preventative methods in reducing its' impact on maternal and fetal health., Competing Interests: Declaration of competing interest The authors declare they have nothing to disclose., (Copyright © 2022 Elsevier B.V. All rights reserved.)