Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered.
Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β ^CD59 ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β ^CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β ⁰ -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major.
Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.
(© 2023. The Author(s).)