Search

Hepatitis E virus (HEV) poses a significant global health threat, with an estimated 20 million infections occurring annually. Despite being a self-limiting illness, in most cases, HEV infection can lead to severe outcomes, particularly in pregnant women and individuals with pre-existing liver disease. In the absence of specific antiviral treatments, the exploration of RNAi interference (RNAi) as a targeted strategy provides valuable insights for urgently needed therapeutic interventions against Hepatitis E. We designed small interfering RNAs (siRNAs) against HEV, which target the helicase domain and the open reading frame 3 (ORF3). These target regions will reduce the risk of viral escape through mutations, as they belong to the most conserved regions in the HEV genome. The siRNAs targeting the ORF3 efficiently inhibited viral replication in A549 cells after HEV infection. Importantly, the siRNA was also highly effective at inhibiting HEV in the persistently infected A549 cell line, which provides a suitable model for chronic infection in patients. Furthermore, we showed that a 5′ triphosphate modification on the siRNA sense strand activates the RIG-I receptor, a cytoplasmic pattern recognition receptor that recognizes viral RNA. Upon activation, RIG-I triggers a signaling cascade, effectively suppressing HEV replication. This dual-action strategy, combining the activation of the adaptive immune response and the inherent RNAi pathway, inhibits HEV replication successfully and may lead to the development of new therapies. [ABSTRACT FROM AUTHOR]

The clinical development of tyrosine kinase inhibitors (TKI) has led to great strides in improving the survival of chronic myeloid leukemia (CML) and acute myeloid leukemia (AML) patients. But even the new generation TKIs are rendered futile in the face of evolving landscape of acquired mutations leading to drug resistance, necessitating the pursuit of alternative therapeutic approaches. In contrast to exploiting proteins as targets like most conventional drugs and TKIs, RNA Interference (RNAi) exerts its therapeutic action towards disease-driving aberrant genes. To realize the potential of RNAi, the major challenge is to efficiently deliver the therapeutic mediator of RNAi, small interfering RNA (siRNA) molecules. In this study, we explored the feasibility of using aliphatic lipid (linoleic acid and lauric acid)-grafted polymers (lipopolymers) for the delivery of siRNAs against the FLT3 oncogene in AML and BCR-ABL oncogene in CML. The lipopolymer delivered siRNA potently suppressed the proliferation AML and CML cells via silencing of the targeted oncogenes. In both AML and CML subcutaneous xenografts generated in NCG mice, intravenously administered lipopolymer/siRNA complexes displayed significant inhibitory effect on tumor growth. Combining siFLT3 complexes with gilteritinib allowed for reduction of effective drug dosage, longer duration of remission, and enhanced survival after relapse, compared to gilteritinib monotherapy. Anti-leukemic activity of siBCR-ABL complexes was similar in wild-type and TKI-resistant cells, and therapeutic efficacy was confirmed in vivo through prolonged survival of the NCG hosts systemically implanted with TKI-resistant cells. These results demonstrate the preclinical efficacy of lipopolymer facilitated siRNA delivery, providing a novel therapeutic platform for myeloid leukemias. [Display omitted] • Lipopolymers showed superior siRNA delivery in 'hard-to-transfect' leukemia cells. • Lipopolymer/siFLT3 complexes demonstrated therapeutic efficacy in FLT3-ITD AML animal models as monotherapy and in combination with gilteritinib. • Treatment with lipopolymer/siBCR-ABL complexes enhanced survival in mice bearing imatinib-resistant CML xenografts. [ABSTRACT FROM AUTHOR]

Treatment options for COVID-19 remain limited. Here, we report the optimization of an siRNA targeting the highly conserved leader region of SARS-CoV-2. The siRNA was rendered nuclease resistant by the introduction of modified nucleotides without loss of activity. Importantly, the siRNA also retained its inhibitory activity against the emerged omicron sublineage variant BA.2, which occurred after the siRNA was designed and is resistant to other antiviral agents such as antibodies. In addition, we show that a second highly active siRNA designed against the viral 5′-UTR can be applied as a rescue molecule, to minimize the spread of escape mutations. We therefore consider our siRNA-based molecules to be promising broadly active candidates for the treatment of current and future SARS-CoV-2 variants. [Display omitted] • siRNA-CoV6 exhibits high antiviral activity against all SARS-CoV-2 s variant tested. • Reduced silencing activity due to mutations can be compensated by second siRNA. • The introduction modified nucleotides improves stability of the siRNA. • High potency and stability make siCoV6 a candidate for the treatment of COVID-19. [ABSTRACT FROM AUTHOR]

Severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5′ end, which is added to all subgenomic mRNAs at their 5′ terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in‐silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed‐duplex stability, exact complementarity with target, at least three mismatches with any off‐target and least number of off‐targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5′GUUUAGAGAACAGAUCUACAA3′ met almost all specificity criteria with no off‐targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of −327.45 for above‐mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off‐target sequences gave significantly low binding scores. Hence, 5′GUUUAGAGAACAGAUCUACAA3′ siRNA possess great potential to silence the leader sequence of SARS‐CoV‐2 with least off‐target effect. Present study provides great scope for development of gene therapy against the prevailing COVID‐19 disease, thus further research in this concern is urgently demanded. [ABSTRACT FROM AUTHOR]

RNA interference (RNAi) holds great promise for therapeutic applications. However, safe and successful clinical translation essentially requires further advancement of developing efficient delivery systems. Herein, we report that amphiphilic phospholipid peptide dendrimers (AmPPDs) could mediated effective delivery of siRNA targeting Hsp27 for treating castration-resistant prostate cancer (CRPC). AmPPDs bears natural lipid derivative DSPE as the hydrophobic tail and different dendritic l -lysine as the hydrophilic head, capable of compacting siRNA into nanoparticles to protect it from enzymatic degradation. Interestingly, DSPE-KK 2 , AmPPD bearing smaller hydrophilic dendron, promoting more efficient intracellular uptake and endosome release of the so-formed siRNA complexes, as well as better siRNA releasing ability, ultimately resulting in more potent gene silencing and anticancer effects both in vitro and in vivo. Such outstanding performance of DSPE-KK 2 in siRNA delivery may attribute to its optimal balance between the hydrophobic tail and hydrophilic dendritic portion. Our findings provide guidance for the development of safe and effective dendrimer-based siRNA delivery system, thus bringing new hope for combating various diseases. Unlabelled Image [ABSTRACT FROM AUTHOR]

Abstract In the present study, a highly effective carrier system has been developed for the delivery of antiviral siRNA mixtures. The developed hybrid microcarriers, made of biodegradable polymers and SiO 2 nanostructures, more efficiently mediate cellular uptake of siRNA than commercially available liposome-based reagents and polyethyleneimine (PEI); they also demonstrate low in vitro toxicity and protection of siRNA from RNase degradation. A series of siRNA designs (targeting the most conserved regions of three influenza A virus (IAV) genes: NP, NS, and PA) were screened in vitro using RT-qPCR, ELISA analysis, and hemagglutination assay. Based on the results of screening, the three most effective siRNAs (PA-1630, NP-717, and NS-777) were selected for in situ encapsulation into hybrid microcarriers. It was revealed that pre-treatment of cells with a mixture of PA-1630, NP-717, and NS-777 siRNAs, delivered by hybrid microcarriers, provided stronger inhibition of viral M1 mRNA expression and control of NP protein level, after viral infection, than single pre-treatment by any of three encapsulated siRNAs used in the study. Moreover, the effective inhibition of replication in several IAV subtypes (H1N1, H1N1pdm, H5N2, and H7N9) using a cocktail of the three selected siRNAs, delivered by our hybrid capsules to the cells, was achieved. In conclusion, we have developed a proof-of-principle which shows that our hybrid microcarrier technology (utilizing a therapeutic siRNA cocktail) may represent a promising approach in anti-influenza therapy. Graphical abstract Image 1 Highlights • In vitro screening of series of designed siRNAs specific for PA, NP and NS genes was performed. • Hybrid microcarriers for in situ encapsulation of anti-viral siRNA mixture have been developed. • The hybrid microcarriers showed high uptake efficacy and low cytotoxicity. • siRNA mixture –loaded microcarriers provided the most substantial inhibition of virus production. • The antiviral effect of encapsulated siRNAs was demonstrated on several IAV subtypes (H1N1, H1N1pdm, H5N2, H7N9). [ABSTRACT FROM AUTHOR]

Background & Aims Antiviral agents including entecavir (ETV) suppress the replication of the hepatitis B virus (HBV) genome in human hepatocytes, but they do not reduce the abundance of viral proteins. The present study focused on effectively reducing viral protein levels. Methods We designed siRNAs (HBV-siRNA) that target consensus sequences in HBV genomes. To prevent the emergence of escaped mutant virus, we mixed three HBV-siRNAs (HBV-siRNAmix); the mixture was encapsulated in a novel pH-sensitive multifunctional envelope-type nanodevice (MEND), a hepatocyte-specific drug delivery system. Coagulation factor 7 siRNA was used to assess delivery and knockdown efficiencies of MEND/siRNA treatments in mice. The potency of MEND/HBV-siRNAmix was evaluated in primary human hepatocytes and in chimeric mice with humanized liver persistently infected with HBV. Results Effective knockdown of targets, efficient delivery of siRNA, and liver-specific delivery were each observed with MEND. MEND/HBV-siRNA caused efficient reduction of HBsAg and HBeAg in vitro and in vivo . However, ETV treatment did not efficiently reduce HBsAg or HBeAg when compared with a single MEND/HBV-siRNAmix treatment. Furthermore, the suppressive effects of a single dose of MEND/HBV-siRNAmix persisted for 14 days in vitro and in vivo . Conclusion We demonstrated that MEND/HBV-siRNA controlled HBV more efficiently than did ETV. Furthermore, the effect of a single dose of MEND/HBV-siRNA persisted for a long time. These results indicated that MEND/HBV-siRNA may be a promising novel HBV treatment that is more effective than reverse transcriptase inhibitors. [ABSTRACT FROM AUTHOR]

Summary RNAi has always captivated scientists due to its tremendous power to modulate the phenotype of living organisms. This natural and powerful biological mechanism can now be harnessed to downregulate specific gene expression in diseased cells, opening up endless opportunities. Since most of the conventional siRNA delivery methods are limited by a narrow therapeutic index and significant side and off-target effects, we are now in the dawn of a new age in gene therapy driven by nanotechnology vehicles for RNAi therapeutics. Here, we outlook the “do's and dont's” of the inorganic RNAi nanomaterials developed in the last 15 years and the different strategies employed are compared and scrutinized, offering important suggestions for the next 15. [ABSTRACT FROM AUTHOR]

The article presents a study centered on ribonucleic acid (RNA) interference (RNAi) as a tool to control gene expression in the laboratory. It notes that a post-transcriptional gene-silencing mechanism can surface due to the presence of a double-stranded RNA (dsRNA) in eukaryotic cells, leading to a sequence-specific degradation of the target messenger RNA (mRNA). Silencing of viral genes is recommended as a therapeutic strategy, while marine shrimp viral diseases, particularly white spot disease (WSD), are regarded as the most attractive targets for the development of therapeutic RNAi due to its widespread economic impact. The author concluded that the cycle of pathogen must be considered when designing the RNAi-based therapy.

Double stranded short interfering RNAs (siRNAs) mediate gene silencing in a sequence specific manner. By virtue of their specific gene silencing activity and owing to the recent discoveries on their plasmid and virus driven expression, siRNAs are being widely adopted in research and therapeutics. Efforts were made to optimize the siRNA expression system for the application in therapy. One major obstacle in developing RNA interference (RNAi) therapy is the delivery of siRNAs to the target cells. Combination of novel molecular targeting technologies, such as recombinant protein technology and ribosome display technology, will enable to deliver gene silencing agents to target cells specifically and efficiently. [ABSTRACT FROM AUTHOR]

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected almost 200 million people worldwide and led to approximately 4 million deaths as of August 2021. Despite successful vaccine development, treatment options are limited. A promising strategy to specifically target viral infections is to suppress viral replication through RNA interference (RNAi). Hence, we designed eight small interfering RNAs (siRNAs) targeting the highly conserved 5′-untranslated region (5′-UTR) of SARS-CoV-2. The most promising candidate identified in initial reporter assays, termed siCoV6, targets the leader sequence of the virus, which is present in the genomic as well as in all subgenomic RNAs. In assays with infectious SARS-CoV-2, it reduced replication by two orders of magnitude and prevented the development of a cytopathic effect. Moreover, it retained its activity against the SARS-CoV-2 alpha variant and has perfect homology against all sequences of the delta variant that were analyzed by bioinformatic means. Interestingly, the siRNA was even highly active in virus replication assays with the SARS-CoV-1 family member. This work thus identified a very potent siRNA with a broad activity against various SARS-CoV viruses that represents a promising candidate for the development of new treatment options. [ABSTRACT FROM AUTHOR]

The use of synthetic RNA for research purposes as well as RNA-based therapy and vaccination has gained increasing importance. Given the anatomical seclusion of the eye, small interfering RNA (siRNA)-induced gene silencing bears great potential for targeted reduction of pathological gene expression that may allow rational treatment of chronic eye diseases in the future. However, there is yet an unmet need for techniques providing safe and efficient siRNA delivery to the retina. We used magnetic nanoparticles (MNPs) and magnetic force (Reverse Magnetofection) to deliver siRNA/MNP complexes into retinal explant tissue, targeting valosin-containing protein (VCP) previously established as a potential therapeutic target for autosomal dominant retinitis pigmentosa (adRP). Safe and efficient delivery of VCP siRNA was achieved into all retinal cell layers of retinal explants from the RHO P23H rat, a rodent model for adRP. No toxicity or microglial activation was observed. VCP silencing led to a significant decrease of retinal degeneration. Reverse Magnetofection thus offers an effective method to deliver siRNA into retinal tissue. Used in combination with retinal organotypic explants, it can provide an efficient and reliable preclinical test platform of RNA-based therapy approaches for ocular diseases. [ABSTRACT FROM AUTHOR]