Search

We have previously shown that cannabinoid CB1 and CB2 receptor antagonists, AM251 and AM630, respectively, modulate cardiostimulatory effects of isoprenaline in atria of Wistar rats. The aim of the present study was to examine whether such modulatory effects can also be observed (a) in the human atrium and (b) in spontaneously hypertensive rats (SHR) and normotensive Wistar Kyoto rats (WKY). Inotropic effects of isoprenaline and/or CGP12177 (that activate the high- and low-affinity site of β1 -adrenoceptors, respectively) were examined in paced human atrial trabeculae and rat left atria; chronotropic effects were studied in spontaneously beating right rat atria. AM251 modified cardiostimulatory effects more strongly than AM630. Therefore, AM251 (1 μM) enhanced the chronotropic effect of isoprenaline in WKY and SHR as well as inotropic action of isoprenaline in WKY and in human atria. It also increased the inotropic influence of CGP12177 in SHR. AM630 (1 μM) decreased the inotropic effect of isoprenaline and CGP12177 in WKY, but enhanced the isoprenaline-induced inotropic effect in SHR and human atria. Furthermore, AM251 (0.1 and 3 μM) and AM630 (0.1 μM) reduced the inotropic action of isoprenaline in human atria. In conclusion, cannabinoid receptor antagonists have potentially harmful and beneficial effects through their amplificatory effects on β-adrenoceptor-mediated positive chronotropic and inotropic actions, respectively.

Pulmonary hypertension (PH) is a disease leading to increased pressure in the pulmonary artery and right heart failure. The adenosine monophosphate-activated protein kinase (AMPK) activator, metformin, has a protective effect against PH. CB1 receptor blockade reduces the number of pathological alterations in experimental lung fibrosis. The current study evaluates the effect of the peripheral cannabinoid CB1 receptor antagonist JD5037 in mono- and polytherapy with metformin in rat monocrotaline-induced mild PH. Animals received metformin (100 mg/kg), JD5037 (3 mg/kg), or a combination of both once daily for 21 days. Monocrotaline (60 mg/kg) increased right ventricular (RV) systolic pressure (RVSP), led to RV and lung hypertrophy and remodeling, and decreased oxygen saturation. Metformin partially restored the monocrotaline-induced effects, i.e., decreased RVSP, increased oxygen saturation, and counteracted cardiac fibrotic, hypertrophic, and inflammatory changes. JD5037 modified parameters related to inflammation and/or fibrosis. Only polytherapy with metformin and JD5037 improved Fulton’s index and coronary artery hypertrophy and tended to be more effective than monotherapy against alterations in RVSP, oxygen saturation and coronary artery tunica media vacuolization. In conclusion, monotherapy with JD5037 does not markedly influence the PH-related changes. However, polytherapy with metformin tends to be more efficient than any of these compounds alone.

Manfred Göthert, who had served Naunyn-Schmiedeberg’s Arch Pharmacol as Managing Editor from 1998 to 2005, deceased in June 2019. His scientific oeuvre encompasses more than 20 types of presynaptic receptors, mostly on serotoninergic and noradrenergic neurones. He was the first to identify presynaptic receptors for somatostatin and ACTH and described many presynaptic receptors, known from animal preparations, also in human tissue. In particular, he elucidated the pharmacology of presynaptic 5-HT receptors. A second field of interest included ligand-gated and voltage-dependent channels. The negative allosteric effect of anesthetics at peripheral nACh receptors is relevant for the peripheral clinical effects of these drugs and modified the Meyer-Overton hypothesis. The negative allosteric effect of ethanol at NMDA receptors in human brain tissue occurred at concentrations found in the range of clinical ethanol intoxication. Moreover, the inhibitory effect of gabapentinoids on P/Q Ca2+ channels and the subsequent decrease in AMPA-induced noradrenaline release may contribute to their clinical effect. Another ligand-gated ion channel, the 5-HT3 receptor, attracted the interest of Manfred Göthert from the whole animal via isolated preparations down to the cellular level. He contributed to that molecular study in which 5-HT3 receptor subtypes were disclosed. Finally, he found altered pharmacological properties of 5-HT receptor variants like the Arg219Leu 5-HT1A receptor (which was also shown to be associated with major depression) and the Phe124Cys 5-HT1B receptor (which may be related to sumatriptan-induced vasospasm). Manfred Göthert was a brilliant scientist and his papers have a major impact on today’s pharmacology.

Athineos Philippu, Department of Pharmacology and Toxicology, University of Innsbruck, Austria The eighth pharmacologic-historical Forum was held online in 2022 in Bonn during the Meeting of the DGPT. In this forum the personalities of Hans Dengler, Paul Martini, Manfred Göthert, and Rudolf Buchheim were honoured by describing their lives and scientific achievements.

Background LY393558 is a combined antagonist of serotonin (5-HT) 5-HT1B receptors and inhibitor of serotonin transporter (SERT). LY393558 reduces 5-HT-induced vasoconstriction and remodelling of rat and/or mouse pulmonary arteries. The aim of our study was to examine the effect of LY393558 on the 5-HT-stimulated vasoconstriction of human pulmonary arteries (hPAs) and to determine the underlying mechanism(s). Methods Vascular effects of 5-HT receptor agonists, antagonists and a SERT inhibitor were examined in organ bath studies on intralobar hPAs obtained from patients during resection of lung carcinoma. Results Serotonin and agonists of the 5-HT1B receptor (5-carboxamidotryptamine, 5-CT) and 5-HT2A receptor (α-methyl-5-HT) contracted endothelium-intact hPAs in a concentration-dependent fashion. The 5-HT1B antagonists SB224289 and GR55562 reduced responses induced by 5-HT and 5-CT and the 5-HT2A antagonist ketanserin inhibited the effects of 5-HT and α-methyl-5-HT. Administration of the SERT inhibitor citalopram (at a concentration that failed to modify the 5-HT-induced vasoconstriction) in combination with SB224289 or GR55562 was more effective in inhibiting the response to 5-HT than the 5-HT1B antagonists alone. LY393558 showed the greatest antagonistic effect against the vasoconstriction elicited by 5-HT, 5-CT and α-methyl-5-HT. Conclusions LY393558 reduces the 5-HT-induced contraction antagonizing 5-HT1B and 5-HT2A receptors probably due to synergic interaction between SERT inhibition and 5-HT1B receptor antagonism. Thus, it might represent a valuable future option in the pulmonary arterial hypertension therapy.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection may lead to coronavirus disease 2019 (COVID-19) which, in turn, may be associated with multiple organ dysfunction. In this review, we present advantages and disadvantages of cannabidiol (CBD), a non-intoxicating phytocannabinoid from the cannabis plant, as a potential agent for the treatment of COVID-19. CBD has been shown to downregulate proteins responsible for viral entry and to inhibit SARS-CoV-2 replication. Preclinical studies have demonstrated its effectiveness against diseases of the respiratory system as well as its cardioprotective, nephroprotective, hepatoprotective, neuroprotective and anti-convulsant properties, that is, effects that may be beneficial for COVID-19. Only the latter two properties have been demonstrated in clinical studies, which also revealed anxiolytic and antinociceptive effects of CBD (given alone or together with Δ9-tetrahydrocannabinol), which may be important for an adjuvant treatment to improve the quality of life in patients with COVID-19 and to limit post-traumatic stress symptoms. However, one should be aware of side effects of CBD (which are rarely serious), drug interactions (also extending to drugs acting against COVID-19) and the proper route of its administration (vaping may be dangerous). Clearly, further clinical studies are necessary to prove the suitability of CBD for the treatment of COVID-19.

Cannabidiol (CBD) is suggested to possess cardioprotective properties. We examined the influence of chronic (10 mg/kg once daily for 2 weeks) CBD administration on heart structure (e.g. cardiomyocyte width) and function (e.g. stimulatory and inhibitory responses induced by β-adrenoceptor (isoprenaline) and muscarinic receptor (carbachol) activation, respectively). Experiments were performed on hearts and/or left atria isolated from spontaneously (SHR) and deoxycorticosterone (DOCA-salt) hypertensive rats; Wistar-Kyoto (WKY) and sham-operated rats (SHAM) served as the respective normotensive controls. CBD diminished the width of cardiomyocytes in left ventricle and reduced the carbachol-induced vasoconstriction of coronary arteries both in DOCA-salt and SHR. However, it failed to affect left ventricular hypertrophy and even aggravated the impaired positive and negative lusitropic effects elicited by isoprenaline and carbachol, respectively. In normotensive hearts CBD led to untoward structural and functional effects, which occurred only in WKY or SHAM or, like the decrease in β1-adrenoceptor density, in either control strain. In conclusion, due to its modest beneficial effect in hypertension and its adverse effects in normotensive hearts, caution should be taken when using CBD as a drug in therapy.

Muscarinic M2 and M4 receptors resemble each other in brain distribution, function, and Gi/o protein signaling. However, there is evidence from human recombinant receptors that the M4 receptor also couples to Gs protein whereas such an alternative signaling is of minor importance for its M2 counterpart. The question arises whether this property is shared by native receptors, e.g., the murine hippocampal M2- and the striatal M4-autoreceptor. To this end, the electrically evoked tritium overflow was studied in mouse hippocampal and striatal slices pre-incubated with 3H-choline. 3H-Acetylcholine release in either region was inhibited by the potent muscarinic receptor agonist iperoxo (pIC50 8.6–8.8) in an atropine-sensitive manner (apparent pA2 8.6–8.8); iperoxo was much more potent than oxotremorine (pIC50 6.5–6.6). In hippocampal slices, N-ethylmaleimide (NEM) 32 μM, which inactivates Gi/o proteins, tended to shift the concentration-response curve of iperoxo (pIC50 8.8) to the right (pIC50 8.5) and depressed its maximum from 85 to 69%. In striatal slices, the inhibitory effect of iperoxo declined at concentrations higher than 0.1 μM, yielding a biphasic curve with a pIC50 of 8.6 for the falling part and a pEC50 of 6.4 for the rising part of the curve. The inhibitory effect of iperoxo 10 μM (47%) after NEM pre-treatment was lower by about 35% compared to the maximum (74%) obtained without NEM. In conclusion, our data, which need to be confirmed by pertussis toxin, might suggest that in the striatum, unlike the hippocampus, stimulatory Gs protein comes into play at high concentrations of a muscarinic receptor agonist.

The endocannabinoid system is overactivated in arterial, pulmonary and portal hypertension. In this paper, we present limited clinical data concerning the role of cannabinoids in human hypertension including polymorphism of endocannabinoid system components. We underline differences between the acute cannabinoid administration and their potential hypotensive effect after chronic application in experimental hypertension. We discuss pleiotropic effects of cannabinoids on the cardiovascular system mediated via numerous neuronal and non-neuronal mechanisms both in normotension and in hypertension. The final results are dependent on the model of hypertension, age, sex, the cannabinoid ligands used or the action via endocannabinoid metabolites. More experimental and clinical studies are needed to clarify the role of endocannabinoids in hypertension, not only in the search for new therapeutic strategies but also in the context of cardiovascular effects of cannabinoids and the steadily increasing legalization of cannabis use for recreational and medical purposes. LINKED ARTICLES: This article is part of a themed section on 8th European Workshop on Cannabinoid Research. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v176.10/issuetoc.

Presynaptic receptors are sites at which transmitters, locally formed mediators or hormones inhibit or facilitate the release of a given transmitter from its axon terminals. The interest in the identification of presynaptic receptors has faded in recent years and it may therefore be justified to give an overview of their occurrence in the autonomic and central nervous system; this review will focus on presynaptic receptors in human tissues. Autoreceptors are presynaptic receptors at which a given transmitter restrains its further release, though in some instances may also increase its release. Inhibitory autoreceptors represent a typical example of a negative feedback; they are tonically activated by the respective endogenous transmitter and/or are constitutively active. Autoreceptors also play a role under pathophysiological conditions, e.g. by limiting the massive noradrenaline release occurring during congestive heart failure. They can be used for therapeutic purposes; e.g., the α2-adrenoceptor antagonist mirtazapine is used as an antidepressant and the inverse histamine H3 receptor agonist pitolisant has been marketed as a new drug for the treatment of narcolepsy in 2016. Heteroreceptors are presynaptic receptors at which transmitters from adjacent neurons, locally formed mediators (e.g. endocannabinoids) or hormones (e.g. adrenaline) can inhibit or facilitate transmitter release; they may be subject to an endogenous tone. The constipating effect of the sympathetic nervous system or of the antihypertensive drug clonidine is related to the activation of inhibitory α2-adrenoceptors on postganglionic parasympathetic neurons. Part of the stimulating effect of adrenaline on the sympathetic nervous system during stress is related to its facilitatory effect on noradrenaline release via β2-adrenoceptors.

About 40% of the papers within the scientific oeuvre of Manfred Göthert (1939–2019) were dedicated to serotonin (5-hydroxytryptamine, 5-HT). He was not only the witness of the gradual definition of the fourteen 5-HT receptor subtypes but also was involved directly by identifying 5-HT1B, 5-HT1D and 5-HT3 receptors. Moreover, he identified presynaptic 5-HT receptors on central and/or peripheral serotoninergic, noradrenergic and/or cholinergic neurones. Two inhibitory (5-HT1B, 5-HT1D) and two facilitatory (5-HT3, 5-HT4) receptors were found, the 5-HT1B receptor representing a possible target for antidepressant drugs. Ten years earlier than electrophysiologists, he identified ligand-gated receptors like the 5-HT3 and the nicotinic acetylcholine (nACh) receptor as targets of halothane. Simultaneously with, but independent of, other authors he found that ethanol allosterically inhibits N-methyl-d-aspartate (NMDA) receptors, which are affected at an even lower concentration than 5-HT3 and nACh receptors. The latter two receptors were shown to be subject to allosteric inhibition also by cannabinoids via a mechanism unrelated to cannabinoid CB1 or CB2 receptors; cannabinoid inhibition of 5-HT3 receptors may represent a new target for the treatment of neuropathic pain.

Cannabidiol (CBD) is a nonpsychotropic constituent of Cannabis sativa L. It is suggested to be useful in hypertension. Under in vitro conditions, it activates vanilloid TRPV1 and inhibits serotonin 5-HT3 receptors, i.e., receptors involved in the Bezold-Jarisch reflex stimulation. The aim of our study was to compare the cardiovascular effects of CBD in spontaneously hypertensive (SHR) and normotensive Wistar Kyoto (WKY) rats. Experiments were performed on conscious, urethane-anesthetized, and pithed rats. In pithed SHR and WKY, CBD increased heart rate (HR) and systolic blood pressure (SBP) and decreased diastolic BP (DBP) in a manner insensitive to adrenalectomy. Propranolol strongly impaired the CBD-induced increases in HR and SBP without affecting the decreases in DBP. Desipramine also reduced the CBD-induced effects on HR and SBP and further increased its effects on DBP. In anesthetized rats, bolus i.v. injection of single doses of CBD induced short-lasting decreases in HR, SBP, and DBP, stronger in SHR than in WKY and prevented by bilateral vagotomy. The CBD-induced fall in HR but not in BP was diminished by the TRPV1 receptor antagonist capsazepine and almost completely abolished if CBD was re-injected after previous administration. CBD reduced the Bezold-Jarisch reflex elicited by the 5-HT3 receptor agonist phenylbiguanide but not that evoked by the TRPV1 agonist capsaicin. In conscious rats, CBD did not affect cardiovascular parameters. In isolated left atria, CBD decreased contractile force. Conclusions: Cannabidiol (1) induces the Bezold-Jarisch reflex likely via TRPV1 receptors (which undergo tachyphylaxis) more markedly in SHR than in WKY; (2) inhibits the Bezold-Jarisch reflex induced by activation of 5-HT3 but not TRPV1 receptors; (3) has peripheral sympathomimetic, (4) vasodilatory, and (5) negative inotropic effects. The above properties of CBD should be taken under consideration when CBD is used for therapeutic purposes.

Cannabidiol (CBD) is a nonpsychotropic constituent of Cannabis sativa L. It is suggested to be useful in hypertension. Under in vitro conditions, it activates vanilloid TRPV1 and inhibits serotonin 5-HT3 receptors, i.e., receptors involved in the Bezold-Jarisch reflex stimulation. The aim of our study was to compare the cardiovascular effects of CBD in spontaneously hypertensive (SHR) and normotensive Wistar Kyoto (WKY) rats. Experiments were performed on conscious, urethane-anesthetized, and pithed rats. In pithed SHR and WKY, CBD increased heart rate (HR) and systolic blood pressure (SBP) and decreased diastolic BP (DBP) in a manner insensitive to adrenalectomy. Propranolol strongly impaired the CBD-induced increases in HR and SBP without affecting the decreases in DBP. Desipramine also reduced the CBD-induced effects on HR and SBP and further increased its effects on DBP. In anesthetized rats, bolus i.v. injection of single doses of CBD induced short-lasting decreases in HR, SBP, and DBP, stronger in SHR than in WKY and prevented by bilateral vagotomy. The CBD-induced fall in HR but not in BP was diminished by the TRPV1 receptor antagonist capsazepine and almost completely abolished if CBD was re-injected after previous administration. CBD reduced the Bezold-Jarisch reflex elicited by the 5-HT3 receptor agonist phenylbiguanide but not that evoked by the TRPV1 agonist capsaicin. In conscious rats, CBD did not affect cardiovascular parameters. In isolated left atria, CBD decreased contractile force. Conclusions: Cannabidiol (1) induces the Bezold-Jarisch reflex likely via TRPV1 receptors (which undergo tachyphylaxis) more markedly in SHR than in WKY; (2) inhibits the Bezold-Jarisch reflex induced by activation of 5-HT3 but not TRPV1 receptors; (3) has peripheral sympathomimetic, (4) vasodilatory, and (5) negative inotropic effects. The above properties of CBD should be taken under consideration when CBD is used for therapeutic purposes.

Aims This study was performed to examine whether hypertension affects the sympathetic transmission to resistance vessels of pithed rats via inhibitory presynaptic cannabinoid CB1 receptors and whether endocannabinoids are involved in this response. Materials and methods We compared uninephrectomised rats rendered hypertensive by high salt diet and deoxycorticosterone acetate (DOCA) injections with normotensive animals (uninephrectomy only). Experiments were performed on vagotomised and pithed animals. Increases in diastolic blood pressure (DBP) were induced four times (S1–S4) by electrical stimulation or phenylephrine injection. Key findings Electrical stimulation (0.75 Hz, 1 ms, 50 V, 5 impulses) of the preganglionic sympathetic nerve fibres innervating the blood vessels more strongly increased DBP in normotensive than in DOCA–salt rats. Phenylephrine (0.01 μmol/kg) induced similar increases in DBP in both groups. The cannabinoid receptor agonist CP55940 (0.01–1 μmol/kg) did not modify the rises in DBP induced by phenylephrine. However, it inhibited the electrically stimulated increases in DBP, more strongly in DOCA–salt than in normotensive animals (maximally by 50 and 30%, respectively). The effect of CP55940 was attenuated by the CB1 antagonist AM251 (3 μmol/kg). AM251 enhanced the neurogenic vasopressor response during S4 by itself in hypertensive rats only. URB597 (3 μmol/kg), which inhibits degradation of the endocannabinoid anandamide, did not modify the electrically stimulated increases in DBP. Significance The function of inhibitory presynaptic CB1 receptors on sympathetic nerves is enhanced in DOCA–salt hypertensive rats. Thus, the CB1 receptor-mediated inhibition of noradrenaline release from the sympathetic nerve fibres innervating the resistance vessels might play a protective role in hypertension.

The cannabinoid CB1 receptors on the noradrenergic neurons in guinea pig hippocampal slices show an endogenous endocannabinoid tone. This conclusion is based on rimonabant, the facilitatory effect of which on noradrenaline release might be due to its inverse CB1 receptor agonism and/or the interruption of a tonic inhibition elicited by endocannabinoids. To examine the latter mechanism, a neutral antagonist would be suitable. Therefore, we studied whether O-2050 is a neutral CB1 receptor antagonist in the guinea pig hippocampus and whether it mimics the facilitatory effect of rimonabant. CB1 receptor affinity of O-2050 was quantified in cerebrocortical membranes, using (3)H-rimonabant binding. Its CB1 receptor potency and effect on (3)H-noradrenaline release were determined in superfused hippocampal slices. Its intrinsic activity at CB1 receptors was studied in hippocampal membranes, using (35)S-GTPγS binding. Endocannabinoid levels in hippocampus were determined by liquid chromatography-multiple reaction monitoring. O-2050 was about ten times less potent than rimonabant in its CB1 receptor affinity, potency and facilitatory effect on noradrenaline release. Although not affecting (35)S-GTPγS binding by itself, O-2050 shifted the concentration-response curve of a CB1 receptor agonist to the right but that of rimonabant to the left. Levels of anandamide and 2-arachidonoyl glycerol in guinea pig hippocampus closely resembled those in mouse hippocampus. In conclusion, our results with O-2050 confirm that the CB1 receptors on noradrenergic neurons of the guinea pig hippocampus show an endogenous tone. To differentiate between the two mechanisms leading to an endogenous tone, O-2050 is not superior to rimonabant since O-2050 may increase the inverse agonistic effect of endocannabinoids.

It has been suggested that activation of nuclear peroxisome proliferator-activated receptors γ (PPARγ) may represent a new strategy for the treatment of pulmonary arterial hypertension. It has been demonstrated that PPARγ activation relaxed the isolated mouse pulmonary artery. The aims of the present study were to examine whether and to which extent the two PPARγ agonists rosiglitazone and pioglitazone relax the isolated human pulmonary artery and to investigate the underlying mechanism(s). Isolated human pulmonary arteries were obtained from patients without clinical evidence of pulmonary hypertension during resection of lung carcinoma. Vasodilatory effects of PPARγ agonists were examined on endothelium-intact or endothelium-denuded vessels preconstricted with the thromboxane prostanoid receptor agonist U-46619. Rosiglitazone and pioglitazone (0.01–100 μM) caused a concentration- and/or time-dependent full relaxation of U-46619-preconstricted vessels. The rosiglitazone-induced relaxation was attenuated by the PPARγ antagonist GW9662 1 μM, endothelium denudation, the nitric oxide synthase inhibitor L-NAME 300 μM, the cyclooxygenase inhibitor indomethacin 10 μM, and the KATP channel blocker glibenclamide 10 μM. The prostacyclin IP receptor antagonist RO1138452 1 μM shifted the concentration–response curve for rosiglitazone to the right. The PPARγ agonists pioglitazone and rosiglitazone relax human pulmonary arteries. The rosiglitazone-induced vasorelaxation is partially endothelium-dependent and involves PPARγ receptors, arachidonic acid degradation products, nitric oxide, and KATP channels. Thus, the relaxant effect of PPARγ agonists in human pulmonary arteries may represent a new therapeutic target in pulmonary arterial hypertension.

Drug discovery strives for selective ligands to achieve targeted modulation of tissue function. Here we introduce engineered context-sensitive agonism as a postreceptor mechanism for tissue-selective drug action through a G protein-coupled receptor. Acetylcholine M2-receptor activation is known to mediate, among other actions, potentially dangerous slowing of the heart rate. This unwanted side effect is one of the main reasons that limit clinical application of muscarinic agonists. Herein we show that dualsteric (orthosteric/allosteric) agonists induce less cardiac depression ex vivo and in vivo than conventional full agonists. Exploration of the underlying mechanism in living cells employing cellular dynamic mass redistribution identified context-sensitive agonism of these dualsteric agonists. They translate elevation of intracellular cAMP into a switch from full to partial agonism. Designed context-sensitive agonism opens an avenue toward postreceptor pharmacologic selectivity, which even works in target tissues operated by the same subtype of pharmacologic receptor.

Background The aim of our study was (1) the pharmacological characterization of EP 3 receptors in human pulmonary arteries and (2) the examination of the potential involvement of these receptors in the regulation of neurogenic tachycardia in pithed rats. L-826266 served as the EP3 receptor antagonist. Methods Experiments were performed on isolated human pulmonary arteries and pithed rats. Results The prostanoid EP 1 /EP 3 receptor agonist sulprostone (1 nM – 100 μM) concentration-dependently contracted isolated human pulmonary arteries (pEC 50 , 6.88 ± 0.10). The EP 1 receptor antagonist SC 19920 (100 μM) did not affect the vasoconstriction induced by sulprostone, the TP receptor antagonist sulotroban (10 μM) only slightly attenuated the effects elicited by sulprostone > 3 μM, whereas L-826266 (10 μM) shifted its concentration-response curve to the right (apparent pA 2 value 6.18; incubation time 0.5 h). In rings exposed to L-826266 (0.1,1 or 10 μM) for 3 h, a concentration-dependent inhibitory effect against the sulprostone-induced vasoconstriction was obtained, yielding a Schild plot-based pA 2 value of 7.39. In pithed rats, sulprostone (10 – 1,000 nmol/kg), but not the IP/EP 1 receptor agonist iloprost (1-100 nmol/kg), inhibited the electrically evoked increase in heart rate (HR) dosedependently, maximally by at least 80%. L-826266 (3 μmol/kg) did not affect basal HR and diastolic blood pressure, but reduced the inhibitory effect of sulprostone 1,000 nmol/kg by about 20%. Conclusion EP 3 receptors (1) located postsynaptically strongly contract human pulmonary arteries and (2) located presynaptically on sympathetic nerve fibers supplying the heart of pithed rats strongly inhibit the neurogenic tachycardia.

Intravenous (i.v.) injection of the endocannabinoid anandamide induces triphasic cardiovascular responses, including a pressor effect mediated via unknown central and peripheral mechanism(s). The aim of the present study was to determine the central mechanism(s) responsible for the pressor response to anandamide. For this purpose, the influence of antagonists at thromboxane A(2) TP (sulotroban, daltroban, SQ 29548), NMDA (MK-801) and beta(2)-adrenergic receptors (ICI 118551) on the pressor effect induced by i.v. and intracerebroventricularly (i.c.v.) administered anandamide was examined in urethane-anaesthetized rats. Anandamide (1.5-3 micromol/kg, i.v.) or its stable analogue methanandamide (0.75 micromol/kg, i.v.) increased blood pressure by 25%. Anandamide (0.03 mumol per animal i.c.v.) caused a pure pressor effect (by 20%) but only in the presence of antagonists of CB(1) and TRPV1 receptors. The effects of cannabinoids (i.v. or i.c.v.) were diminished by i.v. daltroban, sulotroban (10 mumol/kg each), and/or SQ 29548 (1 mumol/kg). The effect of anandamide i.v. was reduced by SQ 29548 (0.02 mumol per animal i.c.v.) and by the thromboxane A(2) synthesis inhibitor furegrelate i.c.v. (1.8 micromol per animal). ICI 118551, MK-801 (1 micromol/kg i.v. each), and bilateral adrenalectomy diminished the effect of anandamide i.c.v. Sulotroban (i.v.) failed to affect the response to anandamide (i.v.) in pithed rats, and anandamide and methanandamide did not bind to TP receptors in rat platelets. The present study suggests that central beta(2)-adrenergic, NMDA and thromboxane A(2) receptors are involved in the anandamide-induced adrenal secretion of catecholamines and their pressor effect in urethane-anaesthetized rats.

Background and purpose: Intravenous injection of the endocannabinoid anandamide induces complex cardiovascular changes via cannabinoid CB1, CB2 and vanilloid TRPV1 receptors. Recently, evidence has been accumulating that in vitro, but not in vivo, anandamide relaxes blood vessels, via an as yet unidentified, non-CB1 vascular cannabinoid receptor, sensitive to O-1918 (1,3-dimethoxy-5-2-[(1R,6R)-3-methyl-6-(1-methylethenyl)-2-cyclohexen-1-yl]-benzene). We here examined whether the anandamide-induced hypotension in urethane-anaesthetized rats was also mediated via a non-CB1 vascular cannabinoid receptor. Experimental approach: Effects of two antagonists (O-1918 and cannabidiol) of the non-CB1 vascular cannabinoid receptor on anandamide-induced changes in mean, systolic and diastolic blood pressure (MBP, SBP, DBP), mesenteric (MBF) and renal (RBF) blood flow and heart rate (HR) in urethane-anaesthetized rats was examined. Key results: In anaesthetized rats, anandamide (1.5–3 µmol·kg−1) and its stable analogue methanandamide (0.5 µmol·kg−1) caused a delayed and prolonged decrease in MBP, SBP, DBP, MBF and RBF by about 10–30% of the respective basal values without changing HR. In pithed rats, anandamide (3 µmol·kg−1) decreased blood pressure by about 15–20% of the basal value without affecting HR, MBF and RBF. All vascular changes were reduced by about 30–70% by cannabidiol and O-1918 (3 µmol·kg−1, each). Conclusions and implications: Non-CB1 cannabinoid vascular receptors, sensitive to O-1918, contribute to the hypotensive effect of anandamide in anaesthetized rats. Activation of these receptors may be therapeutically important as the endocannabinoid system could be activated as a compensatory mechanism in various forms of hypertension.

Prostaglandin E(2) (PGE(2)) and its analogue sulprostone inhibit noradrenaline and serotonin release in rodent tissues. We examined whether the receptor involved is blocked by the EP(3) antagonist L-826,266, whether such receptors also occur on central cholinergic neurones and retinal dopaminergic cells, whether PGE(2) is produced by the degradation of the endocannabinoid virodhamine and whether EP(3) receptor activation stimulates (35)S-GTPgammaS binding. Transmitter release was studied as electrically evoked tritium overflow in superfused tissues preincubated with (3)H-noradrenaline (which in the guinea pig retina labels dopaminergic cells), (3)H-serotonin or (3)H-choline. (35)S-GTPgammaS binding, a measure of G protein activation, was studied in mouse and guinea pig hippocampal membranes. L-826,266 antagonised the effect of sulprostone on noradrenaline release in the rat cortex, yielding a Schild plot-based pA(2) value of 7.56. Apparent pA(2) values in mouse cortex and rat vas deferens (noradrenaline release) and rat cortex (serotonin release) were 7.55, 7.87 and 7.67, respectively. PGE(2) did not affect acetylcholine release in rat brain and dopamine release in guinea pig retina. In seven mice tissues, noradrenaline release was inhibited by sulprostone but not affected by virodhamine. (35)S-GTPgammaS binding was not altered by sulprostone but stimulated by the cannabinoid agonist WIN 55,212-2. Prostaglandins of the E series inhibit monoamine release via EP(3) receptors at which L-826,266 is a competitive antagonist. EP(3) receptors that inhibit transmitter release are not present on central cholinergic neurones and retinal dopaminergic cells. Virodhamine is not converted to PGE(2). An EP(3) receptor model based on (35)S-GTPgammaS binding could not be identified.

Background and purpose: We examined whether cannabinoid CB1 and histamine H3 receptors resemble α2-adrenoceptors in that their presynaptically mediated cardiovascular effects are less marked in urethane- than in pentobarbitone-anaesthetized pithed rats. Experimental approach: Effects of the cannabinoid agonist CP-55,940 and the H3 receptor agonist imetit on electrically induced tachycardic and vasopressor responses, respectively, was compared in pithed rats anaesthetized with urethane or pentobarbitone. The affinity of urethane for the three receptors was measured by radioligand binding studies in rat brain cortex membranes and its potency assessed in superfused mouse tissues preincubated with 3H-noradrenaline. Key results: The neurogenic tachycardic response was less markedly inhibited by CP-55,940 in urethane- than in pentobarbitone-anaesthetized pithed rats. Imetit inhibited the neurogenic vasopressor response after pentobarbitone but not after urethane. The catecholamine-induced tachycardic and vasopressor response did not differ between rats anaesthetized with either compound. Urethane 10 mM (plasma concentration reached under anaesthesia) did not affect binding to CB1 or H3 receptors and α2 adrenoceptors, nor did it alter the inhibitory effect of agonists at the three receptors on electrically evoked 3H-noradrenaline release. Conclusions and implications: Urethane, but not pentobarbitone, abolished the H3 receptor-mediated vascular response in pithed rats and attenuated the CB1 receptor-mediated cardiac response much more than pentobarbitone. The weaker effects of CB1, H3 and α2 receptor agonists cannot be explained by antagonism by urethane at the three receptors in vitro. Pentobarbitone, but not urethane, is suitable as an anaesthetic for investigations of inhibitory presynaptic receptor function in pithed and anaesthetized rats.

Background and purpose: The endocannabinoid virodhamine is a partial agonist at the cannabinoid CB1 receptor and a full agonist at the CB2 receptor, and relaxes rat mesenteric arteries through endothelial cannabinoid receptors. Its concentration in the periphery exceeds that of the endocannabinoid anandamide. Here, we examined the influence of virodhamine on the human pulmonary artery. Experimental approach: Isolated human pulmonary arteries were obtained during resections for lung carcinoma. Vasorelaxant effects of virodhamine were examined on endothelium-intact vessels precontracted with 5-HT or KCl. Key results: Virodhamine, unlike WIN 55,212-2, relaxed 5-HT-precontracted vessels concentration dependently. The effect of virodhamine was reduced by endothelium denudation, two antagonists of the endothelial cannabinoid receptor, cannabidiol and O-1918, and a high concentration of the CB1 receptor antagonist rimonabant (5 μM), but only slightly attenuated by the NOS inhibitor L-NAME and not affected by a lower concentration of rimonabant (100 nM) or by the CB2 and vanilloid receptor antagonists SR 144528 and capsazepine, respectively. The COX inhibitor indomethacin and the fatty acid amide hydrolase inhibitor URB597 and combined administration of selective blockers of small (apamin) and intermediate and large (charybdotoxin) conductance Ca2+-activated K+ channels attenuated virodhamine-induced relaxation. The vasorelaxant potency of virodhamine was lower in KCl- than in 5-HT-precontracted preparations. Conclusions and implications: Virodhamine relaxes the human pulmonary artery through the putative endothelial cannabinoid receptor and indirectly through a COX-derived vasorelaxant prostanoid formed from the virodhamine metabolite, arachidonic acid. One or both of these mechanisms may stimulate vasorelaxant Ca2+-activated K+ channels. British Journal of Pharmacology (2008) 155, 1034–1042; doi:10.1038/bjp.2008.371; published online 22 September 2008

The histamine H4 receptor is coupled to Gi/o proteins and expressed on inflammatory cells and lymphoid tissues; it was suggested that this receptor also occurs in the brain or on peripheral neurones. Since many Gi/o protein-coupled receptors, including the H3 receptor, serve as presynaptic inhibitory receptors, we studied whether the sympathetic neurones supplying four peripheral tissues and the cholinergic neurones in the hippocampus from the guinea-pig are equipped with release-modulating H4 and H3 receptors. For this purpose, we preincubated tissue pieces from the aorta, atrium, renal cortex and vas deferens with 3H-noradrenaline and hippocampal slices with 3H-choline and determined the electrically evoked tritium overflow. The stimulation-evoked overflow in the five superfused tissues was inhibited by the muscarinic receptor agonist oxotremorine, which served as a positive control, but not affected by the H4 receptor agonist 4-methylhistamine. The H3 receptor agonist R-α-methylhistamine inhibited noradrenaline release in the peripheral tissues without affecting acetylcholine release in the hippocampal slices. Thioperamide shifted the concentration–response curve of histamine in the aorta and the renal cortex to the right, yielding apparent pA2 values of 8.0 and 8.1, respectively, which are close to its affinity at other H3 receptors but higher by one log unit than its pKi at the H4 receptor of the guinea-pig. In conclusion, histamine H4 receptors could not be identified in five experimental models of the guinea-pig that are suited for the detection of presynaptic inhibitory receptors whereas H3 receptors could be shown in the peripheral tissues but not in the hippocampus. This article is part of the Special Issue entitled ‘Histamine Receptors’.

A supersensitivity of the beta-adrenoceptor-mediated chronotropic response has been demonstrated in atria isolated from rats subjected to septic shock. Our study was undertaken to investigate whether bacterial endotoxin/LPS affects the increase in heart rate induced by beta-adrenoceptor agonists in the rat also in vivo. In pithed and vagotomized rats, the nonselective beta-adrenoceptor agonist isoprenaline (0.05-0.15 nmol/kg) and agonists at the high- and low-affinity state of beta1-adrenoceptors, that is, prenalterol (0.3-3 nmol/kg) and (+/-)-4-[3-[(1,1-dimethylethyl)amino]-2-hydroxypropoxy]-1,3-dihydro-2H-benzimidazole-2-one (CGP 12177; 3-6 nmol/kg), respectively, and at beta2-adrenoceptors, that is, fenoterol (1-5 nmol/kg), increased heart rate by 50 to 60 beats/min. Administration of LPS (0.4, 1, and 1.5 mg/kg), under continuous infusion of vasopressin, dose-dependently amplified the chronotropic response to isoprenaline, prenalterol, and fenoterol (by 80%, 50%, and 100%, respectively) but not to CGP 12177. The beta2-adrenoceptor antagonist erythro-(+/-)-1-(7-methylindan-4-yloxy)-3-isopropylaminobutan-2-ol (ICI 118551 0.1 mumol/kg) did not affect the chronotropic responses of isoprenaline, fenoterol, and prenalterol under non-endotoxic conditions, but abolished the potentiation of tachycardia produced by LPS (1.5 mg/kg). The beta1-adrenoceptor antagonist (+/-)-2-hydroxy-5-[2-[[2-hydroxy-3-[4-[1-methyl-4-(trifluoromethyl)-1H-imidazol-2-yl]-phenoxy]propyl]-amino]ethoxy]-benzamide CGP 20712A; 0.1 mumol/kg almost completely reduced the chronotropic effects of isoprenaline, fenoterol, and prenalterol both in control rats and in animals exposed to LPS (1.5 mg/kg). We conclude that LPS sensitizes cardiac beta-adrenoceptors by recruiting functionally active beta2-adrenoceptors, but the amplification of tachycardia occurs only when both beta1- and beta2-adrenoceptors are concomitantly activated. The pithed rat may serve as a model to examine the beta-adrenoceptor supersensitivity in vivo.

Activation by CGP 12177 and cyanopindolol of the human and rat low-affinity state of β1-adrenoceptors increases frequency and contractile force and hastens relaxation in isolated cardiac tissues, and probably relaxes isolated vessels. In order to identify the positive inotropic, positive lusitropic and vasodilator effects of both agonists also in vivo, we have determined their effects on the left ventricular systolic pressure (LVSP), the rate of intraventricular pressure rise (+dP dt−1max) and decline (−dP dt−1max), the diastolic blood pressure (DBP) and the mesenteric blood flow (MBF) in pithed and vagotomized rats. CGP 12177 (0.1–100 nmol kg−1) and cyanopindolol (1–1000 nmol kg−1) dose-dependently enhanced all cardiac parameters. The nonselective β-adrenoceptor antagonist bupranolol 10 μmol kg−1 diminished the CGP 12177 (100 nmol kg−1)-stimulated increases in LVSP from 26.3±8.2 to 13.1±1.8 mmHg (P

Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 microM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 microM WIN 55,212-2 on the evoked overflow from the guinea-pig aorta was comparable in size to that obtained with agonists at the histamine H3, kappa opioid (KOP) and ORL1 (NOP) receptor (1 or 10 microM, producing the respective near-maximum effects) whereas prostaglandin E2 1 microM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guinea-pig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guinea-pig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2.

1. We wanted to search for the mechanism(s) responsible for the brief pressor response induced by anandamide in urethane-anaesthetized rats. 2. The anandamide-induced pressor effect was not modified by the antagonists of cannabinoid CB(1) and vanilloid TRPV(1) receptors, SR 141716A (3 micromol kg(-1)) and capsazepine (1 micromol kg(-1)), respectively, by bilateral vagotomy and by pithing. Replacement of urethane by pentobarbitone virtually abolished the pressor effect of anandamide, both in pithed and vagotomized and in 'intact' rats (i.e. not treated in this manner). 3. The pressor effect of anandamide was reduced by the nonselective TRPV family inhibitor ruthenium red (3 micromol kg(-1)) and by the blocker of L-type calcium channels nifedipine (1 micromol kg(-1)), both in pithed urethane-anaesthetized rats and in 'intact' urethane-anaesthetized rats. The nonselective beta-adrenoceptor antagonist propranolol (0.1 or 0.3 micromol kg(-1)) and the nonselective NMDA receptor antagonist MK-801 (1 micromol kg(-1)) diminished the anandamide-induced vasopressor response in 'intact' but not in pithed rats. The inhibitory effect of propranolol in 'intact' rats was mimicked by the beta(2)-adrenoceptor antagonist ICI 118551 (1 micromol kg(-1)), but not by the beta(1)-adrenoceptor antagonist CGP 20712 (1 micromol kg(-1)). 4. The present study revealed that two mechanisms may be responsible for the anandamide-induced pressor response in urethane-anaesthetized rats. The first involves the central nervous system (probably the medulla oblongata) and is sensitive to propranolol and MK-801. The second, which is located peripherally (most probably in blood vessels), is sensitive to nifedipine, ruthenium red and pentobarbitone and, hence, probably represents a Ca(2+)-dependent mode of action.

Presynaptically localized adrenoceptors occur on a variety of neurones. In particular, alpha2-adrenoceptors, occurring on neurones of the peripheral and central nervous system, inhibit the release of the respective transmitters whereas beta2-adrenoceptors on some types of postganglionic sympathetic neurones facilitate noradrenaline release. Since only little information is available whether there are also presynaptic beta3-adrenoceptors, we examined the effect of beta3-adrenoceptor agonists on noradrenaline release from the resistance vessels and the hippocampus of the rat and on serotonin and acetylcholine release from the rat hippocampus. In rat hippocampal slices preincubated with (H-noradrenaline, 3H-serotonin and 3H-choline and superfused in the presence of an inhibitor of the neuronal transporter of the respective neurone, the beta3-adrenoceptor agonist CL 316243 did not affect the electrically evoked tritium overflow. The latter was, however, inhibited by at least 50% by agonists of the respective autoreceptors. CL 316243 and another three beta3-adrenoceptor agonists (BRL 37344, ZD 2079 and CGP 12177) failed to affect the electrically evoked tritium overflow also in slices preincubated with 3H-noradrenaline and superfused in the presence of the alpha2-adrenoceptor antagonist rauwolscine whereas prostaglandin E2 caused a marked inhibition. In pithed and vagotomized rats, the increase in diastolic blood pressure induced by electrical stimulation of the sympathetic outflow was also not affected by CL 316243 but markedly inhibited by the cannabinoid receptor agonist WIN 55212-2. CL 316243 and WIN 55212-2 were devoid of an effect on the rise in diastolic blood pressure induced by exogenous noradrenaline. In conclusion, our data suggest that the noradrenergic neurones innervating the resistance vessels of the rat and the noradrenergic, serotoninergic and cholinergic neurones of the rat hippocampus are not endowed with presynaptic beta3-adrenoceptors.

The first antagonists known for the histamine H3 receptor were mono-substituted imidazole-containing compounds like thioperamide. Meanwhile numerous novel leads have been developed possessing improved affinities, selectivities, specificities, and pharmacokinetic properties. Scope and limitations of this promising class are discussed concerning their structure-activity relationships as well as pharmacological and potential therapeutic aspects.

Our study was undertaken to investigate whether bacterial endotoxin/lipopolysaccharide (LPS) affects the neurogenic vasopressor response in rats in vivo by presynaptic mechanisms and, if so, to characterize the type of presynaptic receptor(s) operating in the initial phase of septic shock. In pithed and vagotomized rats treated with pancuronium, electrical stimulation (ES) (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibers or intravenous bolus injection of noradrenaline (NA) (1–3 nmol kg−1) increased the diastolic blood pressure (DBP) by about 30 mmHg. Administration of LPS (0.4 and 4 mg kg−1) under continuous infusion of vasopressin inhibited the neurogenic vasopressor response by 25 and 50%, respectively. LPS did not affect the increase in DBP induced by exogenous NA. The LPS-induced inhibition of the neurogenic vasopressor response was counteracted by the cannabinoid CB1 receptor antagonist SR 141716A (0.1 μmol kg−1), but not by the CB2 receptor antagonist SR 144528 (3 μmol kg−1), the vanilloid VR1 receptor antagonist capsazepine (1 μmol kg−1) or the histamine H3 receptor antagonist clobenpropit (0.1 μmol kg−1). The four antagonists by themselves did not affect the increase in DBP induced by ES or by injection of NA in rats not exposed to LPS. We conclude that in the initial phase of septic shock, the activation of presynaptic CB1 receptors by endogenously formed cannabinoids contributes to the inhibition of the neurogenic vasopressor response. British Journal of Pharmacology (2004) 142, 701–708. doi:10.1038/sj.bjp.0705839

We studied whether cannabinoid CB1 receptor gene disruption (to yield CB1−/− mice) affects the electrically evoked tritium overflow from vas deferens and atrial pieces preincubated with [3H]-noradrenaline (NA) (‘noradrenaline release') and from cerebral cortex slices preincubated with [3H]-choline (‘acetylcholine release'). NA release was higher by 37% in vas deferens from CB1−/− mice than in vas deferens from CB1+/+ mice. The cannabinoid receptor agonist WIN 55,212-2 inhibited, and the CB1 receptor inverse agonist/antagonist SR 141716, increased NA release in vas deferens from CB1+/+ mice without affecting it in vas deferens from CB1−/− mice. Atrial NA release did not differ between CB1+/+ and CB1−/− mice nor did WIN 55,212-2 affect NA release in either strain. Cortical acetylcholine (Ach) release did not differ between CB1+/+ and CB1−/− mice. WIN 55,212-2 inhibited, but SR 141716 did not affect, Ach release in the cortex from CB1+/+ mice. Both drugs did not alter Ach release in the cortex from CB1−/− mice. Tritium content did not differ between CB1+/+ and CB1−/− mice in any preparation. In conclusion, the increase in NA release associated with CB1 receptor deficiency in the vas deferens, which cannot be ascribed to an alteration of tritium content of the preparations, suggests an endogenous tone at the CB1 receptors of CB1+/+ mice in this tissue. Furthermore, the effect of WIN 55,212-2 on NA release in the vas deferens and on cortical Ach release involves CB1 receptors, whereas the involvement of non-CB1–non-CB2 receptors can be excluded. Keywords: Cerebral cortex, vas deferens, atrium, acetylcholine release, noradrenaline release, cannabinoid CB1 receptors, CB1 receptor-deficient mouse, presynaptic receptors, SR 141716 Introduction Cannabinoid CB1 receptors serve as presynaptic inhibitory receptors on a variety of central and peripheral neurones (for review, see Schlicker & Kathmann, 2001; Howlett et al., 2002). These receptors are activated by endocannabinoids like anandamide, 2-arachidonoylglycerol, noladin ether and virodhamine (Hanus et al., 2001; Porter & Felder, 2001; Porter et al., 2002). Many types of presynaptic CB1 receptors appear to be subject to an endogenous tone as suggested by the fact that CB1 receptor inverse agonists/antagonists like SR 141716 facilitate the release of the respective neurotransmitter (for review, see Pertwee, 1999; Schlicker & Kathmann, 2001). It is of interest in this context whether lack of CB1 receptors will lead to the same result. We have indeed found recently (Kathmann et al., 2001b) that in hippocampal slices, in which SR 141716 increases acetylcholine (Ach) release (Kathmann et al., 2001a), the release of this transmitter was also increased by CB1 receptor deficiency (CB1 receptor knockout mouse (CB1−/−) generated by Zimmer et al. (1999) from C57BL/6J mice). This alteration in transmitter release is very specific inasmuch as hippocampal noradrenaline (NA) release and striatal Ach release (both of which are not subject to modulation via CB1 receptors; Schlicker et al., 1997; Kathmann et al., 2001a) did not differ between both strains (Kathmann et al., 2001b). The aim of the present study was to examine whether parallel effects of SR 141716 and of CB1 receptor deficiency also occur in other isolated tissues of the mouse. For this purpose, we determined the influence of CB1 receptor gene disruption on NA release in the vas deferens and in the atrium. NA release in the vas deferens is inhibited via presynaptic CB1 receptors subject to an endogenous tone (Rinaldi-Carmona et al., 1994; Pertwee et al., 1996), whereas atrial NA release is not affected by presynaptic CB1 receptors at all (Trendelenburg et al., 2000). Our study was extended to cerebral cortex slices in which Ach release was determined. This experimental model differs from the latter two and from the models considered in our previous study (Kathmann et al., 2001b) in that the release of the transmitter is inhibited via presynaptic CB1 receptors, which are, however, not subject to an endogenous tone, that is, Ach release is not facilitated by SR 141716 (Kathmann et al., 2001a).

1. Atypical beta-adrenoceptors resistant to propranolol, but blocked by bupranolol, increase contractile force and/or frequency of the heart in humans and rats. We compared the potencies of the enantiomers of bupranolol and examined the possible effects of seven bupranolol analogues including bevantolol (BEV) at this receptor in pithed and vagotomized rats. 2. CGP 12177, an agonist of the atypical beta-adrenoceptor, increased heart rate dose-dependently. Its dose-response curve was shifted to the right by S-(-)-bupranolol 10 micro mol kg(-1) by a factor of 8.4, but not affected by the same dose of R-(+)-bupranolol. 3. Desmethylbupranolol and compounds BK-21, BK-22, BK-23 and BK-25 also increased heart rate dose-dependently. The beta(1)-adrenoceptor antagonist CGP 20712 given in combination with the beta(2)-adrenoceptor antagonist ICI 118,551 (0.1 micro mol kg(-1) each) reduced the positive chronotropic action of the five bupranolol analogues without affecting that of CGP 12177. The potencies of the bupranolol analogues to increase heart rate were correlated (r=0.91, P

The cannabinoid CB1 receptor inverse agonist/antagonist SR 141716 increases acetylcholine release in rodent hippocampus and improves memory in some experimental paradigms. Since drugs like SR 141716 may represent a novel class of cognition-enhancing drugs, we wanted to check whether the function of the CB1 receptor is preserved during ageing. Hippocampal and striatal slices from 2- to 3- and 24- to 28-month-old C57BL/6J mice were preincubated with [3H]-choline or [3H]-noradrenaline ([3H]-NA) and superfused. The cannabinoid receptor agonist WIN 55,212-2 inhibited, and SR 141716 facilitated, the electrically (3 Hz) evoked tritium overflow in hippocampal slices (preincubated with [3H]-choline) from young and aged mice to the same extent. The evoked overflow per se was less by 33% in slices from aged animals. WIN 55,212-2 and SR 141716 did not affect, but the muscarinic receptor agonist oxotremorine inhibited, the evoked (3 Hz) overflow in striatal slices (preincubated with [3H]-choline) from young and aged mice to the same extent. The evoked overflow per se tended to be less in slices from aged animals. The evoked (0.3 Hz) overflow in hippocampal slices (preincubated with [3H]-NA) was not affected by WIN 55,212-2 and SR 141716, but was inhibited by histamine (via H3 receptors) in slices from young mice and, to a somewhat less extent, in slices from aged mice. The evoked overflow per se did not differ between age groups. In conclusion, the function of the CB1 receptor involved in the tonic inhibition of hippocampal acetylcholine release is preserved in aged mice. Keywords: Ageing, acetylcholine release, noradrenaline release, hippocampus, striatum, cannabinoid CB1 receptor, muscarinic receptors, histamine H3 receptor, C57BL/6J mouse, SR 141716 Introduction Hashish/marijuana and agonists at cannabinoid CB1 receptors impair learning and memory in humans and animals (for review, see Ameri, 1999; Sullivan, 2000). Two lines of evidence suggest that the endocannabinoid system is involved in cognitive processes. First, the CB1 receptor inverse agonist/antagonist SR 141716 facilitates memory tasks in some behavioural paradigms (Terranova et al., 1996; Lichtman, 2000). Second, in each of the three CB1 receptor knockout mice, marked alterations of learning were observed (Reibaud et al., 1999; Marsicano et al., 2002; Varvel & Lichtman, 2002). CB1 receptors are frequently located presynaptically on nerve endings, where their activation results in inhibition of release of the respective neurotransmitter (for review, see Schlicker & Kathmann, 2001; Howlett et al., 2002). CB1 receptor activation also causes inhibition of acetylcholine release in the hippocampus of rodents, whereas SR 141716 or CB1 receptor deficiency increases the release of this transmitter (for review, see Schlicker & Kathmann, 2001). Thus, the possibility has to be considered that the septohippocampal cholinergic system, the morphological and functional integrity of which is important for learning and memory (Dutar et al., 1995), is implicated in the detrimental effects of cannabinoids on cognitive processes. Even if this should not hold true, the fact that CB1 receptor inverse agonists/antagonists (e.g. SR 141716), like the reversible cholinesterase inhibitors (e.g. donepezil; for review, see Fodero & Small, 2002), increase synaptic acetylcholine levels might mean that CB1 receptor inverse agonists/antagonists might represent a new class of cognition-enhancing agents for use in humans. In this context, it is of interest that CB1 receptor-mediated inhibition of acetylcholine release and its facilitation by SR 141716 have recently also been shown in superfused slices of the human brain (Steffens et al., 2002). Since cognitive decline in humans most frequently occurs in aged individuals, the question has to be addressed whether the molecular substrates for potential cognition-enhancing drugs retain their function during the ageing process. With respect to CB1 receptors, this aspect has so far been studied only rarely. An age-induced reduction of cannabinoid receptor binding and mRNA levels has been shown in the striatum and other extrapyramidal brain regions (Mailleux & Vanderhaeghen, 1992; Romero et al., 1998), but is less marked in other brain regions including the cerebral cortex or the hippocampus (Berrendero et al., 1998). In the study of Romero et al. (1998), a functional parameter, the (CB1 receptor-mediated) stimulation of [35S]-guanylyl-5′-O-(γ-thio)-triphosphate binding by WIN 55,212-2, was also studied in extrapyramidal areas and was found to be decreased in some brain regions. The aim of the present study was to check whether the function of the CB1 receptors involved in the inhibition of hippocampal acetylcholine release is preserved in aged mice of the C57BL/6 strain (frequently used for studies of the ageing brain; for review, see Jucker & Ingram, 1997). We examined the effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from superfused hippocampal slices preincubated with [3H]-choline. For the sake of comparison, the electrically evoked tritium overflow from striatal slices preincubated with [3H]-choline and from hippocampal slices preincubated with [3H]-noradrenaline and its modulation via presynaptic receptors were studied as well.

We examined whether replacement of imidazole by a piperidine or pyrrolidine moiety will affect the potency and affinity of six H3-receptor antagonists. Potencies were determined in superfused mouse brain cortex slices preincubated with [3H]noradrenaline, in which the interaction of the antagonists with histamine with respect to its inhibitory effect on the electrically evoked tritium overflow was studied. Affinities were determined in mouse brain cortex membranes, using the radioligand [3H] N(alpha)-methylhistamine. The concentration-response curve of histamine for its effect on the evoked overflow from mouse brain cortex slices was shifted to the right by the 13 compounds under study. Replacement of the imidazole by a piperidine ring affected the p A2 value as follows: thioperamide, -2.7 log units; clobenpropit, -1.9; proxyfan, -1.3; FUB 138, -1.2. Potency hardly changed (or =0.4 log units) when imidazole was replaced by piperidine in FUB 181 and by piperidine or pyrrolidine in FUB 153. Binding of [3H] N (alpha)-methylhistamine to mouse brain cortex membranes was inhibited monophasically by all compounds. The p K(i) values closely matched their p A2 values with three exceptions. The p K(i) values of proxyfan, FUB 138, and FUB 153 exceeded their respective p A(2) values by about 1 log unit. To reveal a potential partial agonism, the effect of the three drugs on (1) the electrically evoked tritium overflow and (2) [35S]GTPgammaS binding in mouse cortex preparations was determined. Proxyfan proved to be a partial agonist in both models (with intrinsic activities of 0.2 and 0.3, respectively) whereas FUB 138 and FUB 153 were devoid of agonistic effects. In conclusion, replacement of imidazole by piperidine or pyrrolidine affects the antagonist potencies of six H3-receptor antagonists in a very different manner. The piperidine analogue of FUB 181 (with a p A2 value as high as 7.7) may represent a lead for the development of non-imidazole H3-receptor antagonists. The discrepancy between the p K(i) and p A2 values may be accounted for by partial agonism in the case of proxyfan but can, at present, not be satisfactorily explained with respect to FUB 138 and FUB 153.

We determined the effects of nociceptin/orphanin FQ and the NOP receptor ligands acetyl-Arg-Tyr-Tyr-Arg-Ile-Lys-NH2 (Ac-RYYRIK-NH2) and naloxone benzoylhydrazone on transmitter release in vitro. The electrically evoked tritium overflow from guinea-pig and mouse striatal slices and guinea-pig retinal discs preincubated with [3H]-dopamine was inhibited by nociceptin/orphanin FQ (pEC50 7.9, 7.6 and 8.6; Emax 30, 50 and 55%). Ac-RYYRIK-NH2 0.032 μM and naloxone benzoylhydrazone 5 μM antagonized the effect of nociceptin/orphanin FQ in striatal slices of the guinea-pig (apparent pA2 9.1 and 6.8) and the mouse (apparent pA2 9.2 and 7.5) and strongly attenuated the effect of nociceptin/orphanin FQ 0.1 μM in guinea-pig retinal discs. Ac-RYYRIK-NH2 0.032 μM did not affect the evoked overflow by itself whereas naloxone benzoylhydrazone 5 μM inhibited it in each tissue. The electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]-noradrenaline was inhibited by nociceptin/orphanin FQ (pEC50 7.9, Emax 85%), Ac-RYYRIK-NH2 (pEC50 8.3, Emax 47%) but not affected by naloxone benzoylhydrazone 5 μM. Ac-RYYRIK-NH2 and naloxone benzoylhydrazone showed apparent pA2 values of 8.6 and 6.9. In conclusion, the inhibitory effect of nociceptin/orphanin FQ on dopamine release in the striatum and retina and on noradrenaline release in the cerebral cortex is mediated via NOP receptors. Ac-RYYRIK-NH2 behaves as an extremely potent NOP receptor antagonist in the striatum and retina and as a partial agonist in the cortex. Keywords: NOP receptor, nociceptin, orphanin FQ, dopamine release, noradrenaline release, striatum, guinea-pig retina, mouse cerebral cortex, Ac-RYYRIK-NH2, naloxone benzoylhydrazone Introduction A fourth type of opioid receptor, which has a homology in the amino acid sequence to the three classical opioid receptors of about 50%, was first identified in 1994 (for review, see Mogil & Pasternak, 2001). This receptor, termed NOP according to the nomenclature of IUPHAR (International Union of Pharmacology; Cox et al., 2000), is activated by a heptadecapeptide, termed nociceptin/orphanin FQ(N/OFQ) (for review, see Mogil & Pasternak, 2001). The NOP and the classical opioid receptors resemble each other with respect to the transduction mechanisms, i.e. inhibition of adenylyl cyclase (Hawes et al., 2000) and of voltage-dependent Ca2+ channels and activation of voltage-dependent K+ channels (Moran et al., 2000). However, the NOP receptor markedly differs from the classical opioid receptors in its pharmacological properties (e.g. lack of antagonistic effect of the opioid receptor blocking agent naloxone) (Calo et al., 2000) and its distribution in the brain (Mollereau & Mouledous, 2000). The most striking difference, however, occurs with respect to the influence on nociception. Thus, N/OFQ elicits hyperalgesia rather than analgesia when administered at a supraspinal site (for review, see Mogil & Pasternak, 2001). The action of N/OFQ is, however, not restricted to nociception since the heptadecapeptide also affects feeding (Polidori et al., 2000), learning and memory (Noda et al., 2000) and anxiety (Jenck et al., 1997) as well as numerous vegetative functions (Mogil & Pasternak, 2001). One aspect in which the classical opioid and the NOP receptors resemble each other is that they occur presynaptically on a variety of peripheral and central neurones where they cause inhibition of the release of the respective neurotransmitter (Moran et al., 2000; Schlicker & Morari, 2000). N/OFQ e.g. affects the release of dopamine and this has been shown by direct measurement of transmitter release or electrophysiological techniques for the (i) nigrostriatal (Konya et al., 1998; Schlicker et al., 1998a; Shieh & Pan, 2001), (ii) mesolimbic (Murphy et al., 1996; Murphy & Maidment, 1999; Lutfy et al., 2001; Shieh & Pan, 2001; Zheng et al., 2002), (iii) tuberoinfundibular (Wagner et al., 1998; Shieh & Pan, 2001) and (iv) incertohypothalamic system (Shieh & Pan, 2001). The involvement of NOP receptors in the effect of N/OFQ has so far been proven only in the studies by Shieh & Pan (2001; use of an antisense oligodeoxynucleotide) and by Zheng et al. (2002; use of the weakly potent NOP receptor antagonist [Phe1Ψ(CH2-NH)Gly2]-N/OFQ(1-13)NH2). The need for such experiments is highlighted by a study on conscious rats in which intrastriatal administration of N/OFQ increased dopamine release in a manner sensitive to naloxone thereby arguing against the involvement of NOP receptors (Konya et al., 1998). We therefore examined in two in vitro models of the striatum, i.e. superfused guinea-pig and mouse striatal slices, in which N/OFQ inhibits dopamine release in the presence of naloxone (Schlicker et al., 1998a), whether this effect is counteracted by NOP receptor antagonists. We used the selective and highly potent NOP receptor antagonist acetyl-Arg-Tyr-Tyr-Arg-Ile-Lys-NH2 (Ac-RYYRIK-NH2) (Dooley et al., 1997; Berger et al., 1999) and a non-selective and less potent NOP receptor antagonist, naloxone benzoylhydrazone, used by our own group (Schlicker et al., 1998b; Malinowska et al., 2000a) and by other investigators (Bucher, 1998; Siniscalchi et al., 1999; Ho et al., 2000; Bigoni et al., 2002). Furthermore, we studied whether N/OFQ affects dopamine release also in guinea-pig retinal discs since the influence of N/OFQ on the retinal dopamine system has so far not been examined. Finally, we compared the potencies of Ac-RYYRIK-NH2 and naloxone benzoylhydrazone at the NOP receptor causing inhibition of noradrenaline release in the mouse brain cortex, i.e. at an NOP receptor previously identified and characterized by our group (Schlicker et al., 1998b; Bauer et al., 1999; Werthwein et al., 1999).

Aims This study was performed to examine whether acute pressure overload induced by transverse aortic constriction (TAC) inhibits the neurogenic vasopressor response and, if so, to check the role of cannabinoid CB 1 receptors and/or other mechanisms. Main methods TAC or a sham operation was performed in pithed and vagotomised rats; sham-operated rats were infused with vasopressin to ensure a basal systolic blood pressure (SBP) comparable to that of TAC animals. SBP was increased by 40 mm Hg by electrical stimulation of the preganglionic sympathetic nerve fibres or phenylephrine injection. At the end of the experiments, the atria and aorta were isolated. Key findings TAC reduced the electrically (but not the chemically) induced pressor response by 80%; sham operation plus vasopressin had no effect. While the cannabinoid receptor agonist CP55940 and antagonists of CB 1 receptors (AM251), α 2 -adrenoceptors (rauwolscine) and K ATP channels (glibenclamide) did not modify the inhibitory effect of TAC, adrenal medulla removal did prevent this effect. The contractile effects of noradrenaline and isoprenaline were reduced (isolated left atria), whereas their chronotropic effects (right atria) were not affected by TAC, which also spared the vasoconstrictor responses to phenylephrine (isolated aorta). Significance Acute pressure overload induced by TAC reduces the neurogenic vasopressor response via an unknown presynaptic mechanism, an increase in heart rate induced by catecholamines released from the adrenal medulla and a decrease in the catecholamine-induced heart contractility. A better understanding of the negative consequences induced by the acute pressure overload may help in the design of future heart failure therapies.

In previous studies, long-term cannabis use led to alterations of the endocannabinoid system including an increase in CB1 and/or CB2 receptor messenger RNA (mRNA) in blood cells and an increase in the serum level of the endocannabinoid 2-arachidonoyl glycerol. However, in those studies, cannabis use was stopped only few days before testing or not interrupted at all. Therefore, one cannot decide whether the alterations are due to long-term cannabis abuse or are confounded by acute effects of cannabis. Blood was sampled from donors that had smoked marijuana ≥20 times in their lives but had abstained from cannabis for ≥6 months (high-frequency users, HFU) and from controls (cannabis use ≤5 times lifetime). CB1 and CB2 mRNA was determined in peripheral mononuclear blood cells using the reverse transcriptase polymerase chain reaction. Serum anandamide level was assayed using electrospray tandem mass spectrometry. CB2 mRNA was increased by 45 % in HFU when compared to controls, whereas CB1 mRNA did not differ. The anandamide level in HFU exceeded that in controls by 90 %. Tobacco smoking could be excluded as a confounding factor. In conclusion, marijuana users that had smoked marijuana ≥20 times in their lives and stopped cannabis use at least 6 months before the study show an increase in CB2 receptor mRNA in the blood and in serum anandamide level. These alterations resemble those obtained for marijuana smokers that had stopped cannabis use only few days before testing and may be implicated in the pathogenesis of disorders associated with long-term cannabis use.

β-Adrenoceptor antagonists are important drugs for the treatment of cardiovascular diseases and some of those drugs also block the so-called low-affinity site of β1-adrenoceptors although at much higher concentrations. This low-affinity site, also identified in vivo and in human tissue, may come into play under certain pathophysiological situations including arrhythmias. The aim of our study was to determine the potency of 14 compounds chemically related to bupranolol or bevantolol and two xanthone derivatives at the low-affinity site of the β1-adrenoceptor. The potency of the compounds at the low- and high-affinity site of β1-adrenoceptors (β1L and β1H; both increasing heart rate) was compared in the pithed rat. One compound was also studied in the isolated rat heart and its α1-adrenolytic effect determined in the isolated rat mesenteric artery. In the pithed rat, four compounds blocked the β1L-adrenoceptor at a ≥10-fold lower potency than the β1H-adrenoceptor whereas the xanthone derivative (−)-MH-3 was equipotent. In the spontaneously beating right atrium (−)-MH-3 was a non-competitive antagonist of comparable potency at either receptor; its apparent pD′2 value for the β1L-adrenoceptor ranged from 5.6 to 6.4 under various conditions, including the Langendorff preparation. Its apparent pA2 at the α1-adrenoceptor in the mesenteric artery was 8.4. (−)-MH-3 is the first compound with virtually the same potency at the low- and high-affinity site of β1-adrenoceptors in vivo; it appears to be a non-competitive antagonist at either site in vitro.

We studied the effects of nociceptin, the endogenous ligand of the opioid OP4 receptor, and of two cannabinoid receptor agonists WIN 55,212-2 and CP-55,940 (0.001-1 micromol/kg each) on the neurogenic tachycardia and bradycardia in pithed rats. Electrical stimulation (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibres and injection of nicotine 2 micromol/kg or isoprenaline 0.5 nmol/kg increased heart rate by about 70 beats/min (bpm) in pithed rats pretreated with atropine 1.5-2 micromol/kg. The electrically induced tachycardia was reduced dose dependently by nociceptin, WIN 55,212-2 and CP-55,940 (by 60, 30 and 20% at the highest dose, respectively). The OP4 and cannabinoid receptor agonists diminished the nicotine- but not the isoprenaline-stimulated increase in heart rate. In pithed rats pretreated with propranolol 3 micromol/kg, vagal stimulation (5 Hz, 1 ms, 15 V for 10 s) or injection of methacholine (5-10 nmol/kg) decreased heart rate by about 30 bpm. Nociceptin, but not WIN 55,212-2 or CP-55,940 decreased the vagal bradycardia dose dependently (the inhibitory effect of 1 micromol/kg was about 40%). Nociceptin failed to modify the methacholine-induced decrease in heart rate. The OP4 receptor antagonists naloxone benzoylhydrazone 5 micromol/kg and/or [Phe1Psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 0.7 micromol/kg, but not the OP(1-3) receptor antagonist naloxone 10 micromol/kg, diminished the inhibitory action of nociceptin on the neurogenic tachycardia and bradycardia. The inhibitory effect of both cannabinoid receptor agonists on the neurogenic tachycardia was abolished by the CB1 receptor antagonist SR 141716 0.1 micromol/kg. The present data suggest that the postganglionic sympathetic nerve fibres innervating the rat heart are endowed with presynaptic opioid OP4 and cannabinoid CB1 receptors, activation of which inhibits the neurogenic tachycardia. The parasympathetic nerve fibres innervating the heart and causing bradycardia are endowed with presynaptic opioid OP4 but not cannabinoid receptors.

We determined the affinities of eight novel histamine H(3)-receptor ligands (ethers and carbamates) for H(3)-receptor binding sites and their agonistic/antagonistic effects in two functional H(3)-receptor models. The compounds differ from histamine in that the ethylamine chain is replaced by a propyloxy chain; in the three ethers mentioned below (FUB 335, 373 and 407), R is n-pentyl, 3-methylbutyl and 3,3-dimethylbutyl, respectively. The compounds monophasically inhibited [(3)H]-N(alpha)-methylhistamine binding to mouse cerebral cortex membranes (pK(i) 7.51 - 9.53). The concentration-response curve of histamine for its inhibitory effect on the electrically evoked [(3)H]-noradrenaline overflow from mouse cortex slices was shifted to the right by these compounds (apparent pA(2) 6.61 - 8.00). Only FUB 373 and 407 inhibited the evoked overflow by themselves (intrinsic activities 0.3 and 0.4); these effects were counteracted by the H(3)-receptor antagonist clobenpropit. [(35)S]-GTPgammaS binding to mouse cortex membranes was stimulated by the H(3)-receptor agonist (R)-alpha-methylhistamine in a manner sensitive to clobenpropit. Among the novel compounds only FUB 373 and 407 stimulated [(35)S]-GTPgammaS binding (intrinsic activities 0.6 and 0.4). In conclusion, the novel compounds are partial H(3)-receptor agonists (FUB 373 and 407) or H(3)-receptor antagonists; comparison with FUB 335 shows that the transition from antagonist to agonist is caused by a slight structural change. A protonated N atom in the side chain is not necessary for agonism at H(3) receptors, proposing a receptor-ligand interaction different from that of classical agonists.

We examined whether acetylcholine release in the hippocampus and striatum and noradrenaline release in the hippocampus is altered in CB(1) receptor-deficient mice. The electrically evoked tritium overflow from hippocampal slices preincubated with [(3)H]-choline was increased by about 100% in CB(1)(-/-) compared to CB(1)(+/+) mice whereas the electrically evoked tritium overflow from striatal slices preincubated with [(3)H]-choline and from hippocampal slices preincubated with [(3)H]-noradrenaline did not differ. The cannabinoid receptor agonist, WIN 55,212-2, inhibited, and the CB(1) receptor antagonist, SR 141716, facilitated, the evoked tritium overflow from hippocampal slices (preincubated with [(3)H]-choline) from CB(1)(+/+) as opposed to CB(1)(-/-) mice. Both drugs did not affect the evoked tritium overflow from striatal slices (preincubated with [(3)H]-choline) and from hippocampal slices (preincubated with [(3)H]-noradrenaline) from CB(1)(+/+) and CB(1)(-/-) mice. The selective increase in acetylcholine release in CB(1)(-/-) mice may indicate that the presynaptic CB(1) receptors on the cholinergic neurones of the mouse hippocampus are tonically activated and/or constitutively active in vivo.

Clenbuterol, a lipophilic beta2-adrenoceptor agonist, was investigated in various seizure models of experimental epilepsy. In the maximal electroshock seizure threshold test, clenbuterol (> or =4 mg/kg i.p.) increased the electroconvulsive threshold for tonic seizures in mice. In the traditional maximal electroshock seizure (MES) test in mice, ED50 values of 11 mg/kg i.p. or s.c. were determined. In both models, the beta2-receptor antagonist ICI 118.551 did not antagonize the anticonvulsant activity of clenbuterol. Combinations of clenbuterol with standard antiepileptics revealed additive anticonvulsant effects. Repeated administration of clenbuterol (5 mg/kg s.c., twice daily for 14 days) to mice did not significantly influence its anticonvulsant potency or the effectiveness of phenobarbital in the MES test. In various chemically-induced seizure tests with tonic convulsions, clenbuterol inhibited or tended to suppress the tonic phase. However, this drug was not effective in preventing clonic seizures in the pentylenetetrazol (85 mg/kg s.c.) seizure threshold test. In the rotarod ataxia test (mice), a minimal "neurotoxic" dose (TD50) of 41 mg/kg i.p. was determined. In unrestrained rats with chronically implanted electrodes in the dorsal hippocampus, clenbuterol (2 mg/kg and 4 mg/kg i.p.) significantly reduced the duration of electrically evoked hippocampal afterdischarges. In amygdala-kindled rats, clenbuterol (5 mg/kg and 10 mg/kg i.p.) reduced the seizure severity to stage 3. Additional studies indicated that clenbuterol (6 mg/kg i.p.) increased the heart rate and decreased the blood pressure, but this drug did not alter the plasma level of the two tested antiepileptics phenobarbital and carbamazepine. Furthermore, in whole-cell voltage-clamp experiments on cultured neonatal rat cardiomyocytes, clenbuterol (1-100 microM) depressed the fast sodium current in a concentration- and frequency-dependent manner. In conclusion, the anticonvulsant effects of higher doses of clenbuterol against generalized tonic-clonic and complex partial seizures seem to be related to the inhibition of voltage-dependent sodium channels and not to the modulation of beta-adrenoceptors.

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

In segments of rat vena cava preincubated with [(3)H]-noradrenaline and superfused with physiological salt solution, the influence of agmatine on the electrically evoked [(3)H]-noradrenaline release, the EP(3) prostaglandin receptor-mediated and the alpha(2D)-adrenoceptor-mediated inhibition of evoked [(3)H]-noradrenaline release was investigated. Agmatine (0.1-10 microM) by itself was without effect on evoked [(3)H]-noradrenaline release. In the presence of 10 microM agmatine, the prostaglandin E(2)(PGE(2))-induced EP(3)-receptor-mediated inhibition of [(3)H]-noradrenaline release was not modified, whereas the alpha(2D)-adrenoceptor-mediated inhibition of [(3)H]-noradrenaline release induced by noradrenaline, moxonidine or clonidine was more pronounced than in the absence of agmatine. However, 1 mM agmatine antagonized the moxonidine-induced inhibition of [(3)H]-noradrenaline release. Agmatine concentration-dependently inhibited the binding of [(3)H]-clonidine and [(3)H]-rauwolscine to rat brain cortex membranes (K(i) values 6 microM and 12 microM, respectively). In addition, 30 and 100 microM agmatine increased the rate of association and decreased the rate of dissociation of [(3)H]-clonidine resulting in an increased affinity of the radioligand for the alpha(2D)-adrenoceptors. [(14)C]-agmatine labelled specific binding sites on rat brain cortex membranes. In competition experiments. [(14)C]-agmatine was inhibited from binding to its specific recognition sites by unlabelled agmatine, but not by rauwolscine and moxonidine. In conclusion, the present data indicate that agmatine both acts as an antagonist at the ligand recognition site of the alpha(2D)-adrenoceptor and enhances the effects of alpha(2)-adrenoceptor agonists probably by binding to an allosteric binding site of the alpha(2D)-adrenoceptor which seems to be labelled by [(14)C]-agmatine.

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi

Nociceptin (or orphanin FQ), the endogenous ligand for the opioid receptor-like 1 (ORL1) receptor, decreases blood pressure in the conscious and anesthetized rat. This study examined whether prejunctional inhibitory ORL1 receptors located on the postganglionic sympathetic neurons innervating the resistance vessels are detectable in pithed rats. In pithed and vagotomized rats electrical stimulation of the preganglionic sympathetic nerve fibers, injection of nicotine (2 micromol/kg) or noradrenaline (1 nmol/kg) increased blood pressure by about 30 mmHg. The electrically induced vasopressor response was decreased dose-dependently by nociceptin (0.001-1 micromol/kg; decrease by about 60% at 1 micromol/kg). Nociceptin 0.1 micromol/kg reduced the nicotine-induced vasopressor response by about 40% but at doses up to 1 micromol/kg failed to affect the increase in blood pressure evoked by noradrenaline. The inhibitory action of nociceptin on the electrically and nicotine-induced increase in blood pressure was attenuated by the ORL1 receptor antagonists naloxone benzoylhydrazone (5 micromol/kg) and/or [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (1 micromol/kg) but was not affected by naloxone 10 micromol/kg. In conclusion, the present data suggest that the postganglionic sympathetic nerve fibers innervating the resistance vessels of the rat are endowed with prejunctional ORL1 receptors, activation of which causes inhibition of noradrenaline release.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Mouse brain slices preincubated with [3H]-noradrenaline or [3H]-serotonin were superfused with medium containing naloxone 10 μM; we studied whether nociceptin (the endogenous ligand at ORL1 receptors) affects monoamine release. Furthermore, the affinities of ORL1 ligands were determined using [3H]-nociceptin binding. The electrically (0.3 Hz) evoked tritium overflow in mouse cortex slices preincubated with [3H]-noradrenaline was inhibited by nociceptin and [Tyr14]-nociceptin (maximally by 80%; pEC50 7.52 and 8.28) but not affected by [des-Phe1]-nociceptin (pEC50