Search

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg -1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL -1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy., (© 2022 The Authors. Small published by Wiley-VCH GmbH.)

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL., Competing Interests: The authors have declared that no competing interests exist.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52-30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

Cystic Fibrosis (CF) is one of the most common life shortening conditions in Caucasians. CF is caused by mutations in the CF Transmembrane Conductance Regulator (CFTR) gene which result in reduced or altered CFTR functionality. Several microRNAs (miRNAs) downregulate the expression of CFTR, thus causing or exacerbating the symptoms of CF. In this context, the design of anti-miRNA agents represents a valid functional tool, but its translation to the clinic might lead to unpredictable side effects because of the interference with the expression of other genes regulated by the same miRNAs. Herein, for the first time, is proposed the use of peptide nucleic acids (PNAs) to protect specific sequences in the 3'UTR (untranslated region) of the CFTR messenger RNA (mRNA) by action of miRNAs. Two PNAs (7 and 13 bases long) carrying the tetrapeptide Gly-SerP-SerP-Gly at their C-end, fully complementary to the 3'UTR sequence recognized by miR-509-3p, have been synthesized and the structural features of target PNA/RNA heteroduplexes have been investigated by spectroscopic and molecular dynamics studies. The co-transfection of the pLuc-CFTR-3´UTR vector with different combinations of PNAs, miR-509-3p, and controls in A549 cells demonstrated the ability of the longer PNA to rescue the luciferase activity by up to 70% of the control, thus supporting the use of suitable PNAs to counteract the reduction in the CFTR expression., Competing Interests: The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

Background: G-quadruplex DNA is involved in many physiological and pathological processes. Both clinical and experimental studies on DNA G-quadruplexes are slowed down by their enzymatic instability. In this frame, more stable chemically modified analogs are needed., Methods: The bis-end-linked-(gggt) 2 PNA molecule (BEL-PNA) was synthesized using in solution and solid phase synthetic approaches. Quadruplex formation was assessed by circular dichroism (CD) and surface enhanced Raman scattering (SERS)., Results: An unprecedented bimolecular PNA homo quadruplex is here reported. To achieve this goal, we developed a bifunctional linker that once functionalized with gggt PNA strands and annealed in K + buffer allowed the obtainment of a PNA homo quadruplex. The identification of the strong SERS band at ~1481cm -1 , attributable to vibrations involving the quadruplex diagnostic Hoogsteen type hydrogen bonds, confirmed the formation of the PNA homo quadruplex., Conclusions: By tethering two G-rich PNA strands to the two ends of a suitable bifunctional linker it is possible to obtain bimolecular PNA homo quadruplexes after annealing in K + -containing buffers. The formation of such CD-unfriendly complexes can be monitored, even at low concentrations, by using the SERS technique., General Significance: Given the importance of DNA G-quadruplexes in medicine and nanotechnology, the obtainment of G-quadruplex analogs provided with enhanced enzymatic stability, and their monitoring by highly sensitive label-free techniques are of the highest importance. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio., (Copyright © 2016 Elsevier B.V. All rights reserved.)

Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA-) RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the miRNAs involved in the posttranscriptional regulation of the CFTR disease-gene of Cystic Fibrosis, and bearing suitable functionalization at its N- and C-ends aimed at improving its resistance to nucleases and cellular uptake, is able to revert the expression of the luciferase gene containing the 3'UTR of the gene in A549 human lung cancer cells, in agreement with the MD results that pointed at the formation of a stable RNA/PNA heteroduplex notwithstanding the short sequence of the latter. The here reported results widen the interest towards the use of small PNAs as effective anti-miRNA agents.

Dominant diseases are single gene disorders occurring in the heterozygous state. The mutated allele exerts a dominant effect because it produces an abnormal polypeptide that interferes with the function of the normal allele product. Peptide Nucleic Acids (PNAs) offer a route for a potential therapy for dominant diseases by selectively silencing the allele carrying the dominant mutation. Here, we have synthesized and studied the properties of a 15-mer PNA fully complementary to the site of the c.5272-38T>A sequence variation, which identifies a recurrent mutant COL7A1 allele causing dominant dystrophic epidermolysis bullosa (DDEB), a mendelian disease characterized by skin blistering. The PNA was conjugated with four lysine residues at the C-terminus and a fluorescent probe at the N-terminus. Physico-chemical results proved the formation of a stable, selective PNA/mutant-DNA heteroduplex in vitro. Intriguingly, when transfected into normal human fibroblasts, the PNA correctly localized in the cell nucleus. Our results open new therapeutic possibilities for patients with DDEB.

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

Continuing our research on the development of nucleopeptides as ODN analogs for biomedical and bioengineering applications, here we report the synthesis and the chemical-physical characterization of a homoadenine hexamer based on a l-diaminobutyric acid (l-DABA) backbone (dabPNA), and its binding studies with a complementary aegPNA. We demonstrated by CD and UV experiments that the l-dabPNA binds the aegPNA forming a complex with good thermal stability, that we identified as a left-handed triplex.

In this work we investigated the interaction between the short ac(4)a C-rich peptide nucleic acid (PNA) probe and two intramolecular G-quadruplex targets having the same G-tetrad core, but different folding topologies. The T(G(4)T)(3)G(4)T and the recently reported tetra-end-linked-(TG(4)T)(4) G-rich oligonucleotides (GROs) were chosen and synthesized for this study. UV, CD, and MS experiments revealed the formation of novel 1:1 G-quadruplex-PNA complexes besides the expected DNA-PNA heteroduplexes.

PNA-DNA chimeras present the interesting properties of PNA, such as the high binding affinity to complementary single-strand (DNA or RNA), and the resistance to nuclease and protease degradation. At the same time, the limitations of an oligomer containing all PNA residues, such as low water solubility, self-aggregation, and low cellular uptake, are effectively overcome. Further, PNA-DNA chimeras possess interesting biological properties as antisense agents. We have explored the ability of PNA-DNA chimeric strands to assemble in quadruplex structures. The rate constant for association of the quadruplexes and their thermodynamic properties have been determined by CD spectroscopy and differential scanning calorimetry (DSC). Thermal denaturation experiments indicated higher thermal and thermodynamic stabilities for chimeric quadruplexes in comparison with the corresponding unmodified DNA quadruplex. Singular value decomposition analysis (SVD) suggests the presence of kinetically stable intermediate species in the quadruplex formation process. The experimental results have been discussed on the basis of molecular dynamic simulations. The ability of PNA-DNA chimeras to form stable quadruplex structures expands their potential utility as therapeutic agents.

Targeting double-stranded DNA with homopyrimidine PNAs results in strand displacement complexes PNA/DNA/PNA rather than PNA/DNA/DNA triplex structures. Not much is known about the binding properties of DNA-PNA chimeras. A 16-mer 5'-DNA-3'-p-(N)PNA(C) has been investigated for its ability to hybridize a complementary duplex DNA by DSC, CD, and molecular modeling studies. The obtained results showed the formation of a triplex structure having similar, if not slightly higher, stability compared to the same all-DNA complex., (Copyright 2004 Wiley Periodicals, Inc.)

A systematic study to evaluate the ability of 5'-DNA-3'-p-(N)-PNA-(C) chimeras to form triple helix structures has been undertaken. Preliminary results carried out on a 16-mer chimera with three PNA monomers at the 3'-end showed the formation of a stable DNA-PNA/DNA/DNA triplex, having similar conformational behaviour to a canonical DNA/DNA/DNA triplex.

1H-NMR, CD, and UV spectroscopy have been used to investigate the structure of PNA/DNA chimeras forming quadruplex structures. In particular, we synthesized 5'TGGG3'-t (1) and 5'TGG3'-gt (2), where lower and upper case letters indicate PNA and DNA residues, respectively. CD spectrum and all NMR data of (1) are typical of quadruplexes involving four parallel strands. UV melting profile of (1) indicates that its thermal stability is quite similar to that observed for the reference structure [d(TGGGT)]4. 1H-NMR spectrum for 5'TGG3'-gt (2) shows that this oligonucleotide is not able to fold into a single, well-defined species.