Search

Cell-free DNA (cfDNA) analysis, specifically circulating tumor DNA (ctDNA) analysis, provides enormous opportunities for noninvasive early assessment of cancers. To date, PCR-based methods have led this field. However, the limited sensitivity/specificity of PCR-based methods necessitates the search for new methods. Here, we describe a direct approach to detect KRAS G12D mutated genes in clinical ctDNA samples with the utmost LOD and sensitivity/specificity. In this study, MutS protein was immobilized on the tip of an atomic force microscope (AFM), and the protein sensed the mismatched sites of the duplex formed between the capture probe on the surface and mutated DNA. A noteworthy LOD (3 copies, 0.006% allele frequency) was achieved, along with superb sensitivity/specificity (100%/100%). These observations demonstrate that force-based AFM, in combination with the protein found in nature and properly designed capture probes/blockers, represents an exciting new avenue for ctDNA analysis.

The development of a multiplexed sensing platform is necessary for highly selective, sensitive, and rapid screening of specific antibiotics. In this study, we designed a novel multiplex aptasensor for antibiotics by fluorescence resonance energy transfer (FRET) strategy using DNase I-assisted cyclic enzymatic signal amplification (CESA) method combined with aptamer/graphene oxide complex. The aptamers specific for sulfadimethoxine, kanamycin, and ampicillin were conjugated with Cyanine 3 (Cy3), 6-Carboxyfluorescein (FAM), and Cyanine 5 (Cy5), respectively, and graphene oxide (GO) was adopted to quench the fluorescence of the three different fluorophores with the efficiencies of 94.36%, 93.94%, and 96.97% for Cy3, FAM, and Cy5, respectively. CESA method was used for sensitive detection, resulting in a 2.1-fold increased signal compared to those of unamplified method. The aptasensor rapidly detected antibiotics in solution with limit of detection of 1.997, 2.664, and 2.337 ng/mL for sulfadimethoxine, kanamycin, and ampicillin, respectively. In addition, antibiotics dissolved in milk were efficiently detected with similar sensitivities. Multiplexed detection test proved that the fluorescently modified aptamers could work separately from each other. The results indicate that the aptasensor offers high specificity for each antibiotic and enables simultaneous and multicolor sensing for rapid screening of multiple antibiotics at the same time.

In this study, we proposed a new G-quadruplex (GQ)-based fluorescent aptasensor using one-shot detection of NS1 for dengue fever diagnosis. To design the aptasensor, Dengue virus-derived NS1-binding aptamer (DBA) that forms a GQ structure was developed. The DBA underwent structural destruction induced by nonstructural protein 1 (NS1), then we aimed to utilize it for optical sensing. Fluorescent detection of the NS1-dependent structural change was performed by applying a fluorescent dye; 6-carboxyfluorescein (FAM) was attached to the 5' end of DBA (5' FAM-DBA). The 5' FAM-DBA could quantitatively detect the fluorescence quenching caused by guanines upon NS1 binding, which was feasible for dengue fever diagnosis. We analyzed to understand the structural and fluorescent characteristics that are involved in the interaction between NS1 and DBA. The results suggested that the central G-tracts were rearranged to adjacent toward the FAM, and that the structure of 5' FAM-DBA bound to NS1 was expected to form base-pairing. Finally, the aptasensor with 5’ FAM-DBA was established after optimization, which contributed to the effective and rapid detection. The aptasensor achieved low detection limits of 2.51 nM in buffer and 8.13 nM in serum. Additionally, it was verified the high specificity using other proteins including yellow fever proteins, and it has the potential to overcome the cross-reactivity with other flaviviruses. Also, the stability of the DF aptasensor was confirmed to give practical usability. Here, we developed a novel GQ-based fluorescent aptasensor for rapid and simple dengue fever diagnosis, which could provide the possibility for use in practical applications.

Electrochemical biosensors using five anticancer drug and lipid molecules attached on the conducting polymer layer to obtain the orientation of drug molecules toward cancer cells, were evaluated as sensing materials and their performances were compared. Conjugation of the drug molecules with a lipid, phosphatidylcholine (PC) has enhanced the sensitivity towards leukemia cells and differentiates cancer cells from normal cells. The composition of each layer of sensor probe was confirmed by electrochemical and surface characterization experiments. Both impedance spectroscopy and voltammetry show the enhanced interaction of leukemia cells using the drug/lipid modified sensor probe. As the number of leukemia cells increased, the charge transfer resistance (R ct ) in impedance spectra increased and the amine oxidation peak current of drug molecules in voltammograms decreased at around 0.7–1.0 V. Of test drug molecules, raltitrexed (Rtx) showed the best performance for the cancer cells detection. Cancer and normal cell lines from different origins were examined to evaluate the degree of expression of folate receptors (FR) on cells surface, where cervical HeLa cell line was found to be shown the highest expression of the receptor. Impedance and chronoamperometric experiments for leukemia cell line (Jurkat E6-1) showed linear dynamic ranges of 1.0×10 3 –2.5×10 5 cells/mL and 1.0×10 3 –8.0×10 3 cells/mL with detection limits of 68±5 cells/mL and 21±3 cells/mL, respectively.

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

In this study, we synthesized dual aptamer-modified silica nanoparticles that simultaneously target two types of breast cancer cells: the mucin 1 (MUC1)(+) and human epidermal growth factor receptor 2 (HER2)(+) cell lines. Dual aptamer system enables a broad diagnosis for breast cancer in comparison with the single aptamer system. The dye-doped silica nanoparticles offer great stability with respect to photobleaching and enable the accurate quantification of breast cancer cells. The morphological and spectroscopic characteristics of the designed Dual-SiNPs were demonstrated via diverse methods such as DLS, zeta potential measurements, UV-vis spectroscopy, and fluorescence spectroscopy. Negatively charged Dual-SiNPs with a homogeneous size distribution showed robust and strong fluorescence. In addition, Dual-SiNPs did not affect cell viability, implying that this probe might be readily available for use in an in vivo system. Through ratio optimization of the MUC1 and HER2 aptamers, the binding capacities of the Dual-SiNPs to both cell lines were maximized. Based on Dual-SiNPs, a highly sensitive quantification of breast cancer cells was performed, resulting in a detection limit of 1 cell/100 μL, which is significantly lower compared with those reported in other studies. Moreover, the developed detection platform displayed high selectivity for only the MUC1(+) and HER2(+) cell lines. It is expected that this valuable diagnostic probe will be a noteworthy platform for the diagnosis and prognosis of breast cancer.

Although various studies related to nanoparticles-based photothermal therapy have been actively performed, an epoch-making photothermolysis therapy exhibiting both high selectivity and efficiency has yet not been discovered. For the first time, we have developed novel valuable therapeutic complexes, namely, dual aptamer-modified gold nanostars, for the targeting of prostate cancers, including PSMA(+) and PSMA(−) cells. The synthesized probes were characterized through several techniques, including UV-VIS spectral analysis, DLS analysis, zeta potential measurements, and TEM imaging, and were subsequently subjected to cytotoxicity tests, cell uptake confirmation, and in vitro photothermal therapy. The homogeneously well-fabricated nanostars presented high selectivity to prostate cancer cells and extremely high efficiency for therapy using an 808 nm laser under an irradiance of 0.3 W cm−2, which is lower than the permitted value for skin exposure (0.329 W cm−2). It is anticipated that this novel photothermal agent will become the general platform for targeted therapy.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

Simultaneous evaluation of the binding affinity of a series of aptamers toward a target molecule was investigated using an electrochemical microarray chip. The chip was modified by immobilizing seven aptamers obtained from the SELEX process and a control sequence onto gold nanoparticle-comprised conducting polymer-coated microarray electrodes. The chip was then incubated with the target molecule, kanamycin. The electrochemical response of the captured kanamycin was studied to evaluate the binding affinity of the aptamers, which showed the same trend with the fluorescence spectroscopic results. The lowest dissociation constant between a selected aptamer and kanamycin was determined to be 38.06 � 0.73 nM.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

The angiotensin II type I receptor (AGTR1) has been implicated in diverse aspects of human disease, from the regulation of blood pressure and cardiovascular homeostasis to cancer progression. We sought to investigate the role of AGTR1 in cell proliferation, epithelial-mesenchymal transition (EMT), migration, invasion, angiogenesis and tumor growth in the breast cancer cell line MCF7. Stable overexpression of AGTR1 was associated with accelerated cell proliferation, concomitant with increased expression of survival factors including poly(ADP-ribose) polymerase (PARP) and X-linked inhibitor of apoptosis (XIAP), as well as extracellular signal-regulated kinase (ERK) activation. AGTR1-overexpressing MCF7 cells were more aggressive than their parent line, with significantly increased activity in migration and invasion assays. These observations were associated with changes in EMT markers, including reduced E-cadherin expression and increased p-Smad3, Smad4 and Snail levels. Treatment with the AGTR1 antagonist losartan attenuated these effects. AGTR1 overexpression also accelerated tumor growth and increased Ki-67 expression in a xenograft model. This was associated with increased tumor angiogenesis, as evidenced by a significant increase in microvessels in the intratumoral and peritumoral areas, and enhanced tumor invasion, with the latter response associated with increased EMT marker expression and matrix metallopeptidase 9 (MMP-9) upregulation. In vivo administration of losartan significantly reduced both tumor growth and angiogenesis. Our findings suggest that AGTR1 plays a significant role in tumor aggressiveness, and its inhibition may have therapeutic implications.

SUMMARY Recent studies have shown that stromal cell derived factor-1 (SDF-1), first known as a cytokine involved in recruiting stem cells into injured organs, confers myocardial protection in myocardial infarction, which is not dependent on stem cell recruitment but related with modulation of ischemia-reperfusion (I/R) injury. However, the effect of SDF has been studied only in a preischemic exposure model, which is not clinically relevant if SDF is to be used as a therapeutic agent. Our study was aimed at evaluating whether or not SDF-1 confers cardioprotection during the reperfusion period. Hearts from SD rats were isolated and perfused with the Langendorff system. Proximal left coronary artery ligation, reperfusion, and SDF perfusion in KH buffer was done according to study protocol. Area of necrosis (AN) relative to area at risk (AR) was the primary endpoint of the study. Significant reduction of AN/AR by SDF in an almost dose-dependent manner was noted during both the preischemic exposure and reperfusion periods. In particular, infusion of a high concentration of SDF (25 nM/L) resulted in a dramatic reduction of infarct size, which was greater than that achieved with ischemic pre- or postconditioning. SDF perfusion during reperfusion was associated with a similar significant reduction of infarct size as preischemic SDF exposure. Further studies are warranted to assess the potential of SDF as a therapeutic agent for reducing I/R injury in clinical practice.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

Polymyxin B, a cationic antimicrobial peptide has been isolated from Paenibacillus polymyxa. The cationic peptide has polycationic, amphipathic and cyclic unique features. These characteristics of the cationic antimicrobial peptide are thought to contribute to the destruction of gram-negative bacteria by through an initial interaction with the negatively charged surface molecule lipopolysaccharide (LPS), which leads to self promoted uptake across the outer membrane into the negatively charged cytoplasmic membrane of the bacterium. This leads to membrane perturbation and probably translocation of the peptide across the membrane. Some gram-negative bacteria resistant to polymyxin B possess mechanism that modify the LPS through neutralization of its negative charge, which decreases the binding affinity of polymyxin B. Several of the genes regulated by PhoP/PhoQ and PmrA/ PmrB encode enzymes that modify either the acyl chain region or the phosphate group of LPS. In Salmonella, polymyxin B resistance is mainly controlled by the PmrA/PmrB two-component system (Figure 1). PmrA-activated genes encode periplasmic and cause the modification of the LPS. Transcription of PmrA-activated genes is not only promoted by high levels of extra-cytoplasmic Fe, which is sensed by the PmrB protein, also it is activated by the PhoP/PhoQ system in response to low levels of extra-cytoplasmic Mg. For activation of PmrA at the low level Mg condition not only requires the noncognate sensor PhoQ protein but also its cognate regulator PhoP, and the PhoP activated PmrD gene. The PmrD protein appears to control the PmrA/PmrB system at a post-transcriptional level. The PmrD protein activates the PmrA/PmrB system via a protection mechanism through dephosphorylation of PmrA. The protective activity of PmrD protein is suggestive of the behavior displayed by certain members of the 14-3-3 protein family in eukaryotes to prevent the phosphorylated state of CDC25. It has recently been reported that the differential regulation of homologous genes is the mechanism responsible for the divergence of Salmonella enterica and E. coli in their ability to make LPS modifications and mediate resistance to polymyxin B. In contrast to Salmonella, E. coli K-12 induces PmrA-activated gene transcription and polymyxin B resistance in response to Fe, but it makes no response to low levels of Mg. This discrepancy suggests that the structure of E.coli PmrD differs from Salmonella PmrD. In particular, the N-terminal region of PmrD, which differs between the E.coli and Salmonella proteins, is in part responsible for the distinct behaviors of the PmrD proteins (Figure 2). In the present report, we describe the crystallization and preliminary X-ray analysis of E. coli PmrD.

Background and objectives Information about the role of the stromal cell-derived factor-1α (SDF-1α)/chemokine receptor type 4 (CXCR4) axis in ischemic postconditioning (IPOC) is currently limited. We hypothesized that the SDF-1α/CXCR4 signaling pathway is directly involved in the cardioprotective effect of IPOC. Methods Isolated rat hearts were divided into four groups. The control group was subjected to 30-min of regional ischemia and 2-hour of reperfusion (n=12). The IPOC group was induced with 6 cycles of 10-second reperfusion and 10-second global ischemia (n=8) in each cycle. The CXCR4 antagonist, AMD3100, was applied before reperfusion in the IPOC group (AMD+IPOC group, n=11) and control group (AMD group, n=9). Hemodynamic changes with electrocardiography were monitored and infarct size was measured. The SDF-1α, lactate dehydrogenase (LDH) and creatine kinase (CK) concentrations in perfusate were measured. We also analyzed extracellular signal-regulated kinase 1/2 (ERK1/2) and Akt phosphorylation state expression. Results IPOC significantly reduced infarct size, but AMD3100 attenuated the infarct reducing effect of IPOC. IPOC significantly decreased LDH and CK, but these effects were reversed by AMD3100. ERK1/2 and Akt phosphorylation increased with IPOC and these effects were blocked by AMD3100. Conclusion Based on the results of this study, SDF-1α/CXCR4 signaling may be involved in IPOC cardioprotection and this signaling pathway couples to the ERK1/2 and Akt pathways.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/μl for PDDA and 74 parasites/μl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

Correct diagnosis and successful therapy are extremely important to enjoy a healthy life when suffering from a disease. To achieve these aims, various cutting-edge technologies have been designed and fabricated to diagnose and treat specific diseases. Among these technologies, aptamer–nanomaterial hybrids have received considerable attention from scientists and doctors because they have numerous advantages over other methods, such as good biocompatibility, low immunogenicity and controllable selectivity. In particular, aptamers, oligonucleic acids or peptides that bind to a specific target molecule, are regarded as outstanding biomolecules. In this review, several screening techniques for aptamers, also called systematic evolution of ligands by exponential enrichment (SELEX) methods, are introduced, and diagnostic and therapeutic aptamer applications are also presented. Furthermore, we describe diverse aptamer–nanomaterial conjugate designs and their applications for diagnosis and therapy. A wide variety ofnanoparticle complexes that target specific biomolecules are revolutionizing disease diagnostics and therapies. Hunho Jo and Changill Ban at Pohang University of Science and Technology, South Korea, reviewed recent advances into the medical uses of aptamerscomplexed with nanoparticles. Aptamers arepeptides or small sections of DNA or RNA that can target and bind to specific chemicals in the body. In a complex, they effectively act as guides escorting nanoparticles to the places where they are needed. For example, aptamers can lead fluorescent nanoparticles to cancer cells to ensure clear imaging and diagnosis of tumors. The authors describe several promising aptamer-nanoparticle complexes, including probes for detecting cocaine and diagnosing breast cancer,as well asa drug delivery system that targets specific brain cells and may provide a therapy for Alzheimer's disease.

A gold nanoparticle based dual fluorescence–colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5′-CACGGCATGGTGGGCGTCGTG-3′), AMP17 (5′-GCGGGCGGTTGTATAGCGG-3′), and AMP18 (5′-TTAGTTGGGGTTCAGTTGG-3′), were confirmed to have high sensitivity and specificity to ampicillin (K d, AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5′-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (−) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

MutL is required to assist the mismatch repair protein MutS during initiation of the methyl-directed mismatch repair (MMR) response in various organisms ranging from prokaryotes to eukaryotes. Despite this necessity, the inherent propensity of MutL to aggregate has led to significant difficulties in determining its biological relationship with other MMR-related proteins. Here, we perform analysis on the thermostable MutL protein found in Thermotoga maritima MSB8 (TmL). Size exclusion chromatographic analysis indicates the lack of aggregated forms with the exception of a dimeric TmL. Small-angle X-ray scattering (SAXS) analysis reveals that the solution structures of the full-length TmL and its corresponding complexes with nucleotides and ssDNA undergo conformational changes. The elucidated TmL SAXS model is superimposed to the crystal structure of the C-terminal domain of Escherichia coli MutL. In addition, the N-terminal SAXS model of TmL exists as monomeric form, indicating that TmL has a structurally flexible N-terminal domain. TmL SAXS analysis can suggest a considerable possibility on a new 3D view of the previously unresolved full-length MutL molecule.

Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.

A simple, direct method for the detection of DNA-protein interaction was developed with electrochemical methods. Single-stranded DNA (ss-DNA) probes were prepared through the chemical bonding of an oligonucleotide to a polymer film bearing carboxylic acid groups, and double-stranded DNA (ds-DNA) probes were prepared through hybridization of the complementary sequence DNA on the ss-DNA probe. Impedance spectroscopy and differential pulse voltammetry (DPV) distinguished the interaction between the DNA probes with mouse Purbeta (mPurbeta), an ss-DNA binding protein, and with Escherichia coli MutH, a ds-DNA binding protein. Impedance spectra obtained before and after the interaction of DNA probes with these proteins clearly showed the sequence-specific ss-DNA preference of mPurbeta and the sequence-specific ds-DNA preference of MutH. The concentration dependence of proteins on the response of the DNA probes was also investigated, and the detection limits of MutH and mPurbeta were 25 and 3 microg/ml, respectively. To confirm the impedance results, the variation of the current oxidation peak of adenine of the DNA probe was monitored with DPV. The formation constants of the complexes formed between the probe DNA and the proteins were estimated based on the DPV results.

Background Polymyxin B resistance protein D (PmrD) plays a key role in the polymyxin B-resistance pathway, as it is the signaling protein that can act as a specific connecter between PmrA/PmrB and PhoP/PhoQ. We conducted structural analysis to characterize Escherichia coli (E. coli) PmrD, which exhibits different features compared with PmrD in other bacteria. Results The X-ray crystal structure of E. coli PmrD was determined at a 2.00 Å resolution, revealing novel information such as the unambiguous secondary structures of the protein and the presence of a disulfide bond. Furthermore, various assays such as native gel electrophoresis, surface plasmon resonance (SPR), size-exclusion chromatography, dynamic light scattering (DLS), and small-angle X-ray scattering (SAXS) measurements, were performed to elucidate the structural and functional role of the internal disulfide bond in E. coli PmrD. Conclusions The structural characteristics of E. coli PmrD were clearly identified via diverse techniques. The findings help explain the different protective mechanism of E. coli compared to other Gram-negative bacteria. Electronic supplementary material The online version of this article (doi:10.1186/s12900-014-0024-y) contains supplementary material, which is available to authorized users.

The folding of aptamer immobilized on an Au electrode was successfully detected using label-free electrochemical methods. A thrombin binding DNA aptamer was used as a model system in the presence of various monovalent cations. Impedance spectra showed that the extent to which monovalent cations assist in folding of aptamer is ordered as K(+) > NH(4)(+) > Na(+) > Cs(+). Our XPS analysis also showed that K(+) and NH(4)(+) caused a conformational change of the aptamer in which it forms a stable complex with these monovalent ions. Impedance results for the interaction between aptamer and thrombin indicated that thrombin interacts more with folded aptamer than with unfolded aptamer. The EQCM technique provided a quantitative analysis of these results. In particular, the present impedance results showed that thrombin participates a folding of aptamer to some extent, and XPS analysis confirmed that thrombin stabilizes and induces the folding of aptamer.