Search

Background: There is no appropriate tool to predict recombinant human growth hormone (rhGH) response before therapy initiation in short-stature children in late puberty. The current study aimed to explore the associations between magnetic resonance imaging (MRI) stages of the knee growth plates and rhGH response in short-stature children in late puberty., Methods: In this prospective cohort study, short-stature children in late puberty were treated with rhGH and followed up for 6 months. We proposed a novel knee MRI staging system according to the growth plate states of distal femurs or proximal tibias and divided the participants into three groups: unclosed growth plate group, marginally closed growth plate group, and nearly closed growth plate group. The primary outcomes were height gain and growth velocity (GV), which were assessed three months later., Results: Fifty participants were enrolled, including 23 boys and 27 girls. GV and height gain after 6 months of rhGH therapy decreased successively in the three groups with an increased degree of growth plate fusion, especially when grouped by proximal tibias (GV 1-3 mon from 9.38 to 6.08 to 4.56 cm/year, GV 4-6 mon from 6.75 to 4.92 to 3.25 cm/year, and height gain from 4.03 to 2.75 to 1.95 cm, all P < 0.001). Moreover, the MRI stages of growth plates independently served as a significant variable for GV and height gain after therapy, especially when grouped by proximal tibias (all P < 0.01)., Conclusion: The MRI staging method is expected to be an effective tool for predicting rhGH response before therapy initiation in short-stature children in late puberty., (© 2023. The Author(s).)

Background: Endometrial fibrosis may cause infertility. Accurate evaluation of endometrial fibrosis helps clinicians to schedule timely therapy., Purpose: To explore T2 mapping for assessing endometrial fibrosis., Study Type: Prospective., Population: Ninety-seven women with severe endometrial fibrosis (SEF) and 21 patients with mild to moderate endometrial fibrosis (MMEF), diagnosed by hysteroscopy, and 37 healthy women., Field Strength/sequence: 3T, T2-weighted turbo spin echo (T2-weighted imaging) and multi-echo turbo spin echo (T2 mapping) sequences., Assessment: Endometrial MRI parameters (T2, thickness [ET], area [EA], and volume [EV]) were measured by N.Z. and Q.H. (9- and 4-years' experience in pelvic MRI) and compared between the three subgroups. A multivariable model including MRI parameters and clinical variables (including age and body mass index [BMI]) was developed to predict endometrial fibrosis assessed by hysteroscopy., Statistical Tests: Kruskal-Wallis; ANOVA; Spearman's correlation coefficient (rho); area under the receiver operating characteristic curve (AUC); binary logistic regression; intraclass correlation coefficient (ICC). P value <0.05 for statistical significance., Results: Endometrial T2, ET, EA, and EV of MMEF patients (185 msec, 8.2 mm, 168 mm 2 , and 2181 mm 3 ) and SEF patients (164 msec, 6.7 mm, 120 mm 2 , and 1762 mm 3 ) were significantly lower than those of healthy women (222 msec, 11.7 mm, 316 mm 2 , and 3960 mm 3 ). Endometrial T2 and ET of SEF patients were significantly lower than those of MMEF patients. Endometrial T2, ET, EA, and EV were significantly correlated to the degree of endometrial fibrosis (rho = -0.623, -0.695, -0.694, -0.595). There were significant strong correlations between ET, EA, and EV in healthy women and MMEF patients (rho = 0.850-0.908). Endometrial MRI parameters and the multivariable model accurately distinguished MMEF or SEF from normal endometrium (AUCs >0.800). Age, BMI, and MRI parameters in univariable analysis and age and T2 in multivariable analysis significantly predicted endometrial fibrosis. The reproducibility of MRI parameters was excellent (ICC, 0.859-0.980)., Data Conclusion: T2 mapping has potential to noninvasively and quantitatively evaluate the degree of endometrial fibrosis., Evidence Level: 2 Technical Efficacy: Stage 2., (© 2023 International Society for Magnetic Resonance in Medicine.)

Patients with comitant exotropia (CE) would usually develop compromised binocular vision and impaired stereoscopic depth perception, which could result in a profound decrease in quality of life. Although the deviated optic axis could be corrected surgically, the impaired stereovision and sensory eye balance may sometimes remain remnant. This study was to investigate the brain functional alterations in patients with CE before and after surgery, using resting-state functional magnetic resonance imaging (fMRI) with amplitude of low-frequency fluctuation (ALFF). Thirty-five patients with CE were recruited to undergo a preoperative fMRI scan, as well as 24 healthy controls (HCs). Twenty-four of the patients were available for rescanned fMRI one month after surgery. The ALFF method was used to evaluate the group differences of spontaneous brain activity. The correlations between ALFF values and clinical variables were analyzed in the patient group. Preoperatively, compared with HCs, 35 patients with CE showed significantly decreased ALFF values in one cluster involving bilateral calcarine sulcus, lingual gyrus and cuneus. The ALFF values in the above cluster were negatively correlated with disease duration (r = -0.379, P = 0.033). One month after surgery, 24 patients with available rescanned fMRI demonstrated increased ALFF values in one cluster located in bilateral cuneus, calcarine sulcus and lingual gyrus relative to the preoperative collection, while still reduced ALFF values in the cluster involving left calcarine sulcus and lingual gyrus compared with HCs. Our study revealed the functional changes of patients with CE in visual-associated brain areas before and after surgery. The findings may provide a new perspective for understanding the underlying pathological mechanisms of CE., Competing Interests: Declaration of competing interest The authors of this manuscript declare no relationships with any companies, whose products or services may be related to the subject matter of the article., (Copyright © 2022 Elsevier Ltd. All rights reserved.)

Objective: We proposed to determine whether the performance of inexperienced radiologists in determining extramural vascular invasion (EMVI) in rectal cancer on MRI can be promoted by means of targeted training., Methods: 230 rectal cancer patients who underwent pre-operative chemoradiotherapy were included. Pre-therapy and post-therapy MR images and pathology EMVI evaluation were available for cases. 230 cases were randomly divided into 150 training cases and 80 testing cases, including 40 testing case A and 40 testing case B. Four radiologists were included for MRI EMVI evaluation, who were divided into targeted training group and non-targeted training group. The two groups evaluated testing case A at baseline, 3 month and 6 month, evaluated testing case B at 6 month. The main outcome was agreement with expert-reference for pre-therapy and post-therapy evaluation, the other outcome was accuracy with pathology for post-therapy evaluation., Results: After 6 months of training, targeted training group showed statistically higher agreement with expert-reference than non-targeted training group for both pre-therapy and post-therapy MRI EMVI evaluation of testing case A and testing case B, all p < 0.05. Targeted training group also showed significantly higher accuracy with pathology than non-targeted training group for post-therapy evaluation of testing case A and testing case B after 6 months of training, all p < 0.05., Conclusion: The diagnostic performance for MRI EMVI evaluation could be promoted by targeted training for inexperienced radiologist., Advances in Knowledge: This study provided the first evidence that after 6 month targeted training, inexperienced radiologists demonstrated improved diagnostic performance, with a 20% increase in agreement with expert-reference for both pre-therapy and post-therapy MRI EMVI evaluation and also a 20% increase in or accuracy with pathology for post-therapy evaluation, while inexperienced radiologists could not gain obvious improvement in MRI EMVI evaluation through the same period of regular clinical practice. It indicated that targeted training may be necessary for helping inexperienced radiologist to acquire adequate experience for the MRI EMVI evaluation of rectal cancer, especially for radiologist who works in a medical unit where MRI EMVI diagnosis is uncommon.

Objectives: To investigate the feasibility and diagnostic value of free-breathing, radial, stack-of-stars three-dimensional (3D) gradient echo (GRE) sequence ("golden angle") on dynamic contrast-enhanced (DCE) MRI of gastric cancer., Methods: Forty-three gastric cancer patients were divided into cooperative and uncooperative groups. Respiratory fluctuation was observed using an abdominal respiratory gating sensor. Those who breath-held for more than 15 s were placed in the cooperative group and the remainder in the uncooperative group. The 3-T MRI scanning protocol included 3D GRE and conventional breath-hold VIBE (volume-interpolated breath-hold examination) sequences, comparing images quantitatively and qualitatively. DCE-MRI parameters from VIBE images of normal gastric wall and malignant lesions were compared., Results: For uncooperative patients, 3D GRE scored higher qualitatively, and had higher SNRs (signal-to-noise ratios) and CNRs (contrast-to-noise ratios) than conventional VIBE quantitatively. Though 3D GRE images scored lower in qualitative parameters compared with conventional VIBE for cooperative patients, it provided images with fewer artefacts. DCE parameters differed significantly between normal gastric wall and lesions, with higher Ve (extracellular volume) and lower Kep (reflux constant) in gastric cancer., Conclusions: The free-breathing, golden-angle, radial stack-of-stars 3D GRE technique is feasible for DCE-MRI of gastric cancer. Dynamic enhanced images can be used for quantitative analysis of this malignancy., Key Points: • Golden-angle radial stack-of-stars VIBE aids gastric cancer MRI diagnosis. • The 3D GRE technique is suitable for patients unable to suspend respiration. • Method scored higher in the qualitative evaluation for uncooperative patients. • The technique produced images with fewer artefacts than conventional VIBE sequence. • Dynamic enhanced images can be used for quantitative analysis of gastric cancer.

Purpose: To compare the diagnostic efficiency of digital breast tomosynthesis (DBT) plus digital mammography (DM) and magnetic resonance imaging (MRI) plus DM in symptomatic women., Materials and Methods: The protocol used in our study was accepted by the ethics committee at our hospital, and informed consent was obtained from all patients. Between June and December 2014, 197 patients with 238 histologically proven lesions all underwent DM, DBT and MRI. Two radiologists were responsible for interpreting all images according to the Breast Imaging Reporting and Data System (BI-RADS). The diagnostic performance of each method was assessed by receiver-operating characteristic (ROC) curve. The sensitivity, specificity, accuracy, positive predictive value (PPV) and negative predictive value (NPV) were compared using McNemar's test and Fisher's exact test. A Kappa test was used to assess the interobserver agreement., Results: The area under the ROC curve (AUC) was lower in the group that underwent DM alone (Radiologist1 [R1], 0.849; Radiologist2 [R2], 0.850) than in the group that underwent DBT plus DM (R1, 0.907, P = 0.0204; R2, 0.900, P = 0.0239) and MRI plus DM (R1, 0.939, P = 0.0006; R2, 0.935, P = 0.0009). However, the difference between the group that received DBT plus DM and the group that received MRI plus DM was not significant (R1, P = 0.1262; R2, P = 0.0843). The accuracy (R1, 71.8%; R2, 71.4%) and sensitivity (R1, 71.9%; R2, 71.2%) of DM were lower than those of DBT ((accuracy: R1, 85.3%, P = 0.001; R2, 83.6%, P < 0.001; sensitivity: R1,92.1%, P < 0.001; R2, 90.8%, P < 0.001) and MRI combined with DM (accuracy: R1, 90.3%, P = 0.001; R2, 90.7%, P < 0.001; sensitivity: R1, 94.7%, P < 0.001; R2, 95.4%, P < 0.001). In contrast, no significant difference was observed between DBT and MRI combined with DM (accuracy: R1, P = 0.644; R2, P = 0.360; sensitivity: R1, P = 0.502; R2, P = 0.359). The interobserver agreement of each method was excellent (k = 0.894 0.919 and 0.882 for DM, DBT and MRI combined with DM, respectively)., Conclusion: The diagnostic performance of DBT and MRI combined with DM is superior to that of DM alone in symptomatic women; MRI plus DM is slightly better than that of DBT plus DM, but this difference was not statistically significant.

Brain iron levels in patients of Parkinson's disease (PD) are usually measured in postmortem samples or by MRI imaging including R2* and SWI. In this study we performed a meta-analysis to understand PD-associated iron changes in various brain regions, and to evaluate the accuracy of MRI detections comparing with postmortem results. Databases including Medline, Web of Science, CENTRAL and Embase were searched up to 19 th November 2015. Ten brain regions were identified for analysis based on data extracted from thirty-three-articles. An increase in iron levels in substantia nigra of PD patients by postmortem, R2* or SWI measurements was observed. The postmortem and SWI measurements also suggested significant iron accumulation in putamen. Increased iron deposition was found in red nucleus as determined by both R2* and SWI, whereas no data were available in postmortem samples. Based on SWI, iron levels were increased significantly in the nucleus caudatus and globus pallidus. Of note, the analysis might be biased towards advanced disease and that the precise stage at which regions become involved could not be ascertained. Our analysis provides an overview of iron deposition in multiple brain regions of PD patients, and a comparison of outcomes from different methods detecting levels of iron.

Background: Intraductal papilloma (IDP) is the most common pathological finding in women with pathological nipple discharge. Magnetic resonance imaging (MRI) has shown potential for characterizing breast tumors; however, MRI findings of IDPs are inconclusive, and certain diagnostic standards are lacking., Purpose: To characterize the MRI features of IDP from a relatively large cohort., Material and Methods: We retrospectively reviewed from 358 women with IDPs that were confirmed by histopathology. The clinical and imaging findings in 70 patients who underwent preoperative MRI were analyzed. MRI analyses included morphology and dynamic contrast-enhanced MRI., Results: In 70 patients, 77 IDPs were detected on MRI, which revealed the following three patterns: small luminal mass papillomas; tumor-like papillomas; and MRI-occult papillomas. Fourteen IDPs involved small, oval, smooth, and contrast-enhanced masses at the posterior end of the enlarged duct corresponding to small luminal mass papillomas. Seven IDPs had large diameters along the direction of the breast duct, indicating the typical MRI findings for IDP. Of 47 tumor-like papillomas, 16 cases showed large diameters along the direction of the breast duct and close to the nipple (within 4 cm), seven cases resembled invasive breast cancer on MRI, and the remaining 24 were (24/47) undistinguishable from other benign breast diseases. Sixteen IDPs were MRI-occult papillomas that could not be distinguished from the surrounding benign disease by either contrast-enhanced MRI or fat-suppressed T2-weighted MRI., Conclusion: Small luminal mass papillomas or tumor-like papillomas with the largest diameters along the direction of the breast duct and close to the nipple (within 4 cm) might be the typical MRI findings for IDPs., (© The Foundation Acta Radiologica 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.)

Purpose: To characterize Xp11.2 translocation renal cell carcinoma (RCC) using magnetic resonance imaging (MRI) and computed tomography (CT)., Methods: This study retrospectively collected the MRI and CT data of twelve patients with Xp11.2 translocation RCC confirmed by pathology. Nine cases underwent dynamic contrast-enhanced MRI (DCE-MRI) and 6 cases underwent CT, of which 3 cases underwent MRI and CT simultaneously. The MRI and CT findings were analyzed in regard to tumor position, size, hemorrhagic, cystic or necrotic components, calcification, tumor density, signal intensity and enhancement features., Results: The age of the 12 patients ranged from 13 to 46 years (mean age: 23 years). T2WI revealed heterogeneous intensity, hyper-intensity, and slight hypo-intensity in 6 cases, 2 cases, and 1 case, respectively. On DCE-MR images, mild, moderate, and marked rim enhancement of the tumor in the corticomedullary phase (CMP) were observed in 1, 6, and 2 cases, respectively. The tumor parenchyma showed iso-attenuation (n = 4) or slight hyper-attenuation (n = 1) compared to the normal renal cortex on non-contrast CT images. Imaging findings were suggestive of hemorrhage (n = 4) or necrosis (n = 8) in the tumors, and there was evidence of calcification in 8 cases by CT (n = 3) and pathology (n = 8). On dynamic contrast-enhanced CT images, 3 cases and 1 case manifested moderate and strong CMP enhancement, respectively. Nine tumors by MRI and 4 tumors by CT showed prolonged enhancement. Three neoplasms presented at stage I, 2 at stage II, 3 at stage III, and 4 at stage IV according the 2010 AJCC staging criteria., Conclusions: XP11.2 translocation RCC should be considered when a child or young adult patient presents with a renal tumor with heterogeneous features such as hemorrhage, necrosis, cystic changes, and calcification on CT and MRI and/or is accompanied by metastatic evidence.

Objective: To study the value of dynamic contrast-enhanced magnetic resonance imaging (MRI) in evaluating the curative effect of high intensity focused ultrasound (HIFU) for hypersplenism., Methods: A retrospective analysis of dynamic contrast enhanced MRI data was conducted in 15 patients with hypersplenism before and after HIFU treatment to observe the signal changes and enhancement features of the lesions., Results: Compared with that before treatment, the signal intensity of the lesions after HIFU could be increased, reduced or remained unchanged on T(1)WI without specificity; on T(2)WI, the signal intensity of the lesions was reduced after HIFU treatment. Dynamic contrast-enhanced MRI showed larger ablation areas than those displayed by T(1)WI and T(2)WI, and no enhancement was found in the lesions., Conclusion: T(2)WI has a greater specificity in demonstrating coagulation necrosis of hypersplenism after HIFU ablation, and dynamic contrast-enhanced MRI has a higher sensitivity in displaying the ablation area by highlighting the blood supply and enhancement characteristics of the lesions. MRI is efficient and noninvasive in follow-up evaluation of the signal intensity as well as histological changes of the treated region after HIFU.

Objective: To explore the clinical and magnetic resonance imaging (MRI) findings of pituitary hyperplasia due to primary hypothyroidism., Method: The clinical presentations, laboratory examinations, and MRI findings of 11 patients with pituitary hyperplasia secondary to primary hypothyroidism diagnosed at our hospitals from the beginning of 2008 to the end of 2011 were retrospectively reviewed., Results: The clinical manifestations in 11 patients included growth arrest(7/8), mental retardation (6/8), cold intolerance and fatigue(6/11), slightly increased body weight (6/11), galactorrhea (3/11), paramenia (8/9), precocious puberty companying vaginal bleeding (2/2),and blurry vision (3/11). Laboratory investigations revealed grossly increased thyroid stimulating hormone, decreased thyroxine, and slightly elevated prolactin levels in all cases. Thyroid antibody was positive in six cases. On MRI, pituitary mass were detected a large intrasellar with/without suprasellar extension in all patients,showing the characteristic of symmetric enlargement. Spherical shape was viewed in 5 cases,with the height of (12.22 ± 3.12)mm. In the other 6 cases, the pituitary mass with the shape of calabash extended superiorly to suprasellar area, with a height of(18.95 ± 2.23)mm. The signal of pituitary mass was isointense to grey matter both on T1 weighted imaging and T2 weighted imaging. Bright short T1 signal in posterior lobe of pituitary was visible. Pituitary stalk was detected only in 4 cases from MRI without dislocation, while the width of pituitary stalk was within the normal limit., Conclusions: Pituitary hyperplasia should be considered when homogenous enlargement of the pituitary gland is found on MRI. The integration of MRI findings, clinical manifestations, and laboratory findings is helpful for the proper identification of the primary endocrine disease and thus avoid misdiagnosis.

Background and Purpose: Rosai-Dorfman disease (RDD) is a rare, lymphoproliferative disorder of uncertain etiology. The Central Nervous System (CNS) is a very rare site for RDD and only a few imaging appearances have been described. The purpose of this study is to present the largest series of cases in the CNS imaging literature to increase familiarity with this entity and further identify features that may distinguish RDD from meningioma., Materials and Methods: Findings from imaging examinations in 10 patients with pathologically confirmed RDD were retrospectively reviewed. Two radiologists evaluated the lesion location, shape, size, number, edge, cerebral edema, homogeneous or heterogeneous appearance, attenuation and signal intensity, degree of enhancement, and the relation between lesions and meninges., Results: RDD in CNS showed similar features in imaging: an extra-axial, well-circumscribed, dura-based mass, isodense or hyperdense on CT, isointensity on T1-weighted imaging and isointensity with hypointensity on T2-weighted imaging. The mass enhanced markedly and homogeneously after the administration of contrast agent and demonstrated dural tail sign in all cases. Significant perifocal edema was associated with the masses. Remarkably, seven patients (77.8%) showed strong hypointensity within isointensity on T2-weighted or FLAIR images and no calcification was observed in CT images or pathologic specimens., Conclusions: Although RDD in the CNS is a rare process, it should be considered in the differential diagnoses for meningioma. We believe that a typical representation of hypointensity irrelevant to calcification on T2-weighted or FLAIR images can suggest the diagnosis of RDD., (Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.)

Objectives During craniotomy for cerebellopontine angle (CPA) lesions, the exact exposure of the margin of the venous sinuses complex remains an essential but risky part of the procedure. Here, we revealed the exact position of the asterion and sinus complex by combining preoperative image information and intraoperative cranial landmarks, and analyzed their clinic-image relationship. Methods Ninety-four patients who underwent removal of vestibular schwannoma (VS) through retrosigmoid craniotomies were enrolled in the series. To determine the exact location of the sigmoid sinus and the transverse sinus and sigmoid sinus junction (TSSJ), we used preoperative images, such as computed tomography (CT) and/or magnetic resonance imaging (MRI) combined with intraoperative anatomical landmarks. The distance between the asterion and the sigmoid sinus was measured using MRI T1 sequences with gadolinium and/or the CT bone window. Results In 94 cases of retrosigmoid craniotomies, the asterion lay an average of 12.71 mm on the posterior to the body surface projection to the TSSJ. Intraoperative cranial surface landmarks were used in combination with preoperative image information to identify the distance from the asterion to the sigmoid sinus at the transverse sinus level, allowing for an appropriate initial burr hole (the margin of the TSSJ). Conclusion By combining intraoperative anatomical landmarks and preoperative image information, the margin of the TSSJ, in particular, the inferior margin of the transverse sinus, can be well and thoroughly identified in the retrosigmoid approach. [ABSTRACT FROM AUTHOR]

Backgrounds: Despite publication of international guidelines, there are notable controversial points of clinical target volume (CTV) delineation in nasopharyngeal carcinoma (NPC). Recently, scholars proposed a novel way of delineation of CTV in NPC—individualization of CTV delineation based on T classification and spread patterns, which yielded excellent long-term local control with limited late toxicities. The aim of this study was to clarify the anatomic patterns and pathways of local recurrence of NPC and provide a clinical reference for the delineation of CTV. Methods: A total of 869 patients with non-metastatic NPC were treated with intensity-modulated radiation therapy (IMRT) at our institution between 2009 and 2010. Among the 57 cases of local/locoregional recurrence, 52 cases with traceable radiotherapy plans and magnetic resonance imaging at the time of the first diagnosis of recurrence were included. Anatomical structures and gross tumor volume of local recurrence were contoured. The incidence of relapse of each anatomic structure, route of local recurrence, and their correlation were analyzed. Results: Locally advanced disease had a significantly increased risk of recurrence in the posterior nasal cavity and a trend towards higher risk of recurrence in the clivus, lateral pterygoid muscle, and hypoglossal canal. Based on the incidence of local recurrence, we constructed a high-risk map for the early and locally advanced stages. Local recurrences were classified into five routes, where anterior extension accounted for the majority (30.8%), and caudal tumor extension pathway had the lowest incidence (5.8%). There was a significant correlation between the local recurrences of neural foramina and neighboring anatomical structures along each pathway. All cases relapsed at unilateral cavernous sinus, most at the same side of primary tumor. Based on our findings, we proposed some suggestions on delineations of CTV, based on T classification and local extension pattern. Conclusions: Local recurrence of NPC varied according to T classification, followed a stepwise pattern, spread via neural foramina, and recurred at ipsilateral cavernous sinus. This provides meaningful clinical evidence for delineation of CTV, especially individualized delineation. [ABSTRACT FROM AUTHOR]

Objectives: This study aimed to assess the epidemiological features and explore the potential risk factors for early neurological deterioration (END) in patients with acute single small subcortical infarction (SSSI) who underwent antiplatelet therapy without carotid artery stenosis. Materials & methods: Patients with SSSI, as confirmed by cranial magnetic resonance imaging (MRI), who were hospitalized within 48 h after the onset of symptoms were enrolled. END was mainly defined as increment in the National Institutes of Health Stroke Scale (NIHSS) score of ≥ 2 points or any new neurological deficit. Poor functional outcome was defined as modified Rankin Scale (mRS) score of > 2 points at 3-month after the onset. The association of END with multiple indicators was assessed at the early stage of admission using multivariate logistic regression analysis, and adjusted odds ratios (aORs) were calculated. Results: A total of 280 patients were enrolled from June 2020 to May 2021, of whom, END occurred in 44 (15.7%) patients (median age, 64 years; 70.5% male), while END occurred during sleep in 28 (63.6%) patients. History of hypertension (aOR: 4.82, p = 0.001), infarction in internal capsule (aOR: 3.35, p = 0.001), and elevated level of low-density lipoprotein cholesterol (LDL-C; aOR: 0.036, p = 0.0016) were significantly associated with the risk of END. Patients with END (aOR: 5.74, p = 0.002), history of diabetes (aOR: 2.61, p = 0.020), and higher NIHSS scores at discharge (per 1-score increase, aOR: 1.29, p = 0.026) were associated with the poor functional outcome at 3-month after the onset. Conclusion: Patients with a history of hypertension, infarction in internal capsule or a higher level of LDL-C were found to be at a higher risk of END. [ABSTRACT FROM AUTHOR]

Background: Cushing's disease (CD) is rare in pediatric patients. It is characterized by elevated plasma adrenocorticotropic hormone (ACTH) from pituitary adenomas, with damage to multiple systems and development. In recent years, genetic studies have shed light on the etiology and several mutations have been identified in patients with CD. Case presentation: A girl presented at the age of 10 years and 9 months with facial plethora, hirsutism and acne. Her vision and eye movements were impaired. A quick weight gain and slow growth were also observed. Physical examination revealed central obesity, moon face, buffalo hump, supra-clavicular fat pads and bruising. Her plasma ACTH level ranged between 118 and 151 pg/ml, and sella enhanced MRI showed a giant pituitary tumor of 51.8 × 29.3 × 14.0 mm. Transsphenoidal pituitary debulk adenomectomy was performed and immunohistochemical staining confirmed an ACTH-secreting adenoma. Genetic analysis identified a novel germline GPR101 (p.G169R) and a somatic USP8 (p. S719del) mutation. They were hypothesized to impact tumor growth and function, respectively. Conclusions: We reported a rare case of pediatric giant pituitary ACTH adenoma and pointed out that unusual concurrent mutations might contribute to its early onset and large volume. [ABSTRACT FROM AUTHOR]

Objective: To investigate the efficiency of pre-therapy magnetic resonance imaging (MRI) features in predicting the prognosis of desmoid-type fibromatosis patients treated with imatinib. Materials and Methods: A total of 38 desmoid-type fibromatosis patients treated with imatinib were collected in this retrospective study. The high signal intensity on pre-therapy MRI was evaluated on axial T2 and T1 contrast-enhanced sequences with fat suppression. Cox regression and Kaplan–Meier analyses explored the correlation between clinical or radiographic characteristics and progression-free survival (PFS). Results: Hyperintense T1 contrast enhancement (CE) proportion (≥ 75%) was identified as an independent predictor for PFS. Patients with hyperintense T1 CE proportion <75% demonstrated no progression, while patients with hyperintense T1 CE proportion ≥75% demonstrated a progression rate of 78.4%. Conclusion: Hyperintense T1 CE proportion in the tumor is a potential predictor of disease progression in patients with desmoid-type fibromatosis treated with imatinib. Hyperintense T1 CE proportion <75% indicates progression-free during treatment. [ABSTRACT FROM AUTHOR]

Rationale and Objectives: To investigate whether multiparametric cardiac magnetic resonance (CMR) could detect and monitor inflammatory myocardial alterations in fulminant myocarditis.Materials and Methods: Nineteen patients (35 ± 14 years, 37% male) with clinical diagnosis of fulminant myocarditis underwent CMR examinations at 3.0T in the acute phase and at 3-months follow up. The control group consisted of 19 healthy volunteers. The CMR protocol included cine, black blood T2-weighted imaging, T1 mapping, T2 mapping and late gadolinium enhancement (LGE). Cardiac parameters, such as edema ratio, LGE mass, native T1, T2 and extracellular volume were measured.Results: The left ventricular mass index (67 ± 15 versus 55 ± 12 g/m2, p < 0.05) and interventricular septum thickness (10.4 ± 1.5 versus 8.3 ± 1.8 mm, p < 0.001) in acute stage was significantly higher compared to controls, and normalized at the chronic stage. All quantitative inflammation metrics, including edema ratio, LGE mass, native T1, T2 and extracellular volume were significantly (all p < 0.001) decreased in the follow-up scan, but still higher compared to controls. Compared to the controls, all global strain indices including circumferential, longitudinal and radial strain values were significantly impaired in acute stage (all p < 0.001). Native T1 and T2 values led to excellent diagnostic accuracy for discriminating fulminant myocarditis from healed myocarditis, with AUC of 0.947 and 0.931.Conclusion: Multiparametric CMR could detect and monitor inflammation myocardial injuries in patients with fulminant myocarditis. Native T1 and T2 values achieved excellent diagnostic performance in distinguishing acute from healed myocarditis. [ABSTRACT FROM AUTHOR]

This study aimed to establish a specified magnetic resonance imaging (MRI) signal and size criterion for assessing the response of desmoid-type fibromatosis (DF). This retrospective study included 129 patients with DF who received non-surgical therapy. All patients underwent pretreatment and 6-month-interval follow-up MRI for >3 years (6 follow-up visits). The correlation between signal grade and size was determined. Signal grade and size among three response groups (partial response [PR], stable disease [SD], progression disease [PD]) were compared. The specified signal and size criterion was established, used to assess tumour response at each follow-up, and compared with the reference. The Response Evaluation Criteria in Solid Tumours (RECIST)1.1 criterion at the end of the 3rd year was considered the reference. MRI signals were moderately correlated with size changes (r = −0.56 and −0.41 for T2 grade and contrast-enhanced T1 grade, respectively). Changes in T2 grade and size in the three response groups were significantly different (all p < 0.01). The signal and size criterion accurately predicted 95% of PR patients at 2nd follow-up and 81.2% of PD patients at the 3rd follow-up, while only 13.1% of PR and 56.3% of PD patients were predicted by RECIST1.1. However, the accuracy of the signal & size criterion for predicting SD was lower than that of RECIST1.1. MRI signal is useful in assessing the response of DF. Signal & size criterion can identify patients with PR and PD earlier than RECIST1.1. • MRI signal correlated moderately with size changes. • MRI signal and size criterion for assessing tumour response of DF was established. • Signal & size criterion can identify PR and PD patients at early follow-ups. [ABSTRACT FROM AUTHOR]

Background: The clinical value of novel mapping techniques and strain measures to assess myocardial inflammation in fulminant myocarditis (FM) has not been fully explored.Purpose: To evaluate the ability of mapping and strain cardiac MRI to assess myocardial inflammation in patients with FM, and to which degree the strain metrics correlate with myocardial edema.Study Type: Prospective.Population: Twenty-nine patients (37 ± 16 years, 48% male) with FM and 29 patients with nonfulminant acute myocarditis (NFAM) (29 ± 14 years, 69% male).Field Strength/sequence: 3.0T; Cine imaging, black blood T2 -weighted imaging, T1 mapping, T2 mapping, and late gadolinium enhancement.Assessment: Native T1 , extracellular volume (ECV), and T2 were measured. Myocardial strain was evaluated by feature tracking.Statistical Tests: Student's t- or Mann-Whitney U-test. Spearman correlation analysis.Results: The myocardial edema rate (2.6 ± 0.7 vs. 1.6 ± 0.2, P < 0.001) and late gadolinium enhancement (LGE) mass (16.5 [11.7, 41.7] vs. 6.9 [2.2, 15.8] g, P < 0.001) were significantly increased in FM patients when compared to the NFAM group. LGE in the FM group was predominantly located in the septal wall, and 38% of the patients showed a diffuse LGE pattern. Native T1 , ECV, and T2 values in the FM group were significantly more elevated than those with NFAM, while global peak radial, circumferential, and longitudinal strain values were significantly reduced (all P < 0.001). Circumferential strain showed the strongest correlations with ECV (r = 0.72, P < 0.001).Data Conclusion: Patients with FM showed significant differences in LGE patterns, increased edema, and decreased strain measurements compared to those with NFAM. Circumferential strain showed significant associations with quantitative cardiac MRI parameters of myocardial inflammation.Level Of Evidence: 2 TECHNICAL EFFICACY STAGE: 2 J. Magn. Reson. Imaging 2020;52:930-938. [ABSTRACT FROM AUTHOR]

Objective To summarize the clinical characteristics of Langerhans cell histiocytosis (LCH) in sellar region, to explore the indication and safety of pathological biopsy in sellar region. Methods and Results Eight patients with LCH who underwent biopsy by endoscopic transsphenoidal approach from November 2011 to November 2019 were retrospectively analyzed. The ratio of male to female was 1 : 1. The median age of 8 patients was 15.50 years old. All patients had central diabetes insipidus as the inaugural manifestation, and 7 patients had hypothalamus-related symptoms. Lesions in 7 patients involved the pituitary stalk, and in 5 patients involved the intrasellar region. The most common site of involvement was both intrasellar region and pituitary stalk (3 patients), followed by both pituitary stalk and hypothalamus (2 patients). MRI showed isointensity (8 cases) on T1WI, isointensity (6 cases), hypointensity (one case) and heterogeneous intensity (one case) on T2WI, while 6 with homogeneous enhancement and 2 with heterogeneous enhancement. The hyperintensity on T1WI of posterior pituitary was absent in all patients. The posterior pituitary bright spot was absent in all patients. Only one patient had a transient hypothalamic dysfunction after operation. None patient had cerebrospinal fluid leakage, central nervous system infection, unplanned secondary operation, death and other adverse events within one month after operation. Conclusions There were no specific clinical manifestations for LCH in sellar region, and this disease should be considered to differentiate from pituitary adenomas, germ cell tumor and lymphocytic hypophysitis. Biopsy was considered as "gold standard" for diagnosis. And biopsy by endoscopic transsphenoidal approach was a safe and reliable way for confirmation. [ABSTRACT FROM AUTHOR]

Rationale and Objectives: To evaluate the value of texture analysis on preoperative magnetic resonance imaging (MRI) for identifying nonfunctional pancreatic neuroendocrine neoplasms (NF-PNENs) and solid pseudopapillary neoplasms (SPNs).Materials and Methods: This retrospective study included 119 patients who underwent MRI, including T2-weighted imaging with fat-suppression, diffusion-weighted imaging (DWI), apparent diffusion coefficient, precontrast T1-weighted imaging with fat-suppression (T1WI+fs), and dynamic contrast-enhanced (DCE)-T1WI+fs. Raw data analysis, principal component analysis, linear discriminant analysis, and nonlinear discriminant analysis (NDA) were used to classify NF-PNENs and SPNs. The results are reported as misclassification rates. The images were simultaneously evaluated by an experienced senior radiologist without knowledge of the pathological results. The misclassification rate of the radiologist was compared to the MaZda (texture analysis software) results. Neural network classifier testing was used for validation. In addition, 30 textures for each MRI sequence were investigated.Results: The misclassification rate of NDA was lower than that of other analyses. In NDA, DWI obtained the lowest value of 7.92%, but there was no significant difference among the sequences. The misclassification rate of the radiologist (34.65%) was significantly higher than that of NDA for all sequences. The validation results were good in the arterial phase and delayed phase. In the training set, entropy and sum entropy were optimal texture features on DWI and precontrast T1WI+fs, while the mean and percentile seemed to be the more discriminative features on DCE-T1WI+fs.Conclusion: Texture analysis can sensitively distinguish between NF-PNENs and SPNs on MRI, and percentile and mean of DCE-T1WI+fs images were informative for differentiation of neoplasms. [ABSTRACT FROM AUTHOR]

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type II patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type II. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type II, and his family was diagnosed as Alexander's disease type II pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. [ABSTRACT FROM AUTHOR]

Objective: Cerebral small vessel disease (CSVD) describes a syndrome of neuroimaging, pathological, and associated clinical features caused by small intracranial vascular lesions, which commonly coexists with large artery atherosclerosis (LAA) and has been identified as a major cause of motor impairment over time. In this review, we aim to summarize the relationship between CSVD and LAA, and discuss the effects of CSVD on the clinical outcome of patients with ischemic stroke caused by LAA. Methods: We searched and scanned all the literature with the keyword cerebral small vessel disease, cerebral microbleeds, white matter hyperintensity, silent lacunar infarcts, enlarged perivascular spaces and stroke in the database of Pubmed and MEDLINE (from inception to 1 February 2015). Results: Various imaging phenotypes of CSVDs have different influences on the clinical outcome of patients with LAA stroke. The total brain burden of CSVD can represent the cumulative effects of different MRI features of CSVD, which has predictive value for recurrent stroke after ischemic stroke. Better quantification of the total brain burden of CSVD may help stratify patients more effectively in clinical practice. Discussion: CSVD can significantly influence the clinical outcome of stroke in patients with cerebral infarction caused by LAA, and the methods to capture whole brain CSVD burden cross the spectrum of changes in CSVD imaging features may be useful for patient stratification in clinical trials. Further studies should be performed to validate the relationship between CSVD related brain damage and LAA stroke. [ABSTRACT FROM AUTHOR]

Objective: To elucidate the relationship between copy number variations (CNVs) detected by high-resolution chromosomal microarray analysis (CMA) and the type of prenatal posterior fossa anomalies (PFAs), especially cerebellar hypoplasia (CH).Methods: This study involved 77 pregnancies with PFAs who underwent CMA.Results: Chromosomal aberrations including pathogenic CNVs and variants of unknown significance were detected in 31.2% (24/77) of all cases by CMA and in 18.5% (12/65) in fetuses with normal karyotypes. The high detection rate of clinically significant CNVs was evident in fetuses with cerebellar hypoplasia (54.6%, 6/11), vermis hypoplasia (33.3%, 1/3), and Dandy-Walker malformation (25.0%, 3/12). Compare with fetuses without other anomalies, cases with CH and additional malformations had the higher CMA detection rate (33.3% vs 88.9%). Three cases of isolated unilateral CH with intact vermis and normal CMA result had normal outcomes. The deletion of 5p15, 6q terminal deletion, and X chromosome aberrations were the most frequent genetic defects associated with cerebellar hypoplasia.Conclusion: Among fetuses with PFA, those with cerebellar hypoplasia, vermis hypoplasia, or Dandy-Walker malformation are at the highest risk of clinically significant CNVs. Chromosomal microarray analysis revealed the most frequent chromosomal aberrations associated with CH. [ABSTRACT FROM AUTHOR]

Background: The clinical presentation of congenital portosystemic shunt is variable and gastrointestinal bleeding is an uncommon presentation.Objective: To describe the imaging features of congenital portosystemic shunt as it presented in 11 children with (n = 6) and without gastrointestinal bleeding (n = 5).Materials and Methods: We performed a retrospective study on a clinical and imaging dataset of 11 children diagnosed with congenital portosystemic shunt.Results: A total of 11 children with congenital portosystemic shunt were included in this study, 7 with extrahepatic portosystemic shunts and 4 with intrahepatic portosystemic shunts. Six patients with gastrointestinal bleeding had an extrahepatic portosystemic shunt, and the imaging results showed that the shunts originated from the splenomesenteric junction (n = 5) or splenic vein (n = 1) and connected to the internal iliac vein. Among the five cases of congenital portosystemic shunt without gastrointestinal bleeding, one case was an extrahepatic portosystemic shunt and the other four were intrahepatic portosystemic shunts.Conclusion: Most congenital portosystemic shunt patients with gastrointestinal bleeding had a shunt that drained portal blood into the iliac vein via an inferior mesenteric vein. This type of shunt was uncommon, but the concomitant rate of gastrointestinal bleeding with this type of shunt was high. [ABSTRACT FROM AUTHOR]

To investigate the safety and efficacy of high-intensity focused ultrasound (HIFU) ablation combined with pharmacogenomic-guided chemotherapy in treating patients with advanced pancreatic cancer (PC). Thirty-one patients with unresectable PC (stage III 17, stage IV 14) were enrolled in this study. The patients were divided into group A (pharmacogenomic-guided chemotherapy following HIFU treatment, n = 13) and group B (traditional chemotherapy following HIFU treatment, n = 18). Contrast-enhanced computed tomography and magnetic resonance imaging were used to evaluate tumor response. Pain intensity was assessed using the numerical rating scale. The Kaplan–Meier method and log-rank test were used to analyze survival. The mean pain intensity score in 18 patients decreased from 6.6 ± 2.2 before HIFU to 3.3 ± 1.0 after HIFU (p = 0.000). The mean duration of pain relief was 5.2 ± 3.2 mo in group A and 2.4 ± 1.3 mo in group B (p = 0.026). There was no significant difference of the non-perfused volume ratio (83.5% ± 22.3% in group A and 85.3% ± 16.8% in group B) between the two groups. The median survival time was 14 mo in group A and 5 mo in group B. The 6 and 12-mo survival rates were 74.1% and 59.3% in group A, and 32.4% and 19.4% in group B, respectively. The difference in survival between the two groups was significant (p = 0.04). No severe complications (≥grade 3) related to HIFU were observed. Bone marrow depression was the main adverse reaction related to chemotherapy, with grade 3 bone marrow depression observed 2 (15.4%) patients in group A and 7 (38.9%) patients in group B. HIFU combined with pharmacogenomic-guided chemotherapy is safe and effective in treating patients with advanced PC. It provides better clinical outcomes in pain relief, quality of life and survival benefits for patients with advanced PC compared to HIFU combined with traditional chemotherapy. This combined approach may have the potential to become an important supplement to the treatment of advanced PC. [ABSTRACT FROM AUTHOR]

Objectives: Fine needle aspiration (FNA) is a cost-effective and rapid method to diagnose salivary gland neoplasms. Histological changes secondary to FNA are usually mild and focal, with only rare cases of complete tumor necrosis reported. We report a case of a low-grade carcinoma ex-pleomorphic adenoma (CXPA) with diffuse post FNA reactive changes. Low-grade CXPA is a rare malignancy that can be difficult to diagnose; the post FNA changes makes the diagnosis even more challenging. Methods: The patient was a 46-year-old man with a right parotid mass of 3 years' duration. CT scan showed a well-circumscribed 3.9 cm mass in the superficial lobe. FNA demonstrated cytomorphologic features typical for pleomorphic adenoma, with ductal epithelium, myoepithelial cells, and chondromyxoid stroma. Subsequently he underwent right parotidectomy eight days after FNA. Results: Gross examination showed a 5.5 cm well-circumscribed mass with heterogeneous cut surface. Microscopically, tumor composed of cells forming ducts with islands of squamous differentiation and focal chondromyxoid stroma. Necrotic areas associated with focal atypia and increased mitosis was present. Capsule showed diffuse edema, lymphocytic infiltrates, and extensive fibroblastic proliferation. Surrounding salivary gland tissue demonstrated diffuse acinar atrophy and ductal proliferation. Careful inspection of capsule showed several foci with extension of tumor beyond fibrous capsule, invading into normal salivary glands. The area of extension beyond capsule measured <1.5 mm in largest focus. Diffuse reactive/reparative changes made the assessment and measurement of invasion difficult. After multiple intra- and inter-departmental discussions, a diagnosis of low-grade salivary mixed neoplasm consistent with CXPA minimally invasive was made. Conclusion: In our case, diffuse reactive changes secondary to prior FNA made the diagnosis difficult. The short interval between FNA and surgery might explain these changes. We propose that a longer interval between FNA and surgery is more appropriate to prevent false positive/negative diagnosis as a result of reactive changes. [ABSTRACT FROM AUTHOR]

Abstract: High-intensity focused ultrasound (HIFU) is a noninvasive method that can cause complete coagulation necrosis without requiring the insertion of any instruments. The purpose of this study was to evaluate the safety and efficacy of HIFU treatment for small liver cancers without performing transcatheter arterial chemoembolization (TACE) or rib resection. HIFU ablation was performed without rib resection or the aid of TACE or percutaneous ethanol injection (PEI) in 12 patients with hepatocelullar carcinoma. The HIFU system (Chongqing Haifu Tech, Chongqing, China) was used under ultrasound guidance. All 12 patients completed the treatment without experiencing any adverse events. Complete coagulation was achieved by applying the sonications from the intercostal space when the tumor was located in the right lobe. After treatment, serum alanine aminotransferase (ALT) and serum aspartate aminotransferase (AST) levels were significantly higher than the baseline values; these levels recovered within 1 week. C-reactive protein (CRP) levels increased 1 week after treatment but decreased within 1 month. An epidural anesthetic provided sufficient pain suppression during the procedure. Edema of the subcutaneous tissue was detected in five cases, but the edema disappeared within 1 month. None of the patients developed acute hepatic failure, liver abscess or renal dysfunction. In conclusion, HIFU is effective for the treatment of patients with small liver cancer. [Copyright &y& Elsevier]