Clinical and gene mutation analysis on Alexander's disease type II caused by a novel GFAP mutation.

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type II patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type II. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type II, and his family was diagnosed as Alexander's disease type II pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. [ABSTRACT FROM AUTHOR]