Search

Background Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α‐thalassemia and two novel cases of β‐thalassemia caused by five different mutations in the globin gene. Methods Next‐generation sequencing (NGS) was used to identify novel α‐ and β‐thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. Results NGS revealed five novel cases of α‐ and β‐thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α‐globin mRNA were analyzed. Conclusion Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population., In this study, we identified five novel mutations in the five families: HBA2:c.245C>T, HBA2:c.54delC, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for the isoelectric point, amino acid conservation, and pathogenicity of the missense mutation.

Decades-old findings supporting origin of F cells in adult life from adult-type progenitors and the in vitro and in vivo enhancement of fetal globin under stress conditions have been juxtaposed against recent mechanistic underpinnings. An updated molecular interrogation did not debunk prior conclusions on the origin of F cells. Although fetal globin reactivation by widely diverse approaches in vitro and in response to anemic stresses in vivo is a work in progress, accumulating evidence converges toward an integrated stress response pathway. The newly uncovered developmental regulators of globin gene switching not only have provided answers to the long-awaited quest of transregulation of switching, they are also reaching a clinical threshold. Although the effect of fetal globin silencers has been robustly validated in adult cells, the response of cells at earlier developmental stages has been unclear and inadequately studied.

The ancient origins and functional versatility of globins make them ideal subjects for studying physiological adaptation to environmental change. Our goals in this review are to describe the evolution of the vertebrate globin gene superfamily and to explore the structure/function relationships of hemoglobin, myoglobin, neuroglobin and cytoglobin in teleost fishes. We focus on the globins of Antarctic notothenioids, emphasizing their adaptive features as inferred from comparisons with human proteins. We dedicate this review to Guido di Prisco, our co-author, colleague, friend, and husband of C.V. Ever thoughtful, creative, and enthusiastic, Guido spearheaded study of the structure, function, and evolution of the hemoglobins of polar fishes - this review is testimony to his wide-ranging contributions. Throughout his career, Guido inspired younger scientists to embrace polar biological research, and he challenged researchers of all ages to explore evolutionary adaptation in the context of global climate change. Beyond his scientific contributions, we will miss his warmth, his culture, and his great intellect. Guido has left an outstanding legacy, one that will continue to inspire us and our research.

Hemoglobinopathies are a heterogeneous group of inherited disorders resulting from mutations in the globin genes. Transmission is autosomal. There are 2 main types of hemoglobinopathies, one of which comprises disorders of decreased or absent production of a globin gene. These disorders are known as thalassemias. Structural abnormalities resulting from single amino acid substitutions comprise the second group of hemoglobinopathies. Although delineated by quantitative and qualitative characteristics, they are not mutually exclusive. Thalassemias can have qualitative defects, whereas other structural abnormalities may have quantitative defects. Collectively, they are one of the most common causes of nonimmune hemolytic anemias with various frequencies distributed throughout the world.

Sickle cell disease and β-thalassemia are well-known genetic disorders which are caused by mutations in β-globin gene. Reactivation of fetal hemoglobin in adulthood through induction of γ-globin gene expression has proven be sufficient to ameliorate sickle cell disease and β-thalassemia. In the last few decades, substantial efforts have been made to identify potential target candidates for β-globin diseases. In the present work, we propose an innovative approach for identifying novel molecular targets of β-globin diseases. Our approach is based on quantitative modeling of fetal-to-adult hemoglobin switching network with hybrid functional Petri nets. We verify the coherence of deterministic quantitative model created in this research to be sure it is consistent with qPCR data available for known siRNA- and shRNA-based strategies. Comparison of simulation results for the proposed strategy with the ones obtained for already existing RNAi-mediated treatments shows that our strategy is optimal, as it leads to the highest level of γ-globin induction. Consequently, it has potential beneficial therapeutic effect on β-globin diseases. This study also provides an innovative strategy for the target-based treatment of many other diseases. The file in this item is the post-print version of the article (author’s copy; author’s final manuscript, accepted for publication after peer-review process). Due to copyright restrictions, the access to the publisher version (published version) of this article is only available via subscription. You may click URI and have access to the Publisher Version of this article through the publisher web site or online databases, if your Library or institution has subscription to the related journal or publication.

The delineation of the beta-globin locus control region has led to a new understanding of the developmental regulation of the beta-globin gene cluster. It now seems that globin gene switching is effected through the sequential and mutually exclusive interaction of the locus control region with the embryonic, fetal and adult stage specific globin genes.

The hemoglobin (Hb) lepore-Boston is a beta-globin structural variant, produced in a reduced amount and formed from the fusion of N-terminus delta-(residues 1-87) and C-terminus beta-chains (residues 116-146). This type of fusion protein is quite common in Southern Italy (Campania, Calabria, and Sicily). We report here the hematological and hemoglobin data on 96 unrelated Sicilians with Hb lepore trait. Particularly interesting are the subjects where Hb lepore occurs with Hb S or Sicilian type delta beta-thalassemia. In these individuals, striking features are clinical variability and different hematological pictures. These observations underscore the importance of thalassemia screening in these geographic areas, such as Southern Italy, principally Sicily, where the mutations in globin gene clusters are especially prevalent. Moreover, as from the second half of the last century, owing to high migratory flux from Sicily to Northern Europe, North and South America, and Australia, the Hb lepore, as well as other hemoglobin variants, have become prevalent, making the identification of the heterozygotes a problem of general interest.

The thalassaemias are the commonest monogenic disorders in the world population. They occur at a particularly high frequency in Mediterranean regions and Southeast Asia, which cause a massive public health problem. In Hong Kong, the prevalence of heterozygous carriers of α or β thalassaemia mutations is approximately 8% [1]. Thalassaemia is characterized by the reduced synthesis of one or more normal globin chains. This causes globin chain imbalance and finally leads to hypochromic microcytic anaemia. Different types of thalassaemia are named according to the under-produced chains. The majority of thalassaemia can be diagnosed by basic haematologic profiles and simple phenotypic techniques. However, in some cases of thalassaemia the diagnosis are not apparent after routine laboratory investigations. To arrive at a diagnosis which is important for antenatal diagnosis and genetic counseling, it is necessary to use molecular approaches. In this study, 25 patients with microcytosis, normal phenotypic haemoglobin study results and without iron deficiency were analyzed retrospectively. This cohort of patients was suspected to have occult or masked thalassaemia. DNA was extracted from archive samples and further investigated by alpha multiplex gap polymerase chain reaction (α multiplex gap-PCR), alpha amplification refractory mutation system (α ARMS) and direct nucleotide sequencing of globin genes for the detection of possible underlying globin gene mutations. Results indicated that 60% of these cases with microcytosis were occult and silent αthalassaemia caused by deletional or non-deletional mutations. Maskedβthalassaemia due to co-existing δ thalassaemia or variants or normal Hb A2 β thalassaemia due to mild β globin gene mutations were not detected in the cohort. Forty percent of these cases of microcytosis remained unexplained, which await further molecular testing.

Induction of murine erythroleukemia (MEL) cell differentiation is accompanied by transcriptional activation of globin genes and biosynthesis of hemoglobin. In this study, we observed cytoplasmic accumulation of relatively small RNAs of different size (150–600 nt) hybridized to α 1 and β major globin DNA probes in MEL cells blocked to differentiate by hypomethylating agents (neplanocin A, 3-deazaneplanocin A and cycloleucine). These RNAs lack poly(A) tail and appear to be quite stable. Search within the 3′-end flanking sequences of β major globin gene revealed the presence of a B1 repeat element, several ATG initiation codons, a GATA-1 consensus sequence and sequences recognized by AP-1/NF-E2 and erythroid Kruppel-like factor (EKLF) transcription factors. These data taken together indicate that exposure of MEL cells to hypomethylating agents promotes accumulation of relatively small discrete RNA transcripts lacking poly(A) tail regardless of the presence or absence of inducer dimethylsulfoxide (DMSO). However, the relative steady-state level of small RNAs was comparatively higher in cells co-exposed to inducer and each one of the hypomethylating agents. Although the orientation of these RNAs has not been established as yet, the possibility these small poly(A) − RNAs which are induced by hypomethylating agents may be involved in the blockade of MEL cell differentiation program is discussed.

Two new δ-globin gene mutations have been detected: one leads to a fairly stable Hb A2 variant differing electrophoretically only minimally from normal Hb A2, and the second causes a δ+-thalassemia (thal) phenotype.

Hemoglobin switching is a complex process by which distinct globin chains are produced during stages of development. In an effort to characterize the process of hemoglobin switching in the zebrafish model system, we have isolated and characterized several embryonic globin genes. The embryonic and adult globin genes are found in clusters in a head-to-head configuration. One cluster of embryonic and adult genes is localized to linkage group 3, whereas another embryonic cluster is localized on linkage group 12. Several embryonic globin genes demonstrate an erythroid-specific pattern of expression early during embryogenesis and later are downregulated as definitive hematopoiesis occurs. We utilized electrospray mass spectroscopy to correlate globin genes and protein expression in developing embryonic red cells. The mutation, zinfandel, has a hypochromic microcytic anemia as an embryo, but later recovers in adulthood. The zinfandel gene maps to linkage group 3 near the major globin gene locus, strongly suggesting that zinfandel represents an embryonic globin defect. Our studies are the first to systematically evaluate the embryonic globins in the zebrafish and will ultimately be useful in evaluating zebrafish mutants with defects in hemoglobin production and switching. © 2003 Elsevier Science (USA). All rights reserved.

Four novel alleles of the adult β-globin gene of Capra hircus were observed in an extended study on hemoglobin polymorphism in goat breeds living in the island of Sardinia. Nucleotide sequencing showed that one of these alleles is due to a 2 bp substitution at codon 125 ( $$\underline {CT} \to \underline {GA} G,$$ G, "Leu→Glu). Two substitutions, the silent CT $$\underline T \to CT\underline C $$ for Leu at codon 78 and the conservative A $$\underline A G \to A\underline G $$ G (Lys →Arg) at codon 104, are shared by the other three alleles, two of them having additional mutations, which suggests a common origin. The allele we provisionally called the β Y shares four out of five amino acid substitutions, together with the same polymorphisms in the IVSII, we observed previously in the rather common β E gene. This evidence allowed the origin of the β E gene to be better characterized. The data increase to seven the number of alleles at the goat β A -globin locus characterized thus far at the molecular level. A simplified nomenclature for the increasing number of goat β-globin alleles is presented.

Recent advances in the study of globin gene switching in the context of the complete locus have contributed greatly to our understanding of the mechanisms of developmental regulation. It has become clear that the interactions between the distant locus control region and the individual globin genes, as well as the trans-acting factors and physical parameters that affect these interactions, are crucial determinants in the developmental modulation of globin gene expression. This review concentrates on recent advances in the highly studied human beta-globin locus and will compare and contrast data from the human alpha-globin locus as well as the alpha and beta loci from other species where appropriate.

This research, conducted on 1495 couples in preconceptional period, demonstrates how the study of globular resistance of erythrocytes (GRO) is not a first choice test and not useful as other more accurate tests to identify subjects with β-thalassemia trait. Instead, the complete blood count (CBC) and the evaluation of HbA, HbA2 and HbF by high pressure liquid chromatography (HPLC) are essential.Each couple arrived in our laboratory to screen for β thalassemia. In case of patients with positive (240) or doubtful (112) results, we studied β-globin gene.Of the 2990 subjects examined, we found 280 subjects with β-thalassemia trait (9.36%). During biochemical tests, among 112 subjects with doubtful--normal GRO or altered GRO--results, 40 of them resulted positive for the molecular analysis, while 72 of them did not show mutations in β-globin genes. The 2710 samples with non-carriers of β-thalassemia trait presented as mean evaluation of HbA2 2.6%, while the 280 subjects with β-thalassemia trait presented as mean evaluation of HbA2 4.8%. Molecular study showed that the β thalassemia phenotype is caused by a small number of mutations, whose regional distribution is typical.In the presence of thalassemic parameters in the CBC, the accurate and precise quantification of hemoglobin HbA2 is essential for the diagnosis of β-thalassemia trait. DNA mutation analysis provides the most effective way to detect primary gene mutations. The mutations identified in this work can be identified with a simple and inexpensive kit. This means, in economic terms, a significant savings for health spending.

Study of globin gene regulation has served as a useful paradigm for cell-specific and developmental control of transcription in higher eukaryotic cells. Recent work directed toward the identification and characterization of the cis-regulatory elements and transcription factors important for both aspects of control is reviewed. Particular emphasis is placed on the organization and function of globin locus control regions, mechanisms of switching of globin gene expression during development, and functions of the major erythroid-specific nuclear regulatory proteins.

High-level production of hunan α - and β -globins in cultured Spodoptera frugiperda (Sf-9) cells infected with recombinant baculoviruses is described. The expressed globins are produced to 70–140 mg protein/liter of cell culture or 5–10% of the total cellular protein. Two recombinant baculoviruses for α -globin, H α and H βα , differ in their construction in that the 5′-untranslated region of the β -globin gene is inserted 5′ to the α -globin mRNA coding region in H βα . This insertion results in a 40% increase in yield of α -globin over that of H α . Consistent with previous observations of the processing of recombinant proteins in Sf-9 cells, both α - and β -globins expressed in Sf-9 cells are correctly processed to remove the initiating methionine from the amino termini of the globins. Sequencing of the expressed globins in Sf-9 cells confirms their identity with globins purified from human normal adult hemoglobin.

The ratio of fetal hemoglobin to total hemoglobin (%Hb F), the ratio of Gγ to total γ globin (%Gγ), and the polymorphism of the Xmn I site at –158 base pairs fr

During the past year, many interesting advances have been made regarding molecular mechanisms controlling beta-like globin gene switching. Throughout the beta locus, -acting elements exist that are dynamically bound by trans-acting proteins, including transcription factors, coactivators, repressors, and chromatin modifiers. Characterization of transcription factors, their interaction with one another, and an ever-increasing role for chromatin structure in gene expression have enhanced understanding of the mechanism of globin gene switching. The studies reviewed here contribute new insights on the interplay between -acting elements, transcription factors, and chromatin modifiers that underlie globin gene switching during development.

We describe a novel alpha-thalassaemia-1 deletion that removes the entire zeta-alpha globin gene cluster. A Chinese couple were referred for counselling after two consecutive pregnancies ended with fetal hydrops. Gene mapping was used to demonstrate that the mother is heterozygous for the South-east Asia alpha-thalassaemia-1 deletion (zeta zeta zeta alpha alpha/zeta zeta--SEA), while the father carries an alpha-thalassaemia-1 deletion of more than 100 kilobases (zeta zeta alpha alpha/----). This newly discovered deletion extends for unknown distances 3' and 5' of the zeta-alpha globin gene cluster and has been designated (--HW).

EpoDB is a database intended for the study of gene expression during differentiation and development of vertebrate erythropoietic lineages. It currently contains 1442 Genbank entries (663 are globin and 779 non-globin) which have been augmented manually and computationally. Each entry was analyzed by an expert system that corrects errors in GenBank features and generates a uniformly annotated set of features. Gene names and gene, family names were manually added. Beyond the standard database queries, the functionality of EpoDB includes the ability to extract features and subsequences (e.g. retrieve −500 to +20 region relative to the start of transcription for all β-globins), display graphically transcription unit features and sequences using Java applets, and direct export of sequences to TESS, a transcription element search program. Information on gene regulatory sites and gene expression levels is being added.

Comment on Basu et al, page [2566][1] Once EKLF (KLF1) was found to be instrumental for adult β-globin expression, related activators for embryonic and fetal β-like genes have been sought. One, first identified 10 years ago, has unexpectedly reappeared. The regulation of β-like globin gene

The Artemia hemoglobin contains two subunits that are similar or different chains of nine globin domains. The domains are ancestrally related and are presumed to be derived from copies of an original single-domain parent gene. Since the gene copies have remained in the same environment for several hundred million years they provide an excellent model for the investigation of intron stability. The cDNA for one of the two types of nine-domain subunit (domains T1-T9) has been sequenced. Comparison with the corresponding genomic DNA reveals a total of 17 intradomain introns. Fourteen of the introns are in locations on the protein that are conventional in globins of other species. In eight of the nine domains an intron corresponds to the B helix, amino acid B12, following the second nucleotide (phase 2), and in six domains a G-helix intron is located between G6 and G7 (phase 0). The consistency of this pattern is supportive of the introns having been inherited from a single-domain parent gene. The remaining three introns are in unconventional locations. Two occur in the F helix, either in amino acid F3 (phase 1) in domain T3, or between F2 and F3 (phase 0) in domain T6. The two F introns strengthen an interpretation of intron inheritance since globin F introns are rare, and in domains T3 and T6 they replace rather than supplement the conventional G introns, as though displacement from G to F occurred before that part of the gene became duplicated. It is inferred that one of the F introns subsequently moved by one nucleotide. Similarly, the third unconventional intron location is the G intron in domain T4 which is in G6, phase 2, one nucleotide earlier than the other G introns. Domain T4 is also unusual in lacking a B intron. The pattern of introns in the Artemia globin gene supports a concept of general positional stability but the exceptions, where introns have moved out of reading frame, or have moved by several codons, or have been deleted, suggest that intron displacements can occur after inheritance from an ancient source.

The Caenorhabditis elegans and Artemia T4 globin sequences are highly homologous with other invertebrate globins. The intron/exon patterns of their genes display a single intron in the E and G helices respectively, Precoding introns in multirepeat globins are inserted in homologous positions. Comparison of the intron/exon patterns in the known globin gene sequences demonstrates that they are more diverse than first expected but nevertheless can be derived from an ancestral pattern having 3 introns and 4 exons.

We describe a new deletional form of alpha thalassaemia which encompasses the entire alpha-like globin gene cluster in a 15-year-old boy of Southern Italian descent. The deletion removes approximately 31 kb, the 5'-end point is located approximately 4 kb upstream of the xi gene, while the 3'-end point maps between the alpha 1- and theta 1-globin genes. The interaction of this deletion with the common-alpha 3.7 form gives origin to a classical form of haemoglobin (Hb) H disease in the propositus of this study. Deletional forms of xi alpha-thalassaemia are uncommon in the Mediterranean basin; as for other unusual xi alpha-thalassaemia forms, heterozygotes for this mutation may escape detection in population surveys based on zeta and alpha probes.

Recent data published in BMC Biology from the globin gene clusters in platypus, together with data from other species, show that beta-globin genes transposed from one chromosomal location to another. This resolves some controversies about vertebrate globin gene evolution but ignites new ones.

A large part of human genetic disease apparently arises from deamination of cytosine residues in methylated CpG dinucleotides. Their mutation rate is known to be high when C is present as 5-methyl-cytosine, but is believed to be normal when it is unmethylated. The beta-globin gene contains five, the gamma-globin gene two, and each of the alpha-globin genes contains 35 CpG dinucleotides. The CpG dinucleotides in the beta and gamma-globin genes are methylated, while those in the alpha-globin genes are under-methylated. One would therefore have expected the CpG dinucleotides to be a frequent source of mutations in the beta and gamma-globin genes, but not in the alpha-globin genes. In fact, the evidence points to CpG dinucleotides being a frequent source of mutations in both the alpha and beta-globin genes. This suggests either that the mutation rates of both methylated and unmethylated CpG dinucleotides are abnormally high, which conflicts with published evidence, or that there is a finite chance of some of these in the alpha-globin genes of certain individuals being methylated and therefore subject to mutation.

This article summarizes experience and data obtained using a previously developed reverse-phase high-performance liquid chromatography method (J.B. Shelton, J.R. Shelton and W.A. Schroeder, J. Liq. Chromatogr. 7 (1984) 1969) in the study of a number of hemoglobinopathies in the Sardinian population. The occurrence and incidence of several abnormal hemoglobins are described, as well as aspects of the expression of abnormal gamma-globin gene arrangements and thalassemic genes.

Circulating erythrocytes of mammals are incapable of haemoglobin synthesis. Haemoglobin is produced mainly by erythroblasts and reticulocytes in the bone marrow. In addition, circulating reticulocytes synthesize some haemoglobin. The circulating immature erythrocytes of nonmammalian vertebrates actively take up iron and produce haemoglobin. Upon maturation haemoglobin synthesis slows down. The synthesis of haem and globin chains are independent events. After the synthesis of the haem group and globin chains, they are assembled to form the characteristic quarternary structure of haemoglobin.

Comment on Zhao et al, page [2138][1] A novel isoform of the erythroid-specific NF-E4 protein contributes to fetal globin gene silencing by sequestering the CP2 transcriptional activator away from the γ-globin gene promoter. During the embryonic, fetal, and adult stages of hematopoiesis, distinct

In this issue, Persons and colleagues (page [506][1]) report another advance in the now rapidly moving field of gene therapy for the β-chain hemoglobinopathies, β-thalassemia (β-thal), and sickle cell disease (SCD). The hemoglobinopathies are the most common human inherited diseases, and while

The pufferfish has a compact genome that is well suited for finding many protein-coding genes by fish-mammal sequence comparison. In this issue Gillemans and colleagues (page [2842][1]) also turn to pufferfish for insights into the evolution and function of long-range regulatory elements, such as

We have used restriction endonucleases for mapping the δ globin gene within the genomic DNA obtained from an individual homozygous for δ thalassemia. The results of our analyses indicate that δ thalassemia is not due to a detectable structural gene deletion as found in α thalassemia, δβ thalassemia or hereditary persistance of fetal hemoglobin, but probably consist of molecular lesions similar to those found in the β° or β+ thalassemias.

We have used the chemical cleavage reagent methidiumpropyl-EDTA-Fe(II) to determine the location of the nucleosomes along the mouse β-major globin gene in erythroid and nonerythroid cells. In mouse L cells, in which the globin gene is inactive, the nucleosomes are precisely positioned with respect to the underlying DNA sequence from positions −3000 to +1500 relative to the cap site. In uninduced and induced murine erythroleukemia cells, the same phasing persists but is interrupted from positions −200 to +500. This gap in the phased distribution of nucleosomes appears to be protected from MPE-Fe(II) digestion, and is bounded on both sides by hypersensitive sites. These results define at least two structural states for the globin gene: an inactive state in which the gene is covered with a continuous array of phased nucleosomes and an active state in which this array is disrupted over the 5′ half of the structural gene.

Using the procedure of Bekhor and Mirell (Biochem, 18 , 609, 1979), we isolated a nonhistone protein fraction tightly bound to DNA which putatively has a role in globin gene regulation in chicken reticulocytes. This fraction was tested by gel electrophoresis and microcomplement fixation and appears by these criteria very similar to the chicken nuclear antigen previously identified in reticulocyte chromatin and structurally altered erythrocyte chromatin. This antigen is tissue and species specific (Pumo et al , Biochem. 19 , 2362, 1980).

1. 1. Chicken reticulocyte chromatin was fractionated by 4 different methods into transcriptionally active and inactive fractions. 2. 2. DNA sequences complementary to chicken globin cDNA probe were found distributed equally in transcriptionally active and inactive fractions of reticulocyte chromatin. 3. 3. Our results can be interpreted to indicate that heterochromatization is not the principal mechanism of globin gene inactivation during reticulocyte maturation.

We have identified 14 Asian patients with homozygous beta zero thalassaemia who had a mild clinical disorder related to an augmented production of haemoglobin F. None of their parents had an elevated level of Hb F. Restriction fragment length polymorphism analysis of the beta-globin cluster of these patients and a control group of Asian thalassaemia major patients showed that 6/14 of the thalassaemia intermedia patients were homozygous for a particular 5' beta-globin haplotype (-+-++), in contrast to 1/42 of the thalassaemia major patients. Furthermore, the -+-++ beta haplotype is also associated with amelioration of disease severity in beta thalassaemia in an Italian population. This beta haplotype is linked to a DNA sequence variation 5' (at position -158) to the G gamma globin gene which can be detected by the presence (+) of an Xmn I restriction enzyme site. The possible role of the Xmn I-gamma polymorphism in relation to this variant HPFH is discussed. We conclude that much of the observed clinical variability of beta thalassaemia can now be explained by the inheritance of beta thalassaemia chromosomes with different propensities for fetal haemoglobin production.

A base substitution (C----T) at position -88 relative to the cap site was identified in the beta-globin gene cloned from an individual with a mild form of beta-thalassemia. This nucleotide change lies in the sequence ACACCC proposed as a distal promoter element. Transient expression of the mutant gene in HeLa cells revealed a modest deficit in beta-globin mRNA production. RNA processing was normal. The -88 beta-thalassemia mutation lends further support for the in vivo role of the distal element in transcription.

At different stages of human development the various globin genes are sequentially activated and expressed in cells of the erythroid lineage. This precisely controlled process raises a number of important issues concerning the molecular basis of gene regulation. These include: (1) the specificity of globin gene expression in erythroid cells; (2) the sequential activation of the different genes within the α-like and β-like globin gene clusters during development, a phenomenon which has been referred to as hemoglobin switching; and (3) the balanced production of α-like and β-like globin polypeptide chains, implying a coordinate expression of genes located on different chromosomes.

The human fetal-to-adult globin switch normally occurs on a fixed schedule, beginning at 32-34 weeks gestation, and recent studies have suggested an association between this developmental inactivation of the fetal (gamma) globin genes and the appearance of methylation within and around these genes. We have studied a population of infants in whom this switch does not occur before birth (infants of diabetic mothers, IDM) and examined the patterns of methylation surrounding their active gamma-globin genes, in comparison to the gamma-globin genes of age-matched controls who have switched their pattern of globin gene expression on schedule. All genomic DNA samples from infants with delays in the globin switch demonstrated extensive hypomethylation in the region of the gamma-globin genes, comparable to that found in the genomes of fetuses of less than 21 weeks gestation. DNA from the erythroid cells of infants of 32-40 weeks gestation had no detectable hypomethylation in the gamma-globin region. These findings support the concept that hypomethylation is an accurate developmental marker of globin gene switching, and suggest that globin gene expression in IDM may be arrested at an early preswitch stage.

An erythroid-specific enhancer was previously identified in the 3′-flanking region of the β adult gene in chicken and duck, by transfection into AEV transformed chicken erythroblasts. Here we show that the duck enhancer is equally active in erythroid human K562 cells, presenting an embryonic/fetal program of globin gene expression. Furthermore, no other enhancer was found within the 20 kb of DNA including four β-like globin genes as well as a 1.5 kb upstream and a 3 kb downstream sequence.

Haemoglobin is a major protein induced during post-gastrula development of Artemia. Three haemoglobins are formed from the association of two different subunits, and they are expressed differentially during post-gastrula development. These haemoglobins are unusual in that they are of high molecular weight (Mr 260,000) and are composed of two globin chains (Mr 130,000) each of which is a polymer of eight covalently linked myoglobin-like domains [1]. Each polypeptide is encoded by a single large mRNA which may have originated as a result of successive tandem duplication and fusion of a single ancestral globin gene [2].