Search

MACROBIOTUS ARIEKAMMENSIS GROENLANDICUS SUBSP. NOV. (TABLES 4, 5; FIGS 5–11) Z o o b a n k r e g i s t r a t i o n: u r n: l s i d: z o o b a n k. org:act: 8A12E93C-8729-4B13-BD36-FC507DD117D3 Material examined: Altogether 110 animals and 78 eggs. Specimens mounted on microscope slides in Hoyer’s medium (83 animals + 68 eggs), fixed on SEM stubs (20 animals + ten eggs + four buccal apparatuses), processed for DNA sequencing (three animals). Etymology: The new subspecies is named after Greenland (from Danish Grønland), the territory where it was discovered. Type locality: 69°15’17’’N, 53°30’46’’W; 30 m a.s.l.: western coast of Greenland, Disko Island, Østerlien; moss on rock. Type depositories: Altogether 83 animals [slides: GL.018. 2–3, 9–17, SEM stubs: 9.06, 12.15 (buccal apparatus), 16.19] and 68 eggs (slides: GL.018. 1, 4–8, SEM stub: 16.19) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland. Description of the new subspecies Animals (measurements and statistics in Table 4): Body colourless in juveniles and whitish in adults, after fixation in Hoyer’s medium transparent (Fig. 5A). Eyes present, visible also after mounting the specimens on permanent slides in Hoyer’s medium. The entire cuticle covered with granulation visible in both PCM and SEM, arranged densely on the dorsum, and less densely on the venter and legs (Figs 5B–G, 6A, C, D, F, G, I). Only in some specimens the cuticular granulation can be less evident under PCM (Fig. 5D). Oval cuticular pores present (0.5–1.4 µm in diameter) (Fig. 5E–G). Patches of dense granulation present on internal and external surface of all legs I– III, as well as on legs IV and clearly visible (Fig. 6A, B, D, E). A pulvinus present on the internal surface of legs I– III (Fig. 6D, E). Granulation on legs IV is visible as a single large patch on dorsal and lateral leg surfaces (Fig. 6G–H). Claws slender, with flat and wide common tract, beginning with a visible stalk that connects the claws to the wide lunulae and ending with elongated branches (especially the primary branch; Fig. 7A–E). Primary branches with distinct accessory points, visible in PCM and SEM (Fig. 7A–E). Lunulae I– III smooth (Fig. 7A, C, D), whereas lunulae IV with clear dentation (Fig. 7B, E). A single continuous cuticular bar (Fig. 7A) and double muscle attachments visible on each leg I– III (Fig. 7A, C, D). Mouth anteroventral with ten peribuccal lamellae. Bucco-pharyngeal apparatus of the Macrobiotus - type (Figs 8A, 9A). Oral cavity armature extremely reduced to only one large tooth present in the dorsal portion of the third band of teeth, whereas other bands of teeth are absent (Figs 8A–D, 9F). Pharyngeal bulb spherical, with triangular apophyses, cuticular spikes, two rod-shaped macroplacoids (macroplacoid sequence: 2 Eggs (measurements and statistics in Table 5): Eggs laid freely, whitish, spherical or slightly oval (Figs 10A–D, 11A). The spaces between the processes are small and the surface of the egg between the processes is continuous and smooth, without any pores or reticulum, i.e. persimilis - type (Figs 10A–D, 11A–D). Between the processes on the egg surface, lightrefracting dots are usually visible in PCM, resembling micropores (Fig. 10A–D). Egg processes single-walled (without reticulation caused by labyrinthine layer) with dome-shaped basal part with distal part being thinner and elongated (Figs 10E–P, 11A–D). Internal septa are sometimes visible between basal and distal portion of the process in PCM (Fig. 10E–P). The basal portions of the processes are pierced by pores of uniform size (1.1– 1.8 µm in diameter) that are arranged alternately with dark thickenings around the process base (Figs 10A– D, 11B–D). In SEM, a reticulate internal structure is visible inside the pores and it seems to be a remnant of the reduced labyrinthine layer (Fig. 11B–D). The apical parts of the processes are flat but devoid of terminal discs and are covered with short, thin and flexible filaments (Figs 10E–P, 11E, F). Reproduction: The population is dioecious (the examination of specimens freshly mounted in Hoyer’s medium revealed testes filled with spermatozoa), but no secondary sexual dimorphism has been observed. DNA sequences: All obtained DNA sequences were represented by a single haplotype per each marker: 18S rRNA: MZ 463662, MZ 463663, MZ 463664. 28S rRNA: MZ 463677, MZ 463678, MZ 463679. ITS 2: MZ 463653, MZ 463654, MZ 463655. COI: MZ 461005, MZ 461006, MZ 461007. Differential diagnosis: Macrobiotus a. groenlandicus, known only from its locus typicus in Disko Island, Greenland, shares with M. a. ariekammensis the elongated primary branches of all claws, only one tooth in the third band of teeth in the oral cavity, and single-layer egg processes surrounded by a crown of pores and thickenings around their bases. However, it differs from M. a. ariekammensis, which is known only from a few localities in Svalbard (Norway) and Poland, by: the presence of a strong pronounced constriction in the first macroplacoid (first macroplacoid weakly constricted in M. a. ariekammensis), the presence of light-refracting dots resembling micropores on the egg surface (egg surface smooth in M. a. ariekammensis) and by the presence of fine granulation on the body cuticle visible in PCM and SEM (the body granulation absent or not visible in PCM in M. a. ariekammensis)., Published as part of Stec, Daniel, Vončina, Katarzyna, Kristensen, Reinhardt Møbjerg & Michalczyk, Łukasz, 2022, The Macrobiotus ariekammensis species complex provides evidence for parallel evolution of claw elongation in macrobiotid tardigrades, pp. 1067-1099 in Zoological Journal of the Linnean Society 195 on pages 1072-1076, DOI: 10.1093/zoolinnean/zlab101, http://zenodo.org/record/6994499

MACROBIOTUS KIRGHIZICUS TUMANOV, 2005 (TABLES 6, 7; FIGS 12–18) Material examined: Altogether 66 animals, and 15 eggs. Specimens mounted on microscope slides in Hoyer’s medium (53 animals + ten eggs), fixed on SEM stubs (ten + five), processed for DNA sequencing (three animals). Population locality: 41°32’37.98’’N, 75°10’2.28’’E; 2288 m a.s.l.: Kyrgyzstan, Chui, Kegeti, moss on rock. Specimens depositories: Altogether 53 animals (slides: KG.062.006. 1, 9–14, SEM stub: 18.07) and ten eggs (slides: KG.062. 5–8, SEM stub: 18.07) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland. Description of the Kyrgyz Republic population Animals (measurements and statistics in Table 6): Body whitish in adults and colourless in smaller individuals, after fixation in Hoyer’s medium transparent (Fig. 12A). After mounting in Hoyer’s medium eyes present in all specimens. Small, oval pores (0.5–0.8 µm in diameter), visible under PCM and SEM (Fig. 12B, C), scattered randomly on the entire body cuticle, including the external and internal surface of all legs (Fig. 13A–F). Extremely fine body granulation (c. 60 nm in diameter), visible only in SEM, present on the entire dorsocaudal cuticle (Fig. 12C). Patches of dense granulation present on the internal and external surfaces of all legs I– III and clearly visible both in PCM and SEM (Fig. 13A–D). A cuticular bulge, resembling a pulvinus, is present on the internal surfaces of legs I– III (Fig. 13C, D). Cuticular granulation on legs IV present and always clearly visible both in PCM and SEM (Fig. 13E, F). Claws slender, with flat and wide common tract, beginning with an evident stalk that connects the claws to the wide lunulae and ending with extremely elongated branches (especially the primary branch; Fig. 14A, B, D, E). Primary branches with indistinct accessory points, barely visible in PCM, but clearly visible in SEM (Fig. 14A, B, D, E). Lunulae I– III smooth (Fig. 14A, D), whereas lunulae IV with clear dentation (Fig. 14B, E). Mouth anteroventral with ten peribuccal lamellae (Fig. 16A, B). Bucco-pharyngeal apparatus of the Macrobiotus - type (Fig. 15A). Under PCM, only the second and third band of teeth visible, with the second band being faintly marked (Fig. 15B, C). However, under SEM, all of the three bands of teeth are visible, with the first band being situated at the base of peribuccal lamellae and composed of several irregular rows of small granular teeth surrounding the oral cavity (Fig. 16A, C). The second band of teeth is situated between the ring fold and the third band of teeth, and is comprises of small cones, barely visible in PCM (Figs 15B, 16B; note: in Fig 16B, only distal portion of these teeth are visible from behind the ring fold; due to unsuitable positioned specimen it was impossible to get better image in SEM). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 15B–D, 16A, B). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a transversal ridge weakly divided into two granular teeth, whereas the ventral teeth are smaller and faintly visible as two separate lateral transverse ridges with granular/roundish thickening at their medial extremities (Fig 15B–D). In SEM, both the dorsal and the ventral portion of the third band of teeth are visible as one fused ridge with two evident teeth extending from the medial portion of the ridge (Fig 16A, B). Pharyngeal bulb spherical, with triangular apophyses, cuticular spikes, two rodshaped macroplacoids (macroplacoid sequence: 2 Eggs (measurements and statistics in Table 7): Eggs laid freely, whitish, spherical or slightly oval (Figs 17A, B, 18A). Although the spaces between processes are small, the surface between processes is of the persimilis - type, i.e. with the continuous smooth chorion, with few, randomly distributed pores (Figs 17A, B, 18B–D). Egg processes single-walled (without reticulation caused by labyrinthine layer) with domeshaped basal part and rigid spine-like distal part (Figs 17A–F, 18A–F). In PCM, the basal and distal portions are clearly separated from with single internal septum (Fig 17C–F). The bases of egg processes are pierced with pores of uniform size (0.3–0.7 µm in diameter), distributed evenly around the base and most often arranged in two rows (Figs 17A, B, 18B–F). In PCM, short, dark thickenings are sometimes visible around the process bases below or at the same level as the lower ring of pores (Fig 17A, B). The apical part of the processes is devoid of terminal discs and is covered with short, thin and flexible filaments (Figs 17C–F, 18A–F). Reproduction: The population is dioecious (the examination of specimens freshly mounted in Hoyer’s medium revealed testes filled with spermatozoa), but no secondary sexual dimorphism has been observed. DNA sequences: All obtained DNA sequences were represented by a single haplotype per each marker: 18S rRNA: MZ 463665, MZ 463666, MZ 463667. 28S rRNA: MZ 463671, MZ 463672, MZ 463673. ITS 2: MZ 463659, MZ 463660, MZ 463661. COI: MZ 461002, MZ 461003, MZ 461004. PHYLOGENY The phylogenetic reconstruction (Fig. 19) shows three well-supported distinct lineages constituting three separate genera within superclade I (sensu Stec et al., 2021a) of the family Macrobiotidae: the clade comprising Macrobiotus species, and further two monophyletic groups: one corresponding to the genus Mesobiotus Vecchi et al., 2016, and the other representing Sisubiotus Stec et al., 2021a (Fig. 19). Macrobiotus is divided into three well-supported subclades: A, B and C, sensu Stec et al. (2021a). All of the three newly found populations investigated in this study, M. a. ariekammensis, M. a. groenlandicus and M. kirghizicus, are nested in subclade A, which contains species of the Macrobiotus hufelandi morphogroup sensu Stec et al. (2021a) and Macrobiotus basiatus Nelson et al., 2020, which exhibits unique egg morphology. Subclade B comprises three species complexes delineated by Stec et al. (2021a). As in Stec et al. (2021a) and Vecchi & Stec (2021), the Macrobiotus pallari complex and the Macrobiotus pseudohufelandi complex are monophyletic also in the present study (Fig. 19). However, the Macrobiotus persimilis complex, which was monophyletic in the two earlier studies, appears to be paraphyletic in the current analysis (Fig. 19). Thus, further studies are needed to clarify the phyletic character of the latter species complex. Subclade C comprises species of the Macrobiotus hufelandi morphogroup. SPECIES DELIMITATION AND GENETIC DISTANCES The PTP analysis identified 49 and 55 putative species in ML and BI approach, respectively. The ASAP analysis, on the other hand, identified 48 putative species. These results are in line with the general inspection of the tree terminals and the morphological information that would suggest also 48 species among the ingroup taxa. However, for two out of the three newly found populations analysed in this study, both PTP approaches were not congruent with ASAP results. The PTP approaches indicated that M. a. ariekammensis and M. a. groenlandicus constitute a single species, whereas the ASAP analysis identified them as separate entities. Uncorrected pairwise distances between the three newly found populations analysed in this study are as follows: • 18S rRNA: 0.2% for M. a. ariekammensis and M. a. groenlandicus; 0.1% for M. a. ariekammensis and M. kirghizicus; 0.3% for M. a. groenlandicus and M. kirghizicus. • 28S rRNA: 0.1% for M. a. ariekammensis and M. a. groenlandicus; 0.3% for M. a. ariekammensis in PCM (E) and SEM (F). Filled flat arrowheads indicate granulation patch on the external leg surface, empty indented arrowheads indicate cuticular bulge (pulvini), filled indented arrowhead indicates cuticular bar, empty flat arrowheads indicate granulation patch on the internal leg surface. Scale bars in µm. and M. kirghizicus; 0.1% for M. a. groenlandicus and M. kirghizicus. • ITS2: 0.3% to 0.8% for M. a. ariekammensis and M. a. groenlandicus; 6.1% for M. a. ariekammensis and M. kirghizicus; 6.3% for M. a. groenlandicus and M. kirghizicus. • COI: 3.3% for M. a. ariekammensis and M. a. groenlandicus; 16.3% for M. a. ariekammensis and M. kirghizicus; 16.4% for M. a. groenlandicus and M. kirghizicus. Given the discrepancies between the PTP and ASAP species delineation results, shallow genetic divergence and low p -distances in COI and ITS2 between M. a. ariekammensis and M. a. groenlandicus, we interpreted the morphological differences between the two taxa as intraspecific variability, hence the later taxon is described here as a subspecies rather than a separate species., Published as part of Stec, Daniel, Vončina, Katarzyna, Kristensen, Reinhardt Møbjerg & Michalczyk, Łukasz, 2022, The Macrobiotus ariekammensis species complex provides evidence for parallel evolution of claw elongation in macrobiotid tardigrades, pp. 1067-1099 in Zoological Journal of the Linnean Society 195 on pages 1076-1090, DOI: 10.1093/zoolinnean/zlab101, http://zenodo.org/record/6994499, {"references":["Tumanov DV. 2005. Two new species of Macrobiotus (Eutardigrada, Macrobiotidae) from Tien Shan (Kirghizia), with notes on Macrobiotus tenuis group. Zootaxa 1043: 33 - 46.","Stec D, Vecchi M, Calhim S, Michalczyk L. 2021 a. New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufeland i group. Molecular Phylogenetics and Evolution 160: 106987.","Vecchi M, Cesari M, Bertolani R, Jonsson KI, Rebecchi L, Guidetti R. 2016. Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics 30: 303 - 322.","Nelson DR, Adkins Fletcher R, Guidetti R, Roszkowska M, Grobys D, Kaczmarek L. 2020. Two new species of Tardigrada from moss cushions (Grimmia sp.) in a xerothermic habitat in northeast Tennessee (USA, North America), with the first identification of males in the genus Viridiscus. PeerJ 8: e 10251.","Vecchi M, Stec D. 2021. Integrative descriptions of two new Macrobiotus species (Tardigrada, Eutardigrada, Macrobiotidae) from Mississippi (USA) and Crete (Greece). Zoosystematics and Evolution 97: 281 - 306."]}

MACROBIOTUS ARIEKAMMENSIS ARIEKAMMENSIS WĘGLARSKA, 1965 (TABLES 2, 3; FIGS 1–4) Material examined: Seven animals and four eggs. Specimens mounted on microscope slides in Hoyer’s medium (four animals + four eggs), processed for DNA sequencing (three animals). Population locality: 78°40’33’’N, 16°38’49’’E; 208 m a.s.l.: Norway, Svalbard, Fortet; moss on soil. Specimen depositories: Four animals (slides: NO.393.393.2-4) and four eggs (slide: NO.393.01) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland. Description of the Norwegian population from Spitsbergen Animals (measurements and statistics in Table 2): Body transparent in smaller individuals (juveniles) and whitish in adults, after fixation in Hoyer’s medium transparent (Fig. 1A). Eyes present in all specimens, visible after mounting in Hoyer’s medium. Cuticular pores (0.7–1.2 µm in diameter) present, clearly visible under PCM (Fig. 1B–E) and scattered randomly on the entire body cuticle, including the external and internal surface of all legs. Patches of fine granulation present on internal and external surfaces of all legs I– III, as well as on legs IV and visible clearly in PCM (Fig. 1C–E). A pulvinus present on the internal surfaces of legs I– III (Fig. 1D). Granulation on legs IV is visible as a single large granulation patch on dorsal and lateral leg surfaces (Fig. 1E). Claws slender, with flat and wide common tract, beginning with a visible stalk that connects the claws to the wide lunulae and ending with elongated branches (especially the primary branch; Fig. 2A, B). Primary branches with distinct accessory points, visible in PCM (Fig. 2A, B). Lunulae I– III smooth (Fig. 2A), whereas lunulae IV with clear dentation (Fig. 2B, D). A single continuous cuticular bar and double muscle attachments visible on each leg I– III (Fig. 2C). Mouth anteroventral with ten peribuccal lamellae. Bucco-pharyngeal apparatus of the Macrobiotus - type (Fig. 3A). Under PCM, oral cavity armature extremely reduced to only one large tooth present in the dorsal portion of the third band of teeth, whereas other bands of teeth invisible or absent (Fig. 3A, B). Pharyngeal bulb spherical, with triangular apophyses, cuticular spikes, two rod-shaped macroplacoids (macroplacoid sequence: 2 Eggs (measurements and statistics in Table 3): Eggs laid freely, whitish, spherical or slightly oval (Fig. 4A, B). The spaces between processes are small, the surface between processes is of the persimilis - type, i.e. with the continuous smooth chorion, with no pores visible (Fig. 4A, B). Egg processes single-walled (without reticulation caused by the labyrinthine layer) with dome-shaped basal part and thinner and elongated distal portions (Fig. 4C–H). Internal septa are sometimes visible between the basal and the distal portion of the process in PCM (Fig. 4H). The basal portions of the processes are pierced by pores that are arranged alternately with dark thickenings and around the process base (Fig. 4A, B). The apical parts of the processes are flat but devoid of terminal discs, and are covered with short, thin and flexible filaments (Fig. 4C–H). Reproduction: The population is dioecious (the examination of specimens freshly mounted in Hoyer’s medium revealed testis filled with spermatozoa), but no secondary sexual dimorphism has been observed. DNA sequences: All obtained DNA sequences were represented by a single haplotype per each marker: 18S rRNA: MZ 463668, MZ 463669, MZ 463670. 28S rRNA: MZ 463674, MZ 463675, MZ 463676. ITS 2: MZ 463656, MZ 463657, MZ 463658. COI: MZ 460999, MZ 461000, MZ 461001., Published as part of Stec, Daniel, Vončina, Katarzyna, Kristensen, Reinhardt Møbjerg & Michalczyk, Łukasz, 2022, The Macrobiotus ariekammensis species complex provides evidence for parallel evolution of claw elongation in macrobiotid tardigrades, pp. 1067-1099 in Zoological Journal of the Linnean Society 195 on pages 1070-1072, DOI: 10.1093/zoolinnean/zlab101, http://zenodo.org/record/6994499, {"references":["Weglarska B. 1965. Die Tardigraden (Tardigrada) Spitzbergens. Acta Zoologica Cracoviensia 11: 43 - 52."]}

Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 Material examined. 102 animals, and 47 eggs. Specimens mounted on microscope slides in Hoyer’s medium (89 animals + 37 eggs), fixed on SEM stubs (10+10), and processed for DNA sequencing (3+0). Population locality. 54°4’55.37”N, 15°0’53.78”E, 15 asl: Poland, Rewal; mixed sample of lichen and moss collected from bark on a cherry tree in an orchard on the Polish coast; coll. Daniel Stec and Krzysztof Miler. Slides and SEM stub depository. 89 animals (slides: PL.352.*, where the asterisk can be substituted by any of the following numbers 03–08) and 37 eggs (slides: PL.352.*: 01–02, 09–10) as well as the SEM stub (code 18.13) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30- 387, Kraków, Poland. Morphology. Animals (measurements and statistics in Table 3). Body transparent in juveniles and creamywhite to slightly yellowish in adults but transparent after fixation in Hoyer’s medium (Fig. 1A). Eyes present in live animals and visible also after fixation. Round to subrounded pores (0.6–1.2 μm in diameter), clearly visible under both PCM and SEM, scattered randomly over the entire body cuticle (Fig. 1 B–С). Granulation on all legs present (Fig. 2 A–F). A patch of clearly visible granulation is present only on the external surface of legs I–III (Fig. 2 A–B). Granulation on legs IV is always clearly visible and consists of a single large, granulated patch on each leg (Fig. 2 E–F). A cuticular bulge/fold (pulvinus) is present on the internal surface of legs I–III (Fig. 2 C–D). Claws Y-shaped, of the hufelandi type. Primary branches with distinct accessory points, a common tract, and an evident stalk connecting the claw to the lunula (Fig. 3 A–F). Lunulae I–III are smooth (Fig. 3A, E), whereas lunulae IV are dentate (Fig. 3 C–D, F) although sometimes the dentation is only faintly visible (Fig. 3B). A divided cuticular bar is situated between the claws and the muscle attachments on legs I–III and is only faintly visible under PCM (Fig. 3A; see also Discussion section for more information on this character). A horseshoe-shaped structure connects anterior and posterior lunules (Fig. 3B). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 4A), with ventral lamina and ten small peribuccal lamellae (Fig. 5 A–B). Under PCM, the oral cavity armature is of the patagonicus type, i.e., with only the second and third bands of teeth visible (Fig. 4 B–C). However, in SEM all three bands of teeth are visible, with the first band being situated at the base of peribuccal lamellae and composed of 1–2 rows of small, conical teeth (Fig. 5 A–B). The second band of teeth is situated between the ring fold and third band of teeth and comprises 2–3 rows of small cones, slightly larger than those of the first band (Fig. 5 A–B), which under PCM are visible as dark dots (Fig. 4 B–C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under both PCM and SEM, the dorsal teeth of the third band are fused and form a single transverse ridge (Fig. 4B, 5A), whereas the ventral teeth appear as three separate transverse ridges with the median tooth being positioned more anteriorly compared to the lateral teeth (Fig. 4C, 5B). In SEM the margins of these ridges are serrated (Fig. 5 A–B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a drop-shaped microplac-oid (Fig. 4A). The macroplacoid length sequence is 2 Eggs (measurements and statistics in Table 4). Laid freely, creamy-white to yellowish and spherical (Figs 6 A–D and 7A). The surface between processes is of the hufelandi type, i.e., chorion surface covered by an evident reticulum with several rows of pores between processes (Figs 6 A–B and 7A–F). Under PCM the reticulation appears uniform over the entire surface (Fig. 6 A–B,); however, in SEM it is evident that the shape and size of the mesh is highly variable, with the mesh diameter ranging from 0.2 to 0.8μm (Fig. 7 B–F). The pillars connecting the reticulum with the chorion surface are visible only in SEM (Fig. 7 C–D). The bases of the processes are surrounded by cuticular thickenings that merge into the bars and nodes of the reticulum (Fig. 7B). These basal thickenings appear in PCM as short dark projections around the process bases (Fig. 6 A–B). Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs (Figs 6 E–G and 7C–D). Margins of the terminal discs are strongly serrated to dentated, with a concave central area (Figs 6 C–G and 7B–F). Under SEM, the teeth of the terminal discs appear to be covered by microgranulation (Fig.7 C–F). Reproduction / Sexual dimorphism. This species is dioecious: both males with testes and females with ovaries were recorded within the same population. Males exhibited a secondary sexual dimorphic trait in the form of poorly developed lateral gibbosities on legs IV (Fig. 8 A–B). DNA sequences obtained in this study. We obtained sequences for all four of the above-mentioned molecular markers from each of the six individuals destined for DNA extraction and sequencing in this study. Sequences of each marker were represented by a single haplotype in each species as follows: Macrobiotus sottilei: 18S rRNA (GenBank: MW 247178), 1011 bp long; 28S rRNA (MW 247175), 785 bp long; ITS-2 (MW 247179), 379 bp long; COI (MW 246133), 658 bp long. Macrobiotus glebkai: 18S rRNA (GenBank: MW 247177), 1012 bp long; 28S rRNA (MW 247176), 719 bp long; ITS-2 (MW 247180), 400 bp long; COI (MW 246134), 620 bp long. Phylogenetic position of the studied species. The bayesian reconstruction produced a well-supported tree (Fig. 9). The same three Macrobiotus clades (A, B and C) from Stec et al. (2020e) were recovered with high support. Macrobiotus glebkai belongs to clade A, without any clear close affinity to any of the other species in the clade, whereas Macrobiotus sottilei instead belongs to clade C and is closely related to Macrobiotus sapiens Binda & Pilato, 1984.

Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 Material examined. 102 animals, and 47 eggs. Specimens mounted on microscope slides in Hoyer’s medium (89 animals + 37 eggs), fixed on SEM stubs (10+10), and processed for DNA sequencing (3+0). Population locality. 54°4’55.37”N, 15°0’53.78”E, 15 asl: Poland, Rewal; mixed sample of lichen and moss collected from bark on a cherry tree in an orchard on the Polish coast; coll. Daniel Stec and Krzysztof Miler. Slides and SEM stub depository. 89 animals (slides: PL.352.*, where the asterisk can be substituted by any of the following numbers 03–08) and 37 eggs (slides: PL.352.*: 01–02, 09–10) as well as the SEM stub (code 18.13) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30- 387, Kraków, Poland. Morphology. Animals (measurements and statistics in Table 3). Body transparent in juveniles and creamywhite to slightly yellowish in adults but transparent after fixation in Hoyer’s medium (Fig. 1A). Eyes present in live animals and visible also after fixation. Round to subrounded pores (0.6–1.2 μm in diameter), clearly visible under both PCM and SEM, scattered randomly over the entire body cuticle (Fig. 1 B–С). Granulation on all legs present (Fig. 2 A–F). A patch of clearly visible granulation is present only on the external surface of legs I–III (Fig. 2 A–B). Granulation on legs IV is always clearly visible and consists of a single large, granulated patch on each leg (Fig. 2 E–F). A cuticular bulge/fold (pulvinus) is present on the internal surface of legs I–III (Fig. 2 C–D). Claws Y-shaped, of the hufelandi type. Primary branches with distinct accessory points, a common tract, and an evident stalk connecting the claw to the lunula (Fig. 3 A–F). Lunulae I–III are smooth (Fig. 3A, E), whereas lunulae IV are dentate (Fig. 3 C–D, F) although sometimes the dentation is only faintly visible (Fig. 3B). A divided cuticular bar is situated between the claws and the muscle attachments on legs I–III and is only faintly visible under PCM (Fig. 3A; see also Discussion section for more information on this character). A horseshoe-shaped structure connects anterior and posterior lunules (Fig. 3B). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 4A), with ventral lamina and ten small peribuccal lamellae (Fig. 5 A–B). Under PCM, the oral cavity armature is of the patagonicus type, i.e., with only the second and third bands of teeth visible (Fig. 4 B–C). However, in SEM all three bands of teeth are visible, with the first band being situated at the base of peribuccal lamellae and composed of 1–2 rows of small, conical teeth (Fig. 5 A–B). The second band of teeth is situated between the ring fold and third band of teeth and comprises 2–3 rows of small cones, slightly larger than those of the first band (Fig. 5 A–B), which under PCM are visible as dark dots (Fig. 4 B–C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under both PCM and SEM, the dorsal teeth of the third band are fused and form a single transverse ridge (Fig. 4B, 5A), whereas the ventral teeth appear as three separate transverse ridges with the median tooth being positioned more anteriorly compared to the lateral teeth (Fig. 4C, 5B). In SEM the margins of these ridges are serrated (Fig. 5 A–B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a drop-shaped microplac-oid (Fig. 4A). The macroplacoid length sequence is 2hufelandi type, i.e., chorion surface covered by an evident reticulum with several rows of pores between processes (Figs 6 A–B and 7A–F). Under PCM the reticulation appears uniform over the entire surface (Fig. 6 A–B,); however, in SEM it is evident that the shape and size of the mesh is highly variable, with the mesh diameter ranging from 0.2 to 0.8μm (Fig. 7 B–F). The pillars connecting the reticulum with the chorion surface are visible only in SEM (Fig. 7 C–D). The bases of the processes are surrounded by cuticular thickenings that merge into the bars and nodes of the reticulum (Fig. 7B). These basal thickenings appear in PCM as short dark projections around the process bases (Fig. 6 A–B). Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs (Figs 6 E–G and 7C–D). Margins of the terminal discs are strongly serrated to dentated, with a concave central area (Figs 6 C–G and 7B–F). Under SEM, the teeth of the terminal discs appear to be covered by microgranulation (Fig.7 C–F). Reproduction / Sexual dimorphism. This species is dioecious: both males with testes and females with ovaries were recorded within the same population. Males exhibited a secondary sexual dimorphic trait in the form of poorly developed lateral gibbosities on legs IV (Fig. 8 A–B). DNA sequences obtained in this study. We obtained sequences for all four of the above-mentioned molecular markers from each of the six individuals destined for DNA extraction and sequencing in this study. Sequences of each marker were represented by a single haplotype in each species as follows: Macrobiotus sottilei: 18S rRNA (GenBank: MW 247178), 1011 bp long; 28S rRNA (MW 247175), 785 bp long; ITS-2 (MW 247179), 379 bp long; COI (MW 246133), 658 bp long. Macrobiotus glebkai: 18S rRNA (GenBank: MW 247177), 1012 bp long; 28S rRNA (MW 247176), 719 bp long; ITS-2 (MW 247180), 400 bp long; COI (MW 246134), 620 bp long. Phylogenetic position of the studied species. The bayesian reconstruction produced a well-supported tree (Fig. 9). The same three Macrobiotus clades (A, B and C) from Stec et al. (2020e) were recovered with high support. Macrobiotus glebkai belongs to clade A, without any clear close affinity to any of the other species in the clade, whereas Macrobiotus sottilei instead belongs to clade C and is closely related to Macrobiotus sapiens Binda & Pilato, 1984., Published as part of Kiosya, Yevgen, Pogwizd, Justyna, Matsko, Yelyzaveta, Vecchi, Matteo & Stec, Daniel, 2021, Phylogenetic position of two Macrobiotus species with a revisional note on Macrobiotus sottilei Pilato, Kiosya, Lisi & Sabella, 2012 (Tardigrada: Eutardigrada Macrobiotidae), pp. 113-135 in Zootaxa 4933 (1) on pages 118-127, DOI: 10.11646/zootaxa.4933.1.5, http://zenodo.org/record/4548040, {"references":["Pilato, G., Kiosya, Y., Lisi, O. & Sabella, G. (2012) New records of Eutardigrada from Belarus with the description of three new species. Zootaxa, 3179, 39 - 60. https: // doi. org / 10.11646 / zootaxa. 3179.1.2","Stec, D., Vecchi, M., Calhim, S. & Michalczyk, L. (2020 e) New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group. Molecular Phylogenetics & Evolution. https: // doi. org / 10.1016 / j. ympev. 2020.106987","Binda, M. G. & Pilato, G. (1984) Macrobiotus sapiens, nuova specie di Eutardigrado di Sicilia. Animalia, 11, 85 - 90."]}

Tenuibiotus zandrae sp. nov. urn:lsid:zoobank.org:act: 99D6163D-E8E6-4223-B975-F68AA2268304 Figs 10���19 Etymology We take great pleasure in dedicating this new species to the friend of the first and third authors. Zandra Maria Skandrup Sigvardt, who recently completed her PhD studies working on crustaceans (Section of Biosystematics) at the Natural History Museum of Denmark in Copenhagen. Material examined 62 animals (including 18 simplex) and 171 eggs. Specimens mounted on microscope slides in Hoyer���s medium (49 animals + 161 eggs), fixed on SEM stubs (including two extracted buccal apparatuses) (10 +10), and processed for DNA sequencing (3 +0). Holotype GREENLAND ��� Disko Island, ��sterlien; 69��15���17��� N, 53��30���46��� W; 30 m a.s.l.; sample of moss collected from the rock in arctic tundra; IZiBB, slide GL.011.17. Paratypes GREENLAND ��� 58 paratypes; same collection data as for holotype; IZiBB, slides GL.011.08 to 011.09, 011.16 to 011.19, 011.22 to 011.23, 011.27 to 011.28, SEM stubs GL.012.06 to 012.07, 012.13 ��� 171 eggs; same collection data as for holotype; IZiBB, slides GL.011.10 to 011.15, 011.20 to 011.21, 011.24 to 011.26, 011.29, SEM stub GL.12.13. Description Animals (measurements and statistics in Table 4) Body transparent in juveniles and whitish in adults, after fixation in Hoyer���s medium transparent (Fig. 10). Eyes present in specimens mounted in Hoyer���s medium. Body cuticle without pores but covered with fine granulation including ventral side of the body and all legs (Figs 11���13). Granulation is distributed uniformly on the body (Fig. 11 A���B, E) but sometimes, especially in larger specimens, random patches without granulation are present on the body cuticle (Fig. 11 C���D, F). Patches of dense granulation composed of cushions with aggregated granules present on all legs (Figs 12���13). A patch of clearly visible granulation, is present on the external surface of legs I���III just below the claws (Figs 12A, 13A). A pulvinus is absent on the internal surface of legs I���III, whereas a patch of dense granulation is present and wider than the patch on the external leg surface (Figs 12B, 13B). A patch of dense granulation on legs IV is always visible and covers the dorsal and the lateral sides of hind legs (Figs 12C, 13 C���D). Claws slender, of the Tenuibiotus type (Fig. 14). Primary branches with distinct accessory points, a long common tract, and with an evident stalk connecting the claw to the very wide lunula (Fig. 14). Lunulae I���III smooth (Fig. 14A, C), whereas lunulae IV exhibit clear dentation (Fig. 14B, D). The horseshoe structure connecting the anterior and the posterior claw is present and is visible only in PCM (Fig. 14B). Mouth antero-ventral, followed by ten peribuccal lamellae (Figs 15A, 16). Bucco-pharyngeal apparatus of the Macrobiotus type (Figs 15A, 17A). Under LCM, only the second and third bands of teeth visible, with the second band being faintly marked (Fig. 15 B���C). However, in SEM all three bands of teeth are visible, with the first band being situated at the base of peribuccal lamellae and composed of 1���2 rows of small, cone-shaped teeth arranged around the oral cavity (Figs 16, 17B). The second band of teeth is situated between the ring fold and the third band of teeth and comprises 3���6 rows of small, cone-shaped teeth (Figs 15 B���C, 16). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 15 B���C,16). The third band of teeth is discontinuous and divided into dorsal and ventral portions. Under LCM, the dorsal teeth are seen as three distinct transversal ridges of which the median tooth is triangular and is wedged between the lateral teeth (Fig. 15B). The ventral teeth under LCM appear as three to four separate roundish teeth, largest than those of the second band (Fig. 15C), only sometimes they can be seen as one faintly marked, elongated tooth. In SEM, both dorsal and ventral teeth are also clearly distinct (Fig. 16). Under SEM, the medio-dorsal tooth is the largest within the third band and is positioned anteriorly with respect to the lateral teeth (Fig. 16A), whereas the ventral portion consist of cone-shaped teeth of which the lateral ones are larger than the medial ones (Fig. 16B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small triangular microplacoid (Fig. 15A, D���E). The macroplacoid length sequence is 2Eggs (measurements and statistics in Table 5) Laid freely, whitish, spherical or ovoid (Figs 18 A���B, 19A). The surface between processes is smooth, with thickenings/striae often radiating from the processes bases (Figs 18 B���D, 19B���C, E���F). Under PCM, these thickenings together with labyrinthine layer within chorion are visible as dark dots and lines on the surface between processes, whereas under SEM they are smooth striae coming out of the process bases (Figs 18 B���D and 19B���C, E���F, respectively). Under SEM, the surface between processes and between the peribasal striae is covered with micropores (Fig. 19 E���F). Processes are of conical shape, with elongated apices which are sometimes bi- or trifurcated (Figs 18 E���H, 19A���D). The labyrinthine layer between the process walls is clearly visible under LCM as a reticular pattern with sinuous margins (Fig. 18 C���D). The elongated meshes decrease in size from the base to the top of the processes (Fig. 18 C���D). Under SEM, the surface of the processes is covered with small tubercles, whereas the surface of the elongated apices is smooth (Fig. 18 B���E). Reproduction The examination of specimens freshly mounted in Hoyer���s medium did not revealed any spermathecae or testes filled with spermatozoa. Also, male secondary sexual dimorphism traits such as lateral gibbosities on legs IV were absent. Thus, reproductive mode could not be unambiguously determined. DNA sequences We obtained sequences of good quality for all four of the above-mentioned DNA markers. Sequences of each marker were represented by single haplotypes: 18S rRNA sequence (GenBank: MN443040), 1035 bp long; 28S rRNA sequence (GenBank: MN443035), 780 bp long; ITS-2 sequence (GenBank: MN443038), 439 bp long; COI sequence (GenBank: MN444827), 658 bp long. Morphological observations of comparative material Amended description of Tenuibiotus voronkovi The examination of the holotype and paratype of T. voronkovi under LCM revealed the presence of granulation on the body cuticle. Faint granulation with small and uniformly sized granules is regularly arranged and covers the dorso-medial region of the body, from its cephalic to the caudal end (Fig. 20A). On the dorso-lateral surface of the body, granulation is unevenly distributed and resembles patches of granules, within which granule size gradually increases in the dorsal to lateral direction (Fig. 20B). The granulation is absent or not visible in LCM on the ventral side of the body. Similarly, the granulation is absent on the legs except a typical dense granulation patch on the external and internal surface of the legs near the claws. However, note that this observation was made on two different specimens (not very well oriented/positioned and stretched on the slide) thus, the certain distribution pattern of body granulation requires a further examination when a new population of T. voronkovi becomes available. As in the original description, the eggs of T. voronkovi have small conical processes with elongated and flexible apices which are often folded and not clearly visible or even broken. (Figs 21A, C���J, 22). The process walls are smooth, without any obvious thickenings or tubercles (Fig. 22) but with obvious annulation and with the labyrinthine layer within process walls, visible under LCM as roundish polygonal reticulation (Fig. 21C, E���F), on one egg being abnormally developed and visible more like pores than true reticulation (Fig. 21D). Under SEM, the surface between processes is covered with short irregular striae/ridges/wrinkles which often radiate from the process bases, with small micropores randomly scattered in between them (Fig. 22). However, under PCM the surface is visible as being covered with dark dots which are probably the thickenings of the labyrinthine layer within the chorion (Fig. 21B). The morphological analysis conducted on two populations designated as ��� T. voronkovi ��� by Zawierucha et al. (2016a), from Edge��ya and Nordaustlandet (islands within the Svalbard archipelago, Norway), showed distinct differences in cuticle morphology in comparison to the T. voronkovi type series. Specifically, animals of the Edge��ya population exhibit faint, dense and uniformly distributed granulation on the whole dorso-lateral cuticle from its cephalic to the caudal end (excluding ventral and leg cuticle) (Fig. 23A), whereas this granulation is absent or not visible under LCM in animals of the Nordaustlandet population. The morphology of egg processes in both these populations is very similar: specifically, processes are of a conical shape with elongated apices, with the labyrinthine layer between the process walls clearly visible under LCM as a reticular pattern with sinuous margins and elongated meshes decreasing in size from the base to the processes top in most cases (Figs 23 B���D, 24). Other traits are as described by Zawierucha et. al. (2016a) however, it should be noted that as for the similarly to T. voronkovi, no more conclusions can be made based on this material due to the bad condition of the slides, with bubbles of air and crystalized Hoyer which prevent further investigation and limit the number of specimens suitable for imaging., Published as part of Stec, Daniel, Tumanov, Denis V. & Kristensen, Reinhardt M��bjerg, 2020, Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland, pp. 1-40 in European Journal of Taxonomy 614 on pages 15-26, DOI: 10.5852/ejt.2020.614, http://zenodo.org/record/3710893, {"references":["Zawierucha K., Kolicka M. & Kaczmarek L. 2016 a. Re-description of the Arctic tardigrade Tenuibiotus voronkovi (Tumanov, 2007) (Eutardigrada; Macrobiotidea), with the first molecular data for the genus. Zootaxa 4196 (4): 498 - 510. https: // doi. org / 10.11646 / zootaxa. 4196.4.2"]}

Macrobiotus engbergi sp. nov. urn:lsid:zoobank.org:act: C592B357-37F6-4C92-B16A-C28EDB17A231 Figs 1���9 Etymology We take great pleasure in dedicating this new species to the friend of the third author, Lars Engberg Hansen, who is a teacher emeritus from Qeqertarsuaq and Alluitsup Paa in Greenland and is always happy to help with collecting samples of mosses and lichens for us. Material examined 112 animals (including 9 simplex) and 108 eggs. Specimens mounted on microscope slides in Hoyer���s medium (98 animals + 103 eggs), fixed on SEM stubs (10+ 5) and processed for DNA sequencing (4+ 0). Holotype GREENLAND ��� ♀; Alluitsup Paa; 60��28���1.5���N, 45��34���27.8���W; 25 m a.s.l.; mixed sample of moss and lichen collected from rock in arctic tundra; IZiBB, slide GL.052.22. Paratypes GREENLAND ��� 107 paratypes; same collection data as for holotype; IZiBB, slides GL.052.17 to 052.24, SEM stub 17.08 ��� 108 eggs; same collection data as for holotype; IZiBB, slides GL.052.09 to 052.16, SEM stub 17.08. Description Animals (measurements and statistics in Table 2) Body transparent in juveniles and whitish in adults, after fixation in Hoyer���s medium transparent (Fig. 1A). Eyes present, visible also in specimens mounted in Hoyer���s medium. Cuticle porous with two types of pores: large (up to 5.0 ��m in diameter) lenticular pores of shape resembling paper wrapped candy, with transversal wrinkles in extremities distributed randomly on entire body cuticle and being the biggest on anterior and posterior dorsal region (Figs 1 B���C, 2); and small round cuticular pores (0.3���0.7 ��m in diameter) scattered in between lenticular pores (Figs 1C, 2B). Patches of granulation on all legs present (Fig. 3). A patch of clearly visible granulation is present on the external surface of legs I���III (Fig. 3 A��� B). A pulvinus present on internal surface of legs I���III, together with a faint cuticular fold covered with faint granulation and paired muscles attachments which are present just below claws (Fig. 3 C���D). Both structures are visible only if the legs are fully extended and well oriented on slide. Granulation on legs IV always visible and consists of a single large granulation patch on each leg (Fig. 3 E���F). Claws stout, of the hufelandi type (Fig. 4). Primary branches with distinct accessory points, a common tract and with an evident stalk connecting the claw to the lunula (Fig. 4). Lunulae on all legs smooth (Fig. 4). Cuticular bars under claws are absent. Double muscle attachments are faintly marked under LCM but clearly visible under SEM (Fig. 4A, C). The horseshoe structure connecting the anterior and the posterior claw is present and is visible only in PCM (Fig. 4B) and sometimes also on legs I���III, but in this case inverted and not connecting the external and the internal claw (Fig. 4A). Mouth antero-ventral, followed by ten peribuccal lamellae and a circular sensory lobe, surrounded by the ring of large pores (Figs 2A, 5A, 6). Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 5A). Under LCM, the oral cavity armature is of the patagonicus type, i.e., with only the 2 nd and 3 rd bands of teeth visible (Fig. 5 B���C). However, in SEM all three bands of teeth are visible, with the first band situated at the base of peribuccal lamellae and composed of a 1���2 rows of small, cone-shaped teeth arranged around the oral cavity (Fig. 6). The second band of teeth is situated between the ring fold and the third band of teeth, and comprises 3���6 rows of small cone-shaped teeth (Figs 5 B���C, 6). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 5 B���C, 6). The third band of teeth is discontinuous and divided into dorsal and ventral portions. Under LCM, the dorsal teeth are seen as three distinct transversal ridges, whereas the ventral teeth appear as two separate lateral transverse ridges and a median roundish tooth (Fig. 5 B���C). In SEM, both dorsal and ventral teeth are also clearly distinct (Fig. 6). Under SEM, the margins of the dorsal teeth slightly serrated (Fig. 6A). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small, triangular microplacoid (Fig. 5A, D���E). The macroplacoid length sequence 2Eggs (measurements and statistics in Table 3) Laid freely, yellowish, spherical (Figs 7A, 8A). The surface between processes is of the persimilis type, i.e., with the continuous smooth chorion, never with pores or reticulum (Figs 7 F���G, 8). Under PCM labyrinthine layer is visible as dark dots/thickenings on the surface between processes, whereas under SEM the surface is smooth (Figs 7 F���G and 8, respectively). Processes are of the inverted goblet shape, with slightly concave trunks and concave terminal discs (Figs 7 B���C, 8A���C). Terminal discs are round with margins ranging from only serrated to clearly indented (Figs 7 D���E, 8). Each terminal disc has a distinct concave central area, which may contain some scattered granulation within, and micro-granulations which are always present on the margins (visible only under SEM; Fig. 8 C���D). Reproduction The new species is dioecious. Spermathecae in females as well as testis in males have been found to be filled with spermatozoa, clearly visible under LCM up to 24 hours after mounting in Hoyer���s medium. The new species exhibits a male secondary sexual dimorphism trait in the form of evident lateral gibbosities on legs IV (Fig. 9). DNA sequences We obtained sequences for all four of the above mentioned DNA markers. Sequences of 18S rRNA and 28S rRNA were represented by single haplotypes, whereas sequences of ITS-2 and COI were represented by two (distance: 0.5%) and three (distance: 1.3���1.8%) haplotypes, respectively: 18S rRNA sequence (GenBank: MN443039), 1017 bp long; 28S rRNA sequence (GenBank: MN443034), 783 bp long; ITS-2 haplotype 1 sequence (GenBank: MN443036), 374 bp long; ITS-2 haplotype 2 sequence (GenBank: MN443037), 374 bp long; COI haplotype 1 sequence (GenBank: MN444824), 638 bp long; COI haplotype 2 sequence (GenBank: MN444825), 638 bp long; COI haplotype 3 sequence (GenBank: MN444826), 638 bp long. Genus Tenuibiotus Pilato & Lisi, 2011, Published as part of Stec, Daniel, Tumanov, Denis V. & Kristensen, Reinhardt M��bjerg, 2020, Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland, pp. 1-40 in European Journal of Taxonomy 614 on pages 4-15, DOI: 10.5852/ejt.2020.614, http://zenodo.org/record/3710893, {"references":["Stec D., Zawierucha K. & Michalczyk L. 2017 a. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300 (3): 403 - 420. https: // doi. org / 10.11646 / zootaxa. 4300.3.4","Zeller C. 2010. Untersuchung der Phylogenie von Tardigraden anhand der Genabschnitte 18 S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). MSc Thesis, Technische Hochschule Wildau, Germany.","Gasiorek P., Stec D., Zawierucha Z., Kristensen R. M. & Michalczyk L. 2018. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472 (2): 261 - 297. https: // doi. org / 10.11646 / zootaxa. 4472.2.3","Mironov S. V., Dabert J., Dabert M. 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253: 54 - 61. https: // doi. org / 10.11646 / zootaxa. 3253.1.2","Stec D., Morek W., Gasiorek P. & Michalczyk L. 2018 a. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity 16 (4): 357 - 376. https: // doi. org / 10.1080 / 14772000.2018.1424267","Folmer O., Black M., Hoeh W., Lutz R. & Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294 - 299.","Michalczyk L., Welnicz W., Frohme M. & Kaczmarek L. 2012. Redescriptions of three Milnesium Doyere, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa 3154: 1 - 20. https: // doi. org / 10.11646 / zootaxa. 3154.1.1"]}

Mesobiotus dilimanensis, new species (Tables 3, 4, Figs. 1–5) Material examined: 65 animals (including eight simplex), 47 eggs, and 7 empty chorions mounted on microscope slides in Hoyer's medium, 5 eggs fixed on SEM stubs, and 8 specimens processed for DNA sequencing. Type locality: 14°39′40″N, 121°04′07″E; 76 m asl: Philippines, Quezon City, Diliman, University of the Philippines, A. Roces St.; moss on a rock; September 2015; coll. Lowelyn Itang. Etymology: The species is named after Diliman, the district in Quezon City, Philippines, where it was discovered. Type depositories: Holotype: slide PH.006.10 with six paratypes; 58 paratypes (slides: PH.006. *, where the asterisk can be substituted by any of the following numbers: 02–03, 11–16), 47 eggs (slides: PH.006. *: 5–9, 17); seven empty chorions (slides: PH.006. *: 01, 04) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland.

Mesobiotus dilimanensis, new species (Tables 3, 4, Figs. 1–5) Material examined: 65 animals (including eight simplex), 47 eggs, and 7 empty chorions mounted on microscope slides in Hoyer's medium, 5 eggs fixed on SEM stubs, and 8 specimens processed for DNA sequencing. Type locality: 14°39′40″N, 121°04′07″E; 76 m asl: Philippines, Quezon City, Diliman, University of the Philippines, A. Roces St.; moss on a rock; September 2015; coll. Lowelyn Itang. Etymology: The species is named after Diliman, the district in Quezon City, Philippines, where it was discovered. Type depositories: Holotype: slide PH.006.10 with six paratypes; 58 paratypes (slides: PH.006. *, where the asterisk can be substituted by any of the following numbers: 02–03, 11–16), 47 eggs (slides: PH.006. *: 5–9, 17); seven empty chorions (slides: PH.006. *: 01, 04) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland., Published as part of Itang, Lowelyn A. M., Stec, Daniel, Mapalo, Marc A., Mirano-Bascos, Denise & Michalczyk, Łukasz, 2020, An integrative description of Mesobiotus dilimanensis, a new tardigrade species from the Philippines (Eutardigrada: Macrobiotidae: furciger group), pp. 19-31 in Raffles Bulletin of Zoology 68 on page 21, DOI: 10.26107/RBZ-2020-0003, http://zenodo.org/record/4576633

Itang, Lowelyn A. M., Stec, Daniel, Mapalo, Marc A., Mirano-Bascos, Denise, Michalczyk, Łukasz (2020): An integrative description of Mesobiotus dilimanensis, a new tardigrade species from the Philippines (Eutardigrada: Macrobiotidae: furciger group). Raffles Bulletin of Zoology 68: 19-31, DOI: 10.26107/RBZ-2020-0003

Macrobiotus noongaris sp. nov. urn:lsid:zoobank.org:act: A7 BF 7 FF 6-451 F- 4382- A 842- CAC 1 EF 51 E 6 B 8 Figs 1–7 Etymology The name refers to the indigenous Australians who live in the region where the new species was found. These are the Noongar peoples, 14 different but related language groups that occupied these lands before western settlement, including the modern city of Perth where the sample was collected. In their languages, the term Noongar means ‘a person of the southwest of Western Australia’. Material examined 86 animals (including 31 simplex) and 57 eggs. Specimens mounted on microscope slides in Hoyer’s medium (72 animals + 47 eggs), fixed on SEM stubs (10+10) and processed for DNA sequencing (4+0). Holotype AUSTRALIA – Western Australia • ♀; Perth, Kings Park; 31°57′30″ S, 115°350′09″ E; 46 m a.s.l.; moss on soil in an urban park; IZiBB AU.031.12. Paratypes AUSTRALIA – Western Australia • 62 paratypes; same collection data as for holotype; IZiBB AU.031.06 to AU.031.14 • 32 eggs; same collection data as for holotype; IZiBB AU.031.02–05. Description Animals (measurements and statistics in Table 2) Body transparent in juveniles and white in adults but transparent after fixation in Hoyer’s medium (Fig. 1 A). Eyes present in live animals as well as in specimens mounted in Hoyer’s medium. Small round and oval cuticular pores (0.3–0.8 μm in diameter), visible under both PCM and SEM, scattered randomly on entire body (Fig. 1 B–C). Granulation present on all legs (Fig. 2 A–F). A patch of clearly visible granulation present on external surface of legs I–III (Fig. 2 A–B). A cuticular bulge/fold (pulvinus) present on internal surface of legs I–III, with a faint cuticular fold covered with faint granulation and paired muscles attachments just above the claws (Fig. 2 C–D). Both structures are visible only if legs are fully extended and properly oriented on slide (particularly in the case of the pulvinus and cuticular fold). Granulation on legs IV always clearly visible and consists of a single large granulation patch on each leg (Fig. 2 E–F). Claws stout, of hufelandi type (Fig. 3 A–D). Primary branches with distinct accessory points, a common tract, and with an evident stalk connecting claw to lunula (Fig. 3 A–D). Lunulae I–III smooth (Fig. 3 A, C), whereas lunulae IV clearly dentate (Fig. 3 B, D). Cuticular bars under claws absent. Double muscle attachments faintly marked under PCM but clearly visible under SEM (Fig. 3 A, C). Mouth antero-ventral followed by ten peribuccal lamellae and a circular sensory lobe (Figs 4 A, 5 A). Bucco-pharyngeal apparatus of Macrobiotus type (Fig. 4 A). Under PCM, oral cavity armature of the patagonicus type, i.e., with only 2 nd and 3 rd bands of teeth visible (Fig. 4 B–C). However, in SEM all three bands of teeth visible, with first band being situated at base of peribuccal lamellae and composed of a single row of small fused cone-shaped teeth connected to form a continuous, slightly serrated ring ridge around oral cavity (Fig. 5 B–C). Second band of teeth situated between ring fold and third band of teeth and comprises 3–6 rows of small cone-shaped teeth (Figs 4 B–C, 5 B–C). Teeth of third band located within posterior portion of oral cavity, between second band of teeth and buccal tube opening (Figs 4 B–C, 5 B–C). Third band of teeth discontinuous and divided into dorsal and ventral portions. Under PCM, dorsal teeth appear as three distinct transverse ridges, whereas ventral teeth appear as two separate lateral transverse ridges and a median tooth (Fig. 4 B–C). In SEM, both dorsal and ventral teeth also clearly distinct (Fig. 5 B–C). Under SEM, margins of medio-dorsal tooth slightly serrated (Fig. 5 B), whereas the medio-ventral tooth slightly anterior to lateral teeth (Fig. 5 C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small triangular microplacoid (Fig. 4 A, D–E). Macroplacoid length sequence 2 Eggs (measurements and statistics in Table 3) Laid freely, white, spherical or slightly ovoid (Fig. 6 A). Surface between processes is of the hufelandi type, i.e., covered with a reticulum (Figs 6 E, 7 B–D, F). Meshes of reticulum small (0.1–0.6 µm) and rounded, regular in size and with blurred rims in PCM (Fig. 6 E), irregular in size and with thick borders in SEM (meshes in SEM appear as pores; Figs 7 B–D, F). Interbasal meshes larger than peribasal meshes, but peribasal meshes do not form rings around process bases (Figs 6 E, 7 B–D, F). Eggs have 22–30 processes on circumference, 26 on average (Fig. 6 A). Processes are of inverted goblet shape, with slightly concave trunks and concave terminal discs (Figs 6 C–E, 7B–E). Terminal discs are round and strongly serrated (Fig. 7 C–E). Each terminal disc has a distinct concave central area which may contain some scattered granulation within, which is also always present on the margin (visible only under SEM; Fig. 7 C–E). Reproduction The new species is dioecious. No spermathecae filled with sperm have been found in gravid females on the freshly prepared slides. However, the testis in males, filled with spermatozoa, is clearly visible under PCM up to 24 hours after mounting in Hoyer’s medium (Fig. 6 F). The new species does not exhibit male secondary sexual dimorphism traits such as lateral gibbosities on legs IV. DNA sequences We obtained sequences for all four of the above mentioned DNA markers. All sequenced fragments were represented by single haplotypes except the ITS-2, in which two distinct haplotypes were present: The 18 S rRNA sequence (GenBank: MK 737069), 1010 bp long. The 28 S rRNA sequence (GenBank: MK 737063), 786 bp long. The ITS-2 haplotype 1 sequence (GenBank: MK 737065), 418 bp long. The ITS-2 haplotype 2 sequence (GenBank: MK 737066), 418 bp long. The COI sequence (GenBank: MK 737919), 658 bp long., Published as part of Coughlan, Kyle & Stec, Daniel, 2019, Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position, pp. 1-38 in European Journal of Taxonomy 573 on pages 6-15, DOI: 10.5852/ejt.2019.573, http://zenodo.org/record/3526912

Family: Macrobiotidae Thulin, 1928 Genus: Mesobiotus Vecchi, Cesari, Bertolani, Jönsson, Rebecchi & Guidetti, 2016, Published as part of Stec, Daniel, 2019, Mesobiotus datanlanicus sp. nov., a new tardigrade species (Macrobiotidae: Mesobiotus harmsworthi group) from Lâm Đ ồng Province in Vietnam, pp. 164-180 in Zootaxa 4679 (1) on page 168, DOI: 10.11646/zootaxa.4679.1.10, http://zenodo.org/record/3466234, {"references":["Thulin, G. (1928) Uber die Phylogenie und das System der Tardigraden. Hereditas, 11, 207 - 266. https: // doi. org / 10.1111 / j. 1601 - 5223.1928. tb 02488. x","Vecchi, M., Cesari, M., Bertolani, R., Jonsson, K. I., Rebecchi, L. & Guidetti, R. (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics, 30 (4), 303 - 322. https: // doi. org / 10.1071 / IS 15033"]}

Fractonotus verrucosus (Richters, 1900) n. comb. Macrobiotus ornatus var. verrucosus Richters, 1900: 41 (terra typica: Taunus, Germany). Macrobiotus scabrosus Murray, 1911: 10 (locus typicus: Clare Island, Ireland). Hypsibius verrucosus – Thulin 1911: 29 (Kiruna, Lapland, Sweden). — Marcus 1928: 180 (Vannsee, Berlin, Germany). — Cuénot 1932: 77 (the Vosges, France and Switzerland). — da Cunha 1947, 1948: 6, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal). Calohypsibius verrucosus – Thulin 1928: 239 (Sweden). Calohypsibius scabrosus Thulin, 1928: 239 (Sweden). Hypsibius scabrosus Cuénot, 1932: 77 (the Vosges, France and Switzerland). — da Cunha 1947, 1948: 6, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal). Hypsibius (Calohypsibius) verrucosus – Marcus 1936: 285 (Schwarzwald, Germany). — Franceschi 1951-1952: 12 (Val Camonica, Italy). — Mihelčič 1953: 247 (Tirol, Austria). — Fontoura 1981: 18 (Viseu, Arga, Amarante, Portugal). Hypsibius placophorus da Cunha, 1943: 1 (locus typicus: Cabril do Ceira, Portugal); 1947, 1948: 2, 2 (Serra d’Arga, Serra do Buçaco, Serra da Estrela, Serra da Lousã, Portugal) n. syn. LOCALITIES. — Scotland. Creag Meagaidh (56°57’10’’ N, 4°30’35’’ W; 291 m a.s.l.; collection date: 1.X.2014), lichens from moorland rocks; Scotland, Hebrides, Isle of Lewis, Loch nan Muilne (58°21’08’’ N, 6°35’14’’ W; 27 m a.s.l.; collection date: 29.VII.2015), moss and lichen mix from stones on the lakeshores; Invermoriston, Loch Ness (57°12’39’’ N, 4°35’59’’ W; 20 m a.s.l.; 25.X.2015; Brian Blagden leg.), moss and lichen mix from stones on the lakeshores. MATERIAL EXAMINED. — 23 individuals, UJ (19 specimens, including one simplex, on slides GB.005.03-12, GB.008.01-3, GB.028.01- 2 and 4 specimens on two SEM stubs); 2 individuals, MNHN (slides GB.005.01-2); 3 individuals, NHMD (slides GB.008.04- 5); 2 individuals, UAM (slides GB.028.03-4); 1 individual, CU (slide GB.028.02). ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). — The name most likely refers to the rugged cuticular surface of the species (from Latin verruca = wart). DIFFERENTIAL DIAGNOSIS. — Fractonotus verrucosus n. comb. can be distinguished from F. caelatus and F. gilvus n. comb. (Fig. 2 A, B) by the presence of plaques (absent in the latter species). It also differs from F. gilvus n. comb. by shorter, stouter claws (anterior and posterior primary branches 4.1-6.4 μm [N =10] and 4.3-7.4 μm long [N =18], respectively, in Fractonotus verrucosus n. comb. vs 7.0- 13.0 μm [N =21] and 10.5-16.5 μm long [N =21], respectively, in F. gilvus n. comb.; compare Fig. 11 A-D). INTEGRATIVE DESCRIPTION Animals (see Table 3 for measurements) Body stubby, typically slightly rose in live animals, transparent in mounted specimens. Dorsum strongly sculptured from the first instar, although with substantial ontogenetic quantitative and qualitative variability in this trait (Fig. 1 A- F). Juveniles with ten transverse bands of numerous tu- bercles that increase in size towards the caudal end of the body, but fully formed plaques never present, legs covered with fine tubercles (Fig. 1 A). All ten bands not always easily identifiable under PCM in juveniles. In young adults, plaques present in bands 6-10, with the most prominent plaques in bands 8-10 (Fig. 1 B). In older adults, smooth spaces between the transverse bands becoming narrow and sometimes merge into larger areas (Fig. 1 C-F). Plaques larger and more numerous than in young adults, and typically developping in bands 4-10, but the most evident plaques present in the caudal part of the body (Fig.1 C-F). Tubercles more or less round or oval (Figs 3 A, B; 5 A, B), gradually increasing in size from juveniles to adults, and becoming scabrous with age (compare Figs 1 A-F; 5 A, B). Plaques, on the other hand, typically smooth and only sometimes slightly rough (Fig. 5 C, D, arrowheads); under stereomicroscope strongly opalescent. Plaques arranged symmetrically in respect to the longitudinal body axis, although deviations A from symmetry are not rare (Fig. 1 C, D). In adults, seven pairs of central plaques and four lateral plaque pairs. Central plaques triangular in shape, with their apices directed laterally and outwards. In rows where only central plaques are present, plaques slimmer and longer than in rows with lateral plaques. Central plaques present in bands aligned with legs I-III as well as in bands between those legs. First three pairs of lateral plaques in line with legs I-III and the last pair of double lateral plaques situated between legs III and IV (Fig. 1 E). Plaque configuration VII:4-2-4-2-4-2-6. Cephalic elliptical organs present but not easy to identify, given the rich cuticular sculpturing (Fig. 7 A). Eyes absent in live animals. Buccal apparatus of the Fractonotus - type (Fig. 7 B, C, E), i.e. with a long ventral AISM, and the dorsal AISM subdivided into the proximal, weakly developed thickening, and the distal, small blunt hook (Fig. 9 A). Mouth opening surrounded by six large and soft peribuccal lobes (visible only under SEM, Fig. 6 A). Oral cavity armature, visible only under SEM, consisting of a single row of minute conical teeth located on the ring fold (Fig. 8 A). Two distinct porous areas on the lateral sides of the buccal crown are visible in SEM only (Fig. 8 B). Stylet furcae of the modified Hypsibius shape, i.e. with very broad and trapezoid bases, thick arms and rounded apices (Figs 7 B, 8 D, 10 A). Buccal tube with slight lateral thickenings posterior to the stylets supports (Figs 7 B, C, E; 8 C). Round bulbus with large pharyngeal apophyses (almost as large as the placoids), and two granular macroplacoids (Figs 7 B, C, E; 8 E, F). In PCM, macroplacoids without constrictions, however slight central constrictions in both macroplacoids detectable under SEM (Fig. 8 E, F). Claws of the modified Isohypsibius - type (Figs 11 A-C; 12 A, B). Specifically, claw bases triangular, especially pronounced in claws IV (Figs 11 C, 12 B). Claw branches V-shaped, elongated and strongly curved. Apparent accessory points on the primary branches (Figs 11 A-C; 12 A, B). Weakly developed pseudolunulae present, particularly visible under the internal and anterior claws (Fig. 11 A, C). Claw septa and cuticular bars on legs absent. Eggs Roundish and smooth, deposited in exuviae (up to two eggs per exuvia recorded). MOLECULAR MARKERS The sequences for all DNA markers were of a good quality. The sequenced fragments were of the following lengths: 1.727 bp (18 S rRNA; MG 800855), 819 bp (28 S rRNA; MG 800856), and 499 bp (ITS-2; MG 800857). All markers, including the specimen without cuticular plaques, were represented by single haplotypes. The p-distances between 18S haplotypes of all available isohypsibioid species and Fractonotus verrucosus n. comb. ranged from 2.0% (I. prosostomus Thulin, 1928, EF 620404 from Denmark) to 7.1% (Hexapodibius micronyx Pilato, 1969, HQ 604915 from Italy), with an average distance of 5.2%. As our 28S rRNA primers obtain a different gene fragment to the one sequenced by previous authors, comparisons of this gene were not possible. Matrices with p-distances are provided in the Supplementary Material 2. REMARKS The vast part of the Richters Collection has been lost, thus the type material (if ever existed) is not available for examination. Moreover, no specimens from Germany were examined in this study, therefore the neotype series is not established. Hence, until the redescription from the terra typica in Germany is available, we propose to consider the description of the Scottish specimens only as the current perception of the species. PHYLOGENETIC POSITION OF FRACTONOTUS AMONG OTHER ISOHYPSIBIIDAE Both Bayesian Inference and Maximum Likelihood methods unreservedly located Fractonotus within Isohypsibioidea (Fig. 13), thus corroborating the phenotypic analysis (see above). The genus Isohypsibius s.s. (i.e. I. prosostomus and its closest relatives) appears paraphyletic with respect to Fractonotus. However, in general, all isohypsibioid lineages clearly remain in polytomy, with only the occasional sound Bayesian posterior probabilities characterising clades with morphologically similar taxa. Therefore, the exact relationships between different isohypsibioid clades remain unsolved.

Fractonotus gilvus (Biserov, 1986) n. comb. Isohypsibius gilvus Biserov, 1986: 984. REMARK Elliptical organs not always visible due to developed sculpturing in the cephalic portion of the body., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993."]}

Genus Microhypsibius Thulin, 1928 DIAGNOSIS. ��� Same as for the family Microhypsibiidae. ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� The name was most likely chosen to underline the minute size of the family members. COMPOSITION. ��� Microhypsibius bertolanii Kristensen, 1982, M. japonicus Ito, 1991, M. minimus Kristensen, 1982, M. truncatus Thulin, 1928 (type species). REMARKS See Kristensen (1982) for the most current depiction of the genus Microhypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 84, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","KRISTENSEN R. M. 1982. - New aberrant eutardigrades from homothermic springs on Disko Island, West Greenland. In: Nelson, D. R. (ed.), Proceedings of the Third International Symposium on the Tardigrada, 1980, 203 - 220."]}

Fractonotus verrucosus (Richters, 1900) n. comb. Macrobiotus ornatus var. verrucosus Richters, 1900: 41 (terra typica: Taunus, Germany). Macrobiotus scabrosus Murray, 1911: 10 (locus typicus: Clare Island, Ireland). Hypsibius verrucosus ��� Thulin 1911: 29 (Kiruna, Lapland, Sweden). ��� Marcus 1928: 180 (Vannsee, Berlin, Germany). ��� Cu��not 1932: 77 (the Vosges, France and Switzerland). ��� da Cunha 1947, 1948: 6, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal). Calohypsibius verrucosus ��� Thulin 1928: 239 (Sweden). Calohypsibius scabrosus Thulin, 1928: 239 (Sweden). Hypsibius scabrosus Cu��not, 1932: 77 (the Vosges, France and Switzerland). ��� da Cunha 1947, 1948: 6, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal). Hypsibius (Calohypsibius) verrucosus ��� Marcus 1936: 285 (Schwarzwald, Germany). ��� Franceschi 1951-1952: 12 (Val Camonica, Italy). ��� Mihelčič 1953: 247 (Tirol, Austria). ��� Fontoura 1981: 18 (Viseu, Arga, Amarante, Portugal). Hypsibius placophorus da Cunha, 1943: 1 (locus typicus: Cabril do Ceira, Portugal); 1947, 1948: 2, 2 (Serra d���Arga, Serra do Bu��aco, Serra da Estrela, Serra da Lous��, Portugal) n. syn. LOCALITIES. ��� Scotland. Creag Meagaidh (56��57���10������ N, 4��30���35������ W; 291 m a.s.l.; collection date: 1.X.2014), lichens from moorland rocks; Scotland, Hebrides, Isle of Lewis, Loch nan Muilne (58��21���08������ N, 6��35���14������ W; 27 m a.s.l.; collection date: 29.VII.2015), moss and lichen mix from stones on the lakeshores; Invermoriston, Loch Ness (57��12���39������ N, 4��35���59������ W; 20 m a.s.l.; 25.X.2015; Brian Blagden leg.), moss and lichen mix from stones on the lakeshores. MATERIAL EXAMINED. ��� 23 individuals, UJ (19 specimens, including one simplex, on slides GB.005.03-12, GB.008.01-3, GB.028.01- 2 and 4 specimens on two SEM stubs); 2 individuals, MNHN (slides GB.005.01-2); 3 individuals, NHMD (slides GB.008.04- 5); 2 individuals, UAM (slides GB.028.03-4); 1 individual, CU (slide GB.028.02). ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� The name most likely refers to the rugged cuticular surface of the species (from Latin verruca = wart). DIFFERENTIAL DIAGNOSIS. ��� Fractonotus verrucosus n. comb. can be distinguished from F. caelatus and F. gilvus n. comb. (Fig. 2 A, B) by the presence of plaques (absent in the latter species). It also differs from F. gilvus n. comb. by shorter, stouter claws (anterior and posterior primary branches 4.1-6.4 ��m [N =10] and 4.3-7.4 ��m long [N =18], respectively, in Fractonotus verrucosus n. comb. vs 7.0- 13.0 ��m [N =21] and 10.5-16.5 ��m long [N =21], respectively, in F. gilvus n. comb.; compare Fig. 11 A-D). INTEGRATIVE DESCRIPTION Animals (see Table 3 for measurements) Body stubby, typically slightly rose in live animals, transparent in mounted specimens. Dorsum strongly sculptured from the first instar, although with substantial ontogenetic quantitative and qualitative variability in this trait (Fig. 1 A- F). Juveniles with ten transverse bands of numerous tu- bercles that increase in size towards the caudal end of the body, but fully formed plaques never present, legs covered with fine tubercles (Fig. 1 A). All ten bands not always easily identifiable under PCM in juveniles. In young adults, plaques present in bands 6-10, with the most prominent plaques in bands 8-10 (Fig. 1 B). In older adults, smooth spaces between the transverse bands becoming narrow and sometimes merge into larger areas (Fig. 1 C-F). Plaques larger and more numerous than in young adults, and typically developping in bands 4-10, but the most evident plaques present in the caudal part of the body (Fig.1 C-F). Tubercles more or less round or oval (Figs 3 A, B; 5 A, B), gradually increasing in size from juveniles to adults, and becoming scabrous with age (compare Figs 1 A-F; 5 A, B). Plaques, on the other hand, typically smooth and only sometimes slightly rough (Fig. 5 C, D, arrowheads); under stereomicroscope strongly opalescent. Plaques arranged symmetrically in respect to the longitudinal body axis, although deviations A from symmetry are not rare (Fig. 1 C, D). In adults, seven pairs of central plaques and four lateral plaque pairs. Central plaques triangular in shape, with their apices directed laterally and outwards. In rows where only central plaques are present, plaques slimmer and longer than in rows with lateral plaques. Central plaques present in bands aligned with legs I-III as well as in bands between those legs. First three pairs of lateral plaques in line with legs I-III and the last pair of double lateral plaques situated between legs III and IV (Fig. 1 E). Plaque configuration VII:4-2-4-2-4-2-6. Cephalic elliptical organs present but not easy to identify, given the rich cuticular sculpturing (Fig. 7 A). Eyes absent in live animals. Buccal apparatus of the Fractonotus - type (Fig. 7 B, C, E), i.e. with a long ventral AISM, and the dorsal AISM subdivided into the proximal, weakly developed thickening, and the distal, small blunt hook (Fig. 9 A). Mouth opening surrounded by six large and soft peribuccal lobes (visible only under SEM, Fig. 6 A). Oral cavity armature, visible only under SEM, consisting of a single row of minute conical teeth located on the ring fold (Fig. 8 A). Two distinct porous areas on the lateral sides of the buccal crown are visible in SEM only (Fig. 8 B). Stylet furcae of the modified Hypsibius shape, i.e. with very broad and trapezoid bases, thick arms and rounded apices (Figs 7 B, 8 D, 10 A). Buccal tube with slight lateral thickenings posterior to the stylets supports (Figs 7 B, C, E; 8 C). Round bulbus with large pharyngeal apophyses (almost as large as the placoids), and two granular macroplacoids (Figs 7 B, C, E; 8 E, F). In PCM, macroplacoids without constrictions, however slight central constrictions in both macroplacoids detectable under SEM (Fig. 8 E, F). Claws of the modified Isohypsibius - type (Figs 11 A-C; 12 A, B). Specifically, claw bases triangular, especially pronounced in claws IV (Figs 11 C, 12 B). Claw branches V-shaped, elongated and strongly curved. Apparent accessory points on the primary branches (Figs 11 A-C; 12 A, B). Weakly developed pseudolunulae present, particularly visible under the internal and anterior claws (Fig. 11 A, C). Claw septa and cuticular bars on legs absent. Eggs Roundish and smooth, deposited in exuviae (up to two eggs per exuvia recorded). MOLECULAR MARKERS The sequences for all DNA markers were of a good quality. The sequenced fragments were of the following lengths: 1.727 bp (18 S rRNA; MG 800855), 819 bp (28 S rRNA; MG 800856), and 499 bp (ITS-2; MG 800857). All markers, including the specimen without cuticular plaques, were represented by single haplotypes. The p-distances between 18S haplotypes of all available isohypsibioid species and Fractonotus verrucosus n. comb. ranged from 2.0% (I. prosostomus Thulin, 1928, EF 620404 from Denmark) to 7.1% (Hexapodibius micronyx Pilato, 1969, HQ 604915 from Italy), with an average distance of 5.2%. As our 28S rRNA primers obtain a different gene fragment to the one sequenced by previous authors, comparisons of this gene were not possible. Matrices with p-distances are provided in the Supplementary Material 2. REMARKS The vast part of the Richters Collection has been lost, thus the type material (if ever existed) is not available for examination. Moreover, no specimens from Germany were examined in this study, therefore the neotype series is not established. Hence, until the redescription from the terra typica in Germany is available, we propose to consider the description of the Scottish specimens only as the current perception of the species. PHYLOGENETIC POSITION OF FRACTONOTUS AMONG OTHER ISOHYPSIBIIDAE Both Bayesian Inference and Maximum Likelihood methods unreservedly located Fractonotus within Isohypsibioidea (Fig. 13), thus corroborating the phenotypic analysis (see above). The genus Isohypsibius s.s. (i.e. I. prosostomus and its closest relatives) appears paraphyletic with respect to Fractonotus. However, in general, all isohypsibioid lineages clearly remain in polytomy, with only the occasional sound Bayesian posterior probabilities characterising clades with morphologically similar taxa. Therefore, the exact relationships between different isohypsibioid clades remain unsolved., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on pages 77-82, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","MURRAY J. 1911. - Clare Island Survey. 37: Arctiscoida. Proceedings of the Royal Irish Academy 31 (37): 1 - 16.","THULIN G. 1911. - Beitage zur Kenntnis der Tardigradenfauna Schwedens. Arkiv for Zoologi 7 (16): 1 - 60.","MARCUS E. 1928. - Spinnentiere oder Arachnoidea. IV: Bartierchen (Tardigrada). Tierwelt Deutschlands und der angrenzenden Meeresteile Jena 12: 1 - 230.","CUENOT L. 1932. - Tardigrades, in LECHEVALIER P. (ed.). Faune de France 24: 1 - 96.","CUNHA A. X. 1947 da. - Tardigrados da Fauna Portuguesa III. Memorias e estudos do Museu zoologico da Universidade de Coimbra 177: 1 - 9.","CUNHA A. X. DA 1948. - Tardigrados da Fauna Portuguesa IV. Memorias e estudos do Museu zoologico da Universidade de Coimbra 188: 1 - 8.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","MARCUS E. 1936. - Tardigrada. Das Tierreich, de Gruyter & Co., Berlin and Leipzig 66: 1 - 340.","FRANCESCHI T. 1951 - 1952. - Contributo alla conoscenza dei Tardigradi d'Italia. Bollettino dei Musei e degli Istituti Biologici dell'Universita di Genova 24 (149): 5 - 15.","MIHELCIC F. 1953. - Contribucion al conocimiento de los tardigrados con especial consideracion de los tardigrados de Osttirol (II). Anales de Edafologia y Fisiologia Vegetal 12 (5): 431 - 479.","FONTOURA A. P. 1981. - Contribution pour l'etude des tardigrades terrestres du Portugal, avec la description d'une nouvelle espece du genre Macrobiotus. Publicac o es do Instituto de Zoologia ' Dr Augusto Nobre', Faculdade de Ciencias do Porto 160: 1 - 24.","CUNHA A. X. DA 1943. - Un Tardigrade nouveau de Portugal: Hypsibius placophorus sp. n. Memorias e estudos do Museu zoologico da Universidade de Coimbra 155: 1 - 5.","MICHALCZYK L. & KACZMAREK L. 2005. - The first record of the genus Calohypsibius Thulin, 1928 (Eutardigrada: Calohypsibiidae) from Chile (South America) with a description of a new species Calohypsibius maliki. New Zealand Journal of Zoology 32: 287 - 292. https: // doi. org / 10.1080 / 03014223.2005.9518420","NELSON D. R. & MCGLOTHLIN K. L. 1996. - A new species of Calohypsibius (Phylum Tardigrada, Eutardigrada) from Roan Mountain, Tennessee-North Carolina, U. S. A. Zoological Journal of the Linnean Society 116: 167 - 174. https: // doi. org / 10.1006 / zjls. 1996.0014","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993.","KACZMAREK L., ZAWIERUCHA K., SMYKLA J. & MICHALCZYK L. 2012. - Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biology 35: 1013 - 1026. https: // doi. org / 10.1007 / s 00300 - 011 - 1149 - 0","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345."]}

Fractonotus gilvus (Biserov, 1986) n. comb. Isohypsibius gilvus Biserov, 1986: 984. REMARK Elliptical organs not always visible due to developed sculpturing in the cephalic portion of the body.

Genus Fractonotus Pilato, 1998 Fractonotus Pilato, 1998: 132. AMENDED DIAGNOSIS. ��� Small isohypsibiid (rarely exceeding 200 ��m, Fig. 1). Cephalic elliptical organs present (Fig. 7 A). Dorsum and limbs covered with densely arranged, blunt protuberances. Six peribuccal lobes present (Fig. 6 A). Apophyses for the insertion of stylet muscles (AISM) asymmetrical with respect to the frontal plane ��� the dorsal apophysis subdivided into two portions: the anterior portion in the shape of a slightly convex longitudinal thickening (and the posterior portion as weakly developed blunt hook); the ventral apophysis in the shape of a mild and long ridge (Fig. 9 A). Very large pharyngeal apophyses and placoids in the muscle pharynx. Stylet furcae of the Fractonotus - type, i.e. with broad, trapezoid base, thin arms and rounded apices (Figs 8 D, 10 A). Claws of the modified Isohypsibius - type, with triangular bases and strongly curved claw branches (Fig. 12 A, B). Accessory points symmetrical or occasionally asymmetrical. Smooth eggs laid in exuviae. DIFFERENTIAL DIAGNOSIS. ��� Fractonotus shares pronounced cuticular sculpturing with some species of six other parachelan genera: Calohypsibius Thulin, 1928, some Ramazzottius Binda & Pilato, 1986, Hypsibius Ehrenberg, 1848, Pilatobius Bertolani, Guidetti, Marchioro, Altiero, Rebecchi, Cesari, 2014, Doryphoribius Pilato, 1969 and Isohypsibius Thulin, 1928, but it can be readily distinguished from these genera by the morphology of the stylet furcae (square/trapezoid in Fractonotus vs narrower and more rectangular in the latter genera; compare Figs 7 B, D; 10 A-C). Furthermore, Fractonotus differs from Ramazzottius, Hypsibius and Pilatobius by having Isohypsibius -like claws (claws of the latter genera are of the Hypsibius or of the modified Hypsibius- type). Moreover, the genus differs specifically from: ��� Calohypsibius Thulin, 1928 (Hypsibioidea: Calohypsibiidae), by having a different type of cuticular sculpture (roundish or oval tubercles covering the entire dorsum and limbs with smooth dorsal pebble-shaped plaques in Fractonotus, Fig. 5 A-D vs multangular or star-like tubercles and occasional spines arranged less densely in Calohypsibius, Fig. 5 E, F), different structures surrounding the mouth opening (six soft and large peribuccal lobes in Fractonotus, Fig. 6 A vs six small well defined papulae in Calohypsibius, Fig. 6 B), a reversed morphology of the dorsal apophysis for the insertion of stylet muscles (an anterior thickening and a tiny posterior hook in Fractonotus, Fig. 7 E-G vs an anterior large blunt hook and a slight posterior thickening in Calohypsibius, Fig. 9 A, B), and by claw morphology (modified Isohypsibius - type claws with pseudolunulae, triangular bases, and elongated, strongly curved branches with conspicuous accessory points in Fractonotus, Figs 11 A-D; 12 A, B vs very small, rigid, with the base width equal to the sum of the primary and secondary branch widths, with the vertical septum between the two branches, and without pseudolunulae in Calohypsibius, Figs 11 E; 12 C, D). ��� Doryphoribius Pilato, 1969 (Isohypsibioidea: Isohypsibiidae), by the presence of elliptical organs on the head (absent in Doryphoribius), and by the absence of the ventral lamina on the buccal tube (ventral lamina present in Doryphoribius). ��� Isohypsibius Thulin, 1928 (Isohypsibioidea: Isohypsibiidae), by the presence of elliptical organs on the head (absent in Isohypsibius), a different shape of AISM (asymmetrical with respect to the frontal plane in Fractonotus, Fig. 7 E vs ridges symmetrical with respect to the frontal plane Isohypsibius, Figs 7 H, I; 9 A, C), and by the claw morphology (modified Isohypsibius - type claws with triangular bases, especially well-marked on the fourth pair of legs, in Fractonotus vs Isohypsibius - type claws with stalk-like bases in Isohypsibius, Figs 11 H, I; 12 E, F). COMPOSITION AND REMARKS Currently only three species, Fractonotus caelatus (the nominal taxon), F. verrucosus n. comb. and F. gilvus n. comb., are assigned to the genus. The three species are placed in the single genus because they share a number of taxonomically important traits: AISM shape, the presence of elliptical cephalic organs, two granular macroplacoids in the pharynx, and the type of cuticular sculpturing. On the other hand, Pilato (1998) described the claws of F. caelatus as of the Microhypsibius type, whereas claws in F. verrucosus n. comb. and F. gilvus n. comb. are closer to Isohypsibius type claws. Therefore, given the differences in claw morphology, there is a possibility that F. verrucosus n. comb. and F. gilvus n. comb. belong to a new isohypsibioid genus, and are only delusively similar to Fractonotus due to convergent evolution in the remaining traits. Nevertheless, the majority of traits suggest that all three species should be placed in Fractonotus. Biserov (1986) misinterpreted the AISM of F.gilvus n. comb. (Fig. 3 therein) as Isohypsibius - type AISM, but our observations of the type material confirm that the species has the AISM of the Fractonotus - type. However, there are more Isohypsibius and Hypsibius species, that exhibit cuticular sculpturing similar to that of Fractonotus. Thus, they may in fact belong to Fractonotus rather than Isohypsibius or Hypsibius. Nevertheless, we refrained from enacting more transfers, as a careful examination of individuals is needed to confirm whether these species, in addition to cuticular sculpturing, also exhibit other characteristics of Fractonotus., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 76, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993."]}

Genus Calohypsibius Thulin, 1928 Calohypsibius Thulin, 1928: 238. DIAGNOSIS. ��� Same as for the family Calohypsibiidae. ETYMOLOGY (NOT PROVIDED IN THE ORIGINAL DESCRIPTION). ��� After Schuster et al. (1980), from Ancient Greek ����^��ς (k��llos) = beauty; derivatives calli-, callo- mean beautiful, pretty. Thulin most likely wanted to highlight the cuticular sculpturing, which is exceptionally complex, rich and unusual among Eutardigrada. COMPOSITION AND REMARKS Currently only three species, namely C. maliki Michalczyk & Kaczmarek, 2005 (Fig. 4 B), C. ornatus (Richters, 1900) (type species; Figs 3 C, D, 4 A), and C. schusteri Nelson & McGlothlin, 1996 (Fig. 4 C), are ascribed to the family. Nevertheless, Barto�� (1940) already described the remarkable variability within European records of the ornatus complex, which raises justifiable concerns as to whether C. ornatus encompasses only a single species. Further, as suggested by Pilato (1998), it is very likely that the genus comprises many more species than currently recognised. However, a systematic integrative study based on extensive sampling is needed to verify this hypothesis., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","SCHUSTER R. O., NELSON D. R., GRIGARICK A. A. & CHRISTENBERRY D. 1980. - Systematic criteria of the Eutardigrada. Transactions of the American Microscopical Society 99: 284 - 303.","MICHALCZYK L. & KACZMAREK L. 2005. - The first record of the genus Calohypsibius Thulin, 1928 (Eutardigrada: Calohypsibiidae) from Chile (South America) with a description of a new species Calohypsibius maliki. New Zealand Journal of Zoology 32: 287 - 292. https: // doi. org / 10.1080 / 03014223.2005.9518420","RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","NELSON D. R. & MCGLOTHLIN K. L. 1996. - A new species of Calohypsibius (Phylum Tardigrada, Eutardigrada) from Roan Mountain, Tennessee-North Carolina, U. S. A. Zoological Journal of the Linnean Society 116: 167 - 174. https: // doi. org / 10.1006 / zjls. 1996.0014","BARTOs E. 1940. - Uber die Variation der Art Hypsibius ornatus Richt. (Tardigrada). Zoologische Jahrbucher abteilung fur Systematik Okologie und Geographie der Tiere 73: 369 - 384.","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134."]}

TAXONOMIC ACCOUNT OF THE CALOHYPSIBIIDAE SENSU STRICTO Superfamily HYPSIBIOIDEA Pilato, 1969 (emended by Bertolani et al. 2014a) Family CALOHYPSIBIIDAE Pilato, 1969 (emended by Bertolani et al. 2014a) EMENDED DIAGNOSIS. ��� Very small eutardigrades (typically below 150 ��m) with elliptical organs on the head. Dorsum covered with irregular, multangular protuberances, and sometimes also with spines (Figs 3 C, D; 4; 5 E, F). Claws miniaturised, but not reduced, of the Calohypsibius - type, i.e. asymmetrical with respect to the sequence of primary and secondary branches (2-1-2-1), but similar in their size, with bases as large as the sum of the primary and secondary branch widths, but devoid of sutures. Pseudolunulae absent. Accessory points symmetrical (Figs 11 E; 12 C, D). Six peribuccal papulae present (Fig. 6 B). AISM asymmetrical with respect to the frontal plane, with the dorsal apophysis subdivided in two portions of different shape (Fig. 9 B). Stylet furcae of the Hypsibius - type (Fig. 10 B). Pharyngeal apophyses smaller than the tiny granular macroplacoids. Smooth eggs laid in exuviae. COMPOSITION. ��� A monotypic family, comprising the genus Calohypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on page 83, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BERTOLANI R., GUIDETTI R., MARCHIORO T., ALTIERO T., REBEC- CHI L. & CESARI M. 2014 a. - Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110 - 126. https: // doi. org / 10.1016 / j. ympev. 2014.03.006"]}

TAXONOMIC ACCOUNT OF THE MICROHYPSIBIIDAE SENSU STRICTO Superfamily HYPSIBIOIDEA Pilato, 1969 (emended by Bertolani et al. 2014a) Family MICROHYPSIBIIDAE Pilato, 1998 EMENDED DIAGNOSIS. ��� Very small eutardigrades (typically below 150 ��m in length) without elliptical organs on the head. Cuticle smooth. Claws minute and asymmetrical with respect to the sequence of primary and secondary branches (2-1-2-1), with thin bases continuous with the primary branches. External and internal, and anterior and posterior claws different in shape but similar in size. Pseudolunulae absent. Accessory points symmetrical (Fig. 11 G). Peribuccal papulae not visible under PCM. AISM asymmetrical with respect to the frontal plane, with the dorsal apophysis subdivided in two portions of different shapes (Fig. 9 A). Stylet furcae of the Hypsibius - type. Pharyngeal apophyses similar in size to macroplacoids. Smooth eggs laid in exuviae. COMPOSITION. ��� A monotypic family, comprising the genus Microhypsibius., Published as part of G��siorek, Piotr, Morek, Witold, Stec, Daniel, Blagden, Brian & Michalczyk, ��ukasz, 2019, Revisiting Calohypsibiidae and Microhypsibiidae: Fractonotus Pilato, 1998 and its phylogenetic position within Isohypsibiidae (Eutardigrada: Parachela), pp. 71-89 in Zoosystema 41 (6) on pages 83-84, DOI: 10.5252/zoosystema2019v41a6, http://zenodo.org/record/3718524, {"references":["PILATO G. 1969 a. - Evoluzione e nuova sistemazione degli Eutardigrada. Bolletino di Zoologia 36: 327 - 345.","BERTOLANI R., GUIDETTI R., MARCHIORO T., ALTIERO T., REBEC- CHI L. & CESARI M. 2014 a. - Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution 76: 110 - 126. https: // doi. org / 10.1016 / j. ympev. 2014.03.006","PILATO G. 1998. - Microhypsibiidae, new family of eutardigrades, and description of the new genus Fractonotus. Spixiana 21 (2): 129 - 134.","RICHTERS F. 1900. - Beitrage zur Kenntnis der Fauna der Umgebung von Frankfurt a. M. Bericht der Senckenbergischen Naturforschenden gesellschaft in Frankfurt am Main 21 - 44.","BISEROV V. I. 1986. - Terrestrial water bears from the North Caucasus. 2. Eutardigrada. Zoologicheskii Zhurnal 65 (7): 981 - 993.","MARCUS E. 1928. - Spinnentiere oder Arachnoidea. IV: Bartierchen (Tardigrada). Tierwelt Deutschlands und der angrenzenden Meeresteile Jena 12: 1 - 230.","THULIN G. 1928. - Uber die phylogenie und das system der tardigraden. Hereditas 11: 207 - 266.","KACZMAREK L., ZAWIERUCHA K., SMYKLA J. & MICHALCZYK L. 2012. - Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biology 35: 1013 - 1026. https: // doi. org / 10.1007 / s 00300 - 011 - 1149 - 0"]}

Mesobiotus romani sp. nov. (Tables 3���4, Figs 1���32) Material examined: Holotype and 30 paratypes (19 animals and 11 eggs). Specimens mounted on microscope slides in Hoyer���s medium, fixed on SEM stubs or processed for DNA sequencing. Description of the new species. Animals (measurements and statistics in Table 3). Body white in living specimens and transparent after fixation (Figs 1���3). Eyes absent after fixation in all studied specimens. Cuticle smooth, i.e. without gibbosities, papillae, spines, sculpturing or pores. Granulation present on external cuticle of all legs (Figs 4���9). Under SEM granulation visible as aggregates consisted of two to a dozen or so microgranules (Figs 6, 9). Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten peribuccal lamellae (Fig. 10). Mouth antero-ventral. The oral cavity armature well developed and with three bands of teeth (Figs 11���13). The first band of teeth comprises numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae (Fig. 11, arrowhead). The second band of teeth, situated between the ring fold and the third band of teeth, contains ridges parallel to the main axis of the buccal tube that are larger than in the granules of the first band (Fig. 12, arrow). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 12���13). The third band of teeth are divided into the dorsal and the ventral portion. Under PCM, dorsal teeth are visible as two lateral and one median transverse ridges (Fig. 12, indented arrowhead), whereas the ventral portion as two lateral ridges and two roundish median teeth (Fig. 13, empty arrowhead). In addition, on the ventral side some barely visible teeth (in shape of granules in LM) are present between second and third rows of teeth. Pharyngeal bulb spherical, with triangular apophyses, three rod���shaped macroplacoids, and a triangular microplacoid. Macroplacoid length sequence 3��1>2. The first macroplacoid narrower anteriorly, the second without constrictions and the third with a sub-terminal constriction (Fig. 14, arrowhead). Claws of the hufelandi type (Figs 15���18); internal, external, anterior and posterior identical in shape. Primary branches with distinct accessory points. Lunules under claws I���III smooth and dentate under claws IV (Figs 15��� 18). Thin cuticular bars under claws I���III present (Fig. 15, arrow). Other cuticular structures on legs absent. Eggs (measurements and statistics in Table 4). Laid freely, white, spherical and ornamented (Figs 19���20). Egg processes in the shape of wide, sharpened cones sometimes bifurcated at the tip or terminated by several short, thin and flexible filaments, visible both under PCM and SEM (Figs 25���32). The process surface is smooth with slight undulations poorly visible under PCM but clearer under SEM. Labyrinthine layer between process walls visible under PCM as a clear reticular pattern with the mesh (0.3���1.5 ��m in diameter), slightly increased in size from the tip to the base (Figs 25���28). In some processes, a slightly larger, bubble-mesh are present near the tip (Figs 25���28, arrowheads). Under SEM, clearly visible pores are present on the processes, but mainly toward the base (Fig. 24, arrowheads). Each process surrounded by a crown of thickenings, which form small ribs and then wrinkles on the egg surface (Figs 21, 22, 24, arrows). Under PCM, the surface between processes appears dotted or with small wrinkles (Figs 21���22), while under SEM, these are visible as small pores and ridges (Fig. 24). DNA sequences. The DNA was successfully extracted from only one of the three individuals used for the analysis. Nevertheless, from this one paragenophore we obtained sequences of very good quality for all four of the previously mentioned molecular markers, which are as follow: The 18S rRNA sequence (GenBank: MH197158), 1020 bp long; The 28S rRNA sequence (GenBank: MH197151), 808 bp long; The ITS-2 sequence (GenBank: MH197150), 486 bp long; The COI sequence (GenBank: MH195149), 658 bp long; Type locality: 00��45'34''N, 79��35'24W; 98 m asl: Tumbes-Choc��-Magdalena hotspot, Ecuador, Esmeraldas Province, next to E20 road to Quinind��, out of Chinca city, mixed moss and lichen on rock, collectors: Milena Roszkowska and Łukasz Kaczmarek. Etymology: The first author takes great pleasure in dedicating this new species to her friend���Roman Tarasewicz. Type depositories: Holotype: slide EC1319/6 (with six paratypes) and seven paratypes (two specimens and five eggs) (slides: EC1319/1, EC1319/2, EC1319/3, EC1319/8) are deposited at the Department of Animal Taxonomy and Ecology, Faculty of Biology, Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Umultowska 89, 61-614 Poznań, Poland; nine paratypes (six specimens and three eggs) (slides: EC1319/5, EC1319/7, EC1319/9) are deposited at the Museo Ecuatoriano de Ciencias Naturales, Secci��n de Entomolog��a, Rumipamba 341 y Av. de los Shyris, Quito, Ecuador. Phenotypic differential diagnosis. Based on the presence of reticulated, conical egg processes surrounded by crown of thickening and the absence of areolation on the egg surface, M. romani sp. nov. is most similar to the following 10 species: M. binieki (Kaczmarek, Gołdyn, Prokop & Michalczyk, 2011), M. coronatus (de Barros, 1942), M. dimentmani (Pilato, Lisi & Binda, 2010), M. patiens (Pilato, Binda, Napolitano & Moncada, 2000), M. perfidus (Pilato & Lisi, 2009), M. philippinicus Mapalo, Stec, Mirano-Bascos & Michalczyk, 2016, M. pseudoblocki Roszkowska, Stec, Ciobanu & Kaczmarek, 2016, M. pseudocoronatus (Pilato, Binda & Lisi, 2006), M. pseudopatiens Kaczmarek & Roszkowska, 2016, M. radiatus (Pilato, Binda & Catanzaro, 1991), M. rigidus (Pilato & Lisi, 2006), M. simulans (Pilato, Binda, Napolitano & Moncada, 2000) and M. wuzhishanensis (Yin, L. Wang & X. Li, 2011). Despite the similarities, M. romani sp. nov differs specifically from: M. binieki, only reported from the type locality in Bulgaria (Kaczmarek et al. 2011), by: the presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. binieki vs. 3��1> 2 in M. romani sp. nov. ), higher pt of: buccal tube external width, macroplacoid 2 length, microplacoid length, claw I���III primary and secondary external branches (see Tables 3 and 1 in Kaczmarek et al. (2011) for the exact differences), different shape of the egg processes (long, smooth flexible spines, with very wide bases in M. binieki vs. typically developed cones in M. romani sp. nov. ), presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, smaller egg diameter without processes (85.1���94.5 ��m in M. binieki vs. 62.0���85.0 ��m in M. romani sp. nov. ), longer egg processes (9.8���14.5 ��m in M. binieki vs. 14.6���21.4 ��m in M. romani sp. nov. ), wider egg process bases (6.5���9.0 ��m in M. binieki vs. 9.6���12.7 ��m in M. romani sp. nov. ) and smaller number of processes on the egg circumference (27���32 in M. binieki vs. 16���17 in M. romani sp. nov. ). M. coronatus, reported from a few localities in South America (de Barros 1942; Pilato et al. 2000; Kaczmarek et al. 2015), by: the absence of eyes*, presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. coronatus vs. 3��1> 2 in M. romani sp. nov. ), presence of several short, thin, and flexible filaments on the top of egg processes, larger egg diameter with and without processes (55.0���71.0 ��m, and 42.0���55.0 ��m respectively in M. coronatus vs. 95.4���116.1 ��m and 62.0���85.0 ��m respectively in M. romani sp. nov. ), longer egg processes (ca. 9.2 ��m in M. coronatus vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. dimentmani, reported from the type locality in Israel (Pilato et al. 2010), by: teeth of the third band visible as two lateral ridges and two roundish median teeth (three ridges in M. dimentmani), first macroplacoid narrower anteriorly (central narrowing in M. dimentmani), anterior and posterior claws IV of a clearly different length, shorter anterior and posterior claws IV, and lower pt of anterior and posterior primary and secondary branches of claws IV (see Tables 3 and 4 in Pilato et al. (2010) for the exact differences). M. patiens, recorded from a few localities in Italy (Pilato et al. 2000), by: the presence of dentate lunules IV, and presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip. M. perfidus, reported from three localities in the Seychelles (Pilato & Lisi 2009), by: the presence of first row of teeth in oral cavity, the absence of tubercles on dorsal cuticle, absence of eyes*, presence of granulation on legs I���III, presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, and higher number of processes on the egg circumference (11���13 in M. perfidus vs. 16���17 in M. romani sp. nov. ). M. philippinicus, reported from the type locality in Philippines (Mapalo et al. 2016), by: the absence of eyes*, no granulation visible under SEM, different macroplacoid length sequence (1>3> 2 in M. philippinicus vs. 3��1> 2 in M. romani sp. nov.), absence of granulation on the filaments at the tip of the egg processes, and longer egg processes (2.1���13.7 ��m in M. philippinicus vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. pseudoblocki, reported from the type locality in Argentina (Roszkowska et al. 2016), by: the absence of eyes*, presence of granulation on legs I���IV, different macroplacoid length sequence (1>3> 2 in M. pseudoblocki vs. 3��1> 2 in M. romani sp. nov.), presence of dentate lunules IV, larger internal secondary branch of claw III, higher pt of: stylet support insertion point, buccal tube external width, claw I���III external primary and internal secondary external branches, claw II���III external secondary branches (see Table 1 and 3 in Roszkowska et al. (2016) for the exact differences), larger egg diameter with processes (83.4���88.3 ��m in M. pseudoblocki vs. 95.4���116.1 ��m in M. romani sp. nov. ), longer egg processes (10.5���12.8 ��m in M. pseudoblocki vs. 14.6���21.4 ��m in M. romani sp. nov. ), wider egg process bases (5.8���7.6 ��m in M. pseudoblocki vs. 9.6���12.7 ��m in M. romani sp. nov. ), and smaller number of processes on the egg circumference (20���24 in M. pseudoblocki vs. 16���17 in M. romani sp. nov. ). M. pseudocoronatus, reported from the type locality on Seychelles (Pilato et al. 2006), by: the absence of tubercles on dorsal cuticle, absence of eyes*, higher number of processes on egg circumference (ca. 14 in M. pseudocoronatus vs. 16���17 in M. romani sp. nov. ), larger eggs with and without processes (ca. 82.3 and ca. 50.1 ��m respectively in M. pseudocoronatus vs. 95.4���116.1 and 62.0���85.0 ��m in M. romani sp. nov. ), and longer egg processes (10.9���12.7 ��m in M. pseudocoronatus vs. 14.6���21.4 ��m in M. romani sp. nov ). M. pseudopatiens, reported from the type locality in Costa Rica (Kaczmarek & Roszkowska 2016), by: the presence of first row of teeth in oral cavity, different macroplacoid length sequence (1>3> 2 in M. pseudopatiens vs. 3��1> 2 in M. romani sp. nov. ), presence of granulation on legs I���III, presence of dentate lunules IV, larger internal secondary branch of claw I and III, higher pt of: claw I internal secondary branches, claw II external primary and internal secondary branches, claw III external and internal secondary branches (see Table 1 and 3 in Kaczmarek & Roszkowska (2016) for the exact differences), higher number of processes on egg circumference (11���12 in M. pseudopatiens vs. 16���17 in M. romani sp. nov. ), and larger egg diameter with and without processes (80.4���88.0 and 55.5���59.3 ��m respectively in M. pseudopatiens vs. 95.4���116.1 and 62.0���85.0 ��m in M. romani sp. nov. ). M. radiatus, reported only from Tanzania, Democratic Republic of Congo and Kenya (Pilato et al. 1991, Stec et al. in review), by: smooth cuticle under SEM, absence of spurs on claws I���III, absence of pores on the top of egg processes, lack of microgranules on the filaments on the top of egg processes, higher number of processes on the egg circumference (10���12 in M. radiatus vs. 16���17 in M. romani sp. nov. ), and narrower egg processes (14.5���22.5 in M. radiatus vs. 9.6���12.7 in M. romani sp. nov. ). M. rigidus, reported from the type locality in New Zealand (Pilato & Lisi 2006), by: the presence of granulation on legs I���III, the presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, higher number of processes on egg circumference (ca. 12 in M. rigidus vs. 16���17 in M. romani sp. nov. ), and larger egg diameter with processes (ca. 91.0 ��m in M. rigidus vs. 95.4���116.1 ��m in M. romani sp. nov. ). M. simulans, recorded from a few localities in Italy and Israel (Pilato et al. 2000; Pilato et al. 2010), by: the absence of eyes*, presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, longer egg processes (up to 11 ��m in M. simulans vs. 14.6���21.4 ��m in M. romani sp. nov. ). M. wuzhishanensis, reported from the type locality in China (Yin et al. 2011), by: the absence of eyes*, different macroplacoid length sequence (3>1> 2 in M. wuzhishanensis vs. 3��1> 2 in M. romani sp. nov. ), egg shell surface between processes dotted or with small wrinkles, and processes never trifurcated. *character uncertain; Hoyer���s medium has the potential to cause eyes to ���disappear���. Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances between the Mesobiotus romani sp. nov. and species of the genus Mesobiotus, for which sequences are available from GenBank (see Table 2 for details), are as follows (from the most to the least conservative): 18S rRNA: 1.1���5.9% (3.9% on average), with the most similar being M. philippinicus from Philippines (KX129793) and the least similar being M. cf. mottai from Antarctica (KT226072); 28S rRNA: 6.8���9.9% (8.5% on average), with the most similar being M. philippinicus from Philippines (KX129794) and the least similar being M. ethiopicus Stec & Kristensen, 2017 from Ethiopia (MF678792); COI: 19.6���23.4% (21.7% on average), with the most similar being M. insanis Mapalo, Stec, Mirano-Bascos & Michalczyk, 2017 from Philippines (MF441491) and the least similar being M. hilariae Vecchi, Cesari, Bertolani, J��nsoon, Rebecchi & Guidetti, 2016 from Antarctica (KT226108); ITS-2: 25.5���28.6% (27.1% on average), with the most similar being M. philippinicus from Philippines (KX129795) and the least similar being M. insanis from Philippines (MF441490)., Published as part of Roszkowska, Milena, Stec, Daniel, Gawlak, Magdalena & Kaczmarek, ��ukasz, 2018, An integrative description of a new tardigrade species Mesobiotus romani sp. nov. (Macrobiotidae: harmsworthi group) from the Ecuadorian Pacific coast, pp. 550-564 in Zootaxa 4450 (5) on pages 553-560, DOI: 10.11646/zootaxa.4450.5.2, http://zenodo.org/record/1445026, {"references":["Kaczmarek, L., Goldyn, B., Prokop, Z. M. & Michalczyk, L. (2011) New records of Tardigrada from Bulgaria with the description of Macrobiotus binieki sp. nov. (Eutardigrada: Macrobiotidae) and a key to the species of the harmsworthi group. Zootaxa, 2781, 29 - 39.","De Barros, R. (1942) Tardigrados de Estado de Sao Paulo, Brasil. II. Genero Macrobiotus. Revista Brasileira de Biologia, 2, 373 - 386.","Pilato, G., Lisi, O. & Binda, M. G. (2010) Tardigrades of Israel with description of four new species. Zootaxa, 2665, 1 - 28.","Pilato, G., Binda, M. G., Napolitano, A. & Moncada, E. (2000) The specific value of Macrobiotus coronatus De Barros 1942, and description of two new species of the harmsworthi group (Eutardigrada). Bollettino delle sedute della Accademia Gioenia di Scienze Naturali in Catania, 33, 103 - 120.","Pilato, G. & Lisi, O. (2009) Description of three new species of Tardigrada from the Seychelles. Zootaxa, 2005, 24 - 34.","Mapalo, M. A., Stec, D., Mirano-Bascos, D. & Michalczyk, L. (2016) Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines. Zootaxa, 4126 (3), 411 - 426. https: // doi. org / 10.11646 / zootaxa. 4126.3.6","Roszkowska, M., Stec, D., Ciobanu, D. A. & Kaczmarek, L. (2016) Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species. Zootaxa, 4105 (3), 243 - 260. https: // doi. org / 10.11646 / zootaxa. 4105.3.2","Pilato, G., Binda, M. G. & Lisi, O. (2006) Three new species of eutardigrades from the Seychelles. New Zealand Journal of Zoology, 33, 39 - 48. https: // doi. org / 10.1080 / 03014223.2006.9518429","Pilato, G., Binda, M. G. & Catanzaro, R. 1991. Remarks on some tardigrades of the African fauna with the description of three new species of Macrobiotus Schultze 1834. Tropical Zoology, 4, 167 - 178. https: // doi. org / 10.1080 / 03946975.1991.10539487","Yin, H., Wang, L. - H. & Li, X. - C. (2011) Two new species of genus Macrobiotus (Tardigrada: Macrobiotidae) from China. Proceedings of the Biological Society of Washington, 124 (3), 165 - 178. https: // doi. org / 10.2988 / 11 - 05.1","Stec, D. & Kristensen, R. M. (2017) An integrative description of Mesobiotus ethiopicus sp. nov. (Tardigrada: Eutradigrada: Parachela: Macrobiotidae: harmsworthi group) from the northern Afrotropic region. Turkish Journal of Zoology, 41, 800 - 811.","Mapalo, M. A., Stec, D., Mirano-Bascos, D. & Michalczyk, L. (2017) An integrative description of a limnoterrestrial tardigrade from the Philippines, Mesobiotus insanis, new species (Eutardigrada: Macrobiotidae: harmsworthi group). Raffles Bulletin of Zoology, 65, 440 - 454.","Vecchi, M., Cesari, M., Bertolani, R., Jonsoon, I. K., Rebecchi, L. & Guidetti, R. (2016) Integrative systematic studies on tardigrades from Antarctica identify new genera and new species within Macrobiotoidea and Echiniscoidea. Invertebrate Systematics, 30, 303 - 322. https: // doi. org / 10.1071 / IS 15033"]}

Mesobiotus romani sp. nov. (Tables 3–4, Figs 1–32) Material examined: Holotype and 30 paratypes (19 animals and 11 eggs). Specimens mounted on microscope slides in Hoyer’s medium, fixed on SEM stubs or processed for DNA sequencing. Description of the new species. Animals (measurements and statistics in Table 3). Body white in living specimens and transparent after fixation (Figs 1–3). Eyes absent after fixation in all studied specimens. Cuticle smooth, i.e. without gibbosities, papillae, spines, sculpturing or pores. Granulation present on external cuticle of all legs (Figs 4–9). Under SEM granulation visible as aggregates consisted of two to a dozen or so microgranules (Figs 6, 9). Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten peribuccal lamellae (Fig. 10). Mouth antero-ventral. The oral cavity armature well developed and with three bands of teeth (Figs 11–13). The first band of teeth comprises numerous small granules arranged in a several rows situated anteriorly in the oral cavity, just behind the bases of the peribuccal lamellae (Fig. 11, arrowhead). The second band of teeth, situated between the ring fold and the third band of teeth, contains ridges parallel to the main axis of the buccal tube that are larger than in the granules of the first band (Fig. 12, arrow). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 12–13). The third band of teeth are divided into the dorsal and the ventral portion. Under PCM, dorsal teeth are visible as two lateral and one median transverse ridges (Fig. 12, indented arrowhead), whereas the ventral portion as two lateral ridges and two roundish median teeth (Fig. 13, empty arrowhead). In addition, on the ventral side some barely visible teeth (in shape of granules in LM) are present between second and third rows of teeth. Pharyngeal bulb spherical, with triangular apophyses, three rod–shaped macroplacoids, and a triangular microplacoid. Macroplacoid length sequence 3±1>2. The first macroplacoid narrower anteriorly, the second without constrictions and the third with a sub-terminal constriction (Fig. 14, arrowhead). Claws of the hufelandi type (Figs 15–18); internal, external, anterior and posterior identical in shape. Primary branches with distinct accessory points. Lunules under claws I–III smooth and dentate under claws IV (Figs 15– 18). Thin cuticular bars under claws I–III present (Fig. 15, arrow). Other cuticular structures on legs absent. Eggs (measurements and statistics in Table 4). Laid freely, white, spherical and ornamented (Figs 19–20). Egg processes in the shape of wide, sharpened cones sometimes bifurcated at the tip or terminated by several short, thin and flexible filaments, visible both under PCM and SEM (Figs 25–32). The process surface is smooth with slight undulations poorly visible under PCM but clearer under SEM. Labyrinthine layer between process walls visible under PCM as a clear reticular pattern with the mesh (0.3–1.5 µm in diameter), slightly increased in size from the tip to the base (Figs 25–28). In some processes, a slightly larger, bubble-mesh are present near the tip (Figs 25–28, arrowheads). Under SEM, clearly visible pores are present on the processes, but mainly toward the base (Fig. 24, arrowheads). Each process surrounded by a crown of thickenings, which form small ribs and then wrinkles on the egg surface (Figs 21, 22, 24, arrows). Under PCM, the surface between processes appears dotted or with small wrinkles (Figs 21–22), while under SEM, these are visible as small pores and ridges (Fig. 24). DNA sequences. The DNA was successfully extracted from only one of the three individuals used for the analysis. Nevertheless, from this one paragenophore we obtained sequences of very good quality for all four of the previously mentioned molecular markers, which are as follow: The 18S rRNA sequence (GenBank: MH197158), 1020 bp long; The 28S rRNA sequence (GenBank: MH197151), 808 bp long; The ITS-2 sequence (GenBank: MH197150), 486 bp long; The COI sequence (GenBank: MH195149), 658 bp long; Type locality: 00°45'34''N, 79°35'24W; 98 m asl: Tumbes-Chocó-Magdalena hotspot, Ecuador, Esmeraldas Province, next to E20 road to Quinindé, out of Chinca city, mixed moss and lichen on rock, collectors: Milena Roszkowska and Łukasz Kaczmarek. Etymology: The first author takes great pleasure in dedicating this new species to her friend—Roman Tarasewicz. Type depositories: Holotype: slide EC1319/6 (with six paratypes) and seven paratypes (two specimens and five eggs) (slides: EC1319/1, EC1319/2, EC1319/3, EC1319/8) are deposited at the Department of Animal Taxonomy and Ecology, Faculty of Biology, Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Umultowska 89, 61-614 Poznań, Poland; nine paratypes (six specimens and three eggs) (slides: EC1319/5, EC1319/7, EC1319/9) are deposited at the Museo Ecuatoriano de Ciencias Naturales, Sección de Entomología, Rumipamba 341 y Av. de los Shyris, Quito, Ecuador. Phenotypic differential diagnosis. Based on the presence of reticulated, conical egg processes surrounded by crown of thickening and the absence of areolation on the egg surface, M. romani sp. nov. is most similar to the following 10 species: M. binieki (Kaczmarek, Gołdyn, Prokop & Michalczyk, 2011), M. coronatus (de Barros, 1942), M. dimentmani (Pilato, Lisi & Binda, 2010), M. patiens (Pilato, Binda, Napolitano & Moncada, 2000), M. perfidus (Pilato & Lisi, 2009), M. philippinicus Mapalo, Stec, Mirano-Bascos & Michalczyk, 2016, M. pseudoblocki Roszkowska, Stec, Ciobanu & Kaczmarek, 2016, M. pseudocoronatus (Pilato, Binda & Lisi, 2006), M. pseudopatiens Kaczmarek & Roszkowska, 2016, M. radiatus (Pilato, Binda & Catanzaro, 1991), M. rigidus (Pilato & Lisi, 2006), M. simulans (Pilato, Binda, Napolitano & Moncada, 2000) and M. wuzhishanensis (Yin, L. Wang & X. Li, 2011). Despite the similarities, M. romani sp. nov differs specifically from: M. binieki, only reported from the type locality in Bulgaria (Kaczmarek et al. 2011), by: the presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. binieki vs. 3±1> 2 in M. romani sp. nov. ), higher pt of: buccal tube external width, macroplacoid 2 length, microplacoid length, claw I–III primary and secondary external branches (see Tables 3 and 1 in Kaczmarek et al. (2011) for the exact differences), different shape of the egg processes (long, smooth flexible spines, with very wide bases in M. binieki vs. typically developed cones in M. romani sp. nov. ), presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, smaller egg diameter without processes (85.1–94.5 µm in M. binieki vs. 62.0–85.0 µm in M. romani sp. nov. ), longer egg processes (9.8–14.5 µm in M. binieki vs. 14.6–21.4 µm in M. romani sp. nov. ), wider egg process bases (6.5–9.0 µm in M. binieki vs. 9.6–12.7 µm in M. romani sp. nov. ) and smaller number of processes on the egg circumference (27–32 in M. binieki vs. 16–17 in M. romani sp. nov. ). M. coronatus, reported from a few localities in South America (de Barros 1942; Pilato et al. 2000; Kaczmarek et al. 2015), by: the absence of eyes*, presence of dentate lunules IV, different macroplacoid length sequence (1>3> 2 in M. coronatus vs. 3±1> 2 in M. romani sp. nov. ), presence of several short, thin, and flexible filaments on the top of egg processes, larger egg diameter with and without processes (55.0–71.0 µm, and 42.0–55.0 µm respectively in M. coronatus vs. 95.4–116.1 µm and 62.0–85.0 µm respectively in M. romani sp. nov. ), longer egg processes (ca. 9.2 µm in M. coronatus vs. 14.6–21.4 µm in M. romani sp. nov. ). M. dimentmani, reported from the type locality in Israel (Pilato et al. 2010), by: teeth of the third band visible as two lateral ridges and two roundish median teeth (three ridges in M. dimentmani), first macroplacoid narrower anteriorly (central narrowing in M. dimentmani), anterior and posterior claws IV of a clearly different length, shorter anterior and posterior claws IV, and lower pt of anterior and posterior primary and secondary branches of claws IV (see Tables 3 and 4 in Pilato et al. (2010) for the exact differences). M. patiens, recorded from a few localities in Italy (Pilato et al. 2000), by: the presence of dentate lunules IV, and presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip. M. perfidus, reported from three localities in the Seychelles (Pilato & Lisi 2009), by: the presence of first row of teeth in oral cavity, the absence of tubercles on dorsal cuticle, absence of eyes*, presence of granulation on legs I–III, presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, and higher number of processes on the egg circumference (11–13 in M. perfidus vs. 16–17 in M. romani sp. nov. ). M. philippinicus, reported from the type locality in Philippines (Mapalo et al. 2016), by: the absence of eyes*, no granulation visible under SEM, different macroplacoid length sequence (1>3> 2 in M. philippinicus vs. 3±1> 2 in M. romani sp. nov.), absence of granulation on the filaments at the tip of the egg processes, and longer egg processes (2.1–13.7 µm in M. philippinicus vs. 14.6–21.4 µm in M. romani sp. nov. ). M. pseudoblocki, reported from the type locality in Argentina (Roszkowska et al. 2016), by: the absence of eyes*, presence of granulation on legs I–IV, different macroplacoid length sequence (1>3> 2 in M. pseudoblocki vs. 3±1> 2 in M. romani sp. nov.), presence of dentate lunules IV, larger internal secondary branch of claw III, higher pt of: stylet support insertion point, buccal tube external width, claw I–III external primary and internal secondary external branches, claw II–III external secondary branches (see Table 1 and 3 in Roszkowska et al. (2016) for the exact differences), larger egg diameter with processes (83.4–88.3 µm in M. pseudoblocki vs. 95.4–116.1 µm in M. romani sp. nov. ), longer egg processes (10.5–12.8 µm in M. pseudoblocki vs. 14.6–21.4 µm in M. romani sp. nov. ), wider egg process bases (5.8–7.6 µm in M. pseudoblocki vs. 9.6–12.7 µm in M. romani sp. nov. ), and smaller number of processes on the egg circumference (20–24 in M. pseudoblocki vs. 16–17 in M. romani sp. nov. ). M. pseudocoronatus, reported from the type locality on Seychelles (Pilato et al. 2006), by: the absence of tubercles on dorsal cuticle, absence of eyes*, higher number of processes on egg circumference (ca. 14 in M. pseudocoronatus vs. 16–17 in M. romani sp. nov. ), larger eggs with and without processes (ca. 82.3 and ca. 50.1 µm respectively in M. pseudocoronatus vs. 95.4–116.1 and 62.0–85.0 µm in M. romani sp. nov. ), and longer egg processes (10.9–12.7 µm in M. pseudocoronatus vs. 14.6–21.4 µm in M. romani sp. nov ). M. pseudopatiens, reported from the type locality in Costa Rica (Kaczmarek & Roszkowska 2016), by: the presence of first row of teeth in oral cavity, different macroplacoid length sequence (1>3> 2 in M. pseudopatiens vs. 3±1> 2 in M. romani sp. nov. ), presence of granulation on legs I–III, presence of dentate lunules IV, larger internal secondary branch of claw I and III, higher pt of: claw I internal secondary branches, claw II external primary and internal secondary branches, claw III external and internal secondary branches (see Table 1 and 3 in Kaczmarek & Roszkowska (2016) for the exact differences), higher number of processes on egg circumference (11–12 in M. pseudopatiens vs. 16–17 in M. romani sp. nov. ), and larger egg diameter with and without processes (80.4–88.0 and 55.5–59.3 µm respectively in M. pseudopatiens vs. 95.4–116.1 and 62.0–85.0 µm in M. romani sp. nov. ). M. radiatus, reported only from Tanzania, Democratic Republic of Congo and Kenya (Pilato et al. 1991, Stec et al. in review), by: smooth cuticle under SEM, absence of spurs on claws I–III, absence of pores on the top of egg processes, lack of microgranules on the filaments on the top of egg processes, higher number of processes on the egg circumference (10–12 in M. radiatus vs. 16–17 in M. romani sp. nov. ), and narrower egg processes (14.5–22.5 in M. radiatus vs. 9.6–12.7 in M. romani sp. nov. ). M. rigidus, reported from the type locality in New Zealand (Pilato & Lisi 2006), by: the presence of granulation on legs I–III, the presence of dentate lunules IV, presence of bifurcated egg processes or with several short, thin, and flexible filaments at the tip, higher number of processes on egg circumference (ca. 12 in M. rigidus vs. 16–17 in M. romani sp. nov. ), and larger egg diameter with processes (ca. 91.0 µm in M. rigidus vs. 95.4–116.1 µm in M. romani sp. nov. ). M. simulans, recorded from a few localities in Italy and Israel (Pilato et al. 2000; Pilato et al. 2010), by: the absence of eyes*, presence of bifurcated processes or with several short, thin, and flexible filaments at the tip, longer egg processes (up to 11 µm in M. simulans vs. 14.6–21.4 µm in M. romani sp. nov. ). M. wuzhishanensis, reported from the type locality in China (Yin et al. 2011), by: the absence of eyes*, different macroplacoid length sequence (3>1> 2 in M. wuzhishanensis vs. 3±1> 2 in M. romani sp. nov. ), egg shell surface between processes dotted or with small wrinkles, and processes never trifurcated. *character uncertain; Hoyer’s medium has the potential to cause eyes to ‘disappear’. Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances between the Mesobiotus romani sp. nov. and species of the genus Mesobiotus, for which sequences are available from GenBank (see Table 2 for details), are as follows (from the most to the least conservative): 18S rRNA: 1.1–5.9% (3.9% on average), with the most similar being M. philippinicus from Philippines (KX129793) and the least similar being M. cf. mottai from Antarctica (KT226072); 28S rRNA: 6.8–9.9% (8.5% on average), with the most similar being M. philippinicus from Philippines (KX129794) and the least similar being M. ethiopicus Stec & Kristensen, 2017 from Ethiopia (MF678792); COI: 19.6–23.4% (21.7% on average), with the most similar being M. insanis Mapalo, Stec, Mirano-Bascos & Michalczyk, 2017 from Philippines (MF441491) and the least similar being M. hilariae Vecchi, Cesari, Bertolani, Jönsoon, Rebecchi & Guidetti, 2016 from Antarctica (KT226108); ITS-2: 25.5–28.6% (27.1% on average), with the most similar being M. philippinicus from Philippines (KX129795) and the least similar being M. insanis from Philippines (MF441490).

Macrobiotus canaricus sp. nov. urn:lsid:zoobank.org:act: AE3AAEA9-D20E-4917-8ECD-12B30DB514B6 Figs 1–7, Tables 5–6 Etymology The specific epithet refers to the Canary Islands, the place where the new species was found. Material examined (162 animals, 57 eggs) Specimens mounted on microscope slides in Hoyer’s medium (120 animals + 42 eggs), fixed on SEM stubs (20 + 15), processed for DNA sequencing (7 animals), and aceto-orcein staining (15 animals). Holotype SPAIN: Canary Islands, Gran Canaria, Fagajesto, 28°03′05″ N, 15°38′21″ W, moss on a tree trunk in a pine forest (slide IZiBB ES.004.04). Paratypes SPAIN: 127 specimens, same data as for holotype (slides IZiBB ES.004.01–24); 42 eggs, same data as for holotype (slides IZiBB ES.004.25–33). Description Animals (measurements and statistics in Table 5) Body white in adults, after fixation in Hoyer’s medium transparent (Fig. 1A). Eyes present both in live animals and in specimens mounted in Hoyer’s medium. Round and oval pores (0.4–0.7 μm in diameter), visible under PCM and SEM, scattered randomly on entire body cuticle (Fig. 2 A–F), including external and internal surface of all legs (Fig. 2 A–F). Extremely fine body granulation (granules 0.06–0.09 μm in diameter), visible only under SEM, present on the dorso-posterior cuticle (Fig. 2 E–F). Granulation patches on external surface of legs I–III clearly visible both under PCM and SEM (Fig. 3 A–B). Granulation patches on internal surface of legs I–III weakly visible under PCM but clearly visible under SEM (Fig. 3 C–D, empty indented arrowheads). Single, large, oval pore present at centre of each external patch on legs I–III (Fig. 3 A–B, filled flat arrowheads). Cuticular bulge, resembling pulvinus, present on internal surface of legs I–III (Fig 3 C–D, filled indented arrowheads). This structure is visible only if legs are fully extended and correctly oriented on slide. Cuticular granulation on legs IV present and always clearly visible both under PCM and SEM (Fig. 3 E–F). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes (Fig. 4 A–C). Under PCM, the oral cavity armature is of the maculatus type, i.e., only the third band of teeth is visible (Fig. 4A). Under SEM, the oral cavity is always composed of three bands of teeth (Fig. 4 B–C). The first band of teeth is composed of numerous extremely small cones arranged in one or two rows, situated anteriorly in the oral cavity, on the basal part of the peribuccal lamellae (Fig. 4 B–C, filled arrowhead). The second band of teeth is situated between the ring fold and the third band of teeth and consists of cones, clearly larger than those of the first band (Fig. 4 B–C, empty arrowhead). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4 B–C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a transversal ridge weakly divided into three teeth, whereas the ventral teeth appear as two separate lateral transverse ridges between which a roundish median tooth is visible (Fig. 4A). Under SEM, the dorsal teeth are divided into three separate teeth: one median and two lateral, the median tooth has a slightly serrated edge (Fig. 4B). The ventral teeth are also separated into one median and two lateral teeth (Fig. 4C). The medio-ventral tooth is much smaller than the medio-dorsal tooth (Fig. 4 B–C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small microplacoid (Fig. 4A). The first and the second macroplacoids have a fine central and a subterminal constriction, respectively. The macroplacoid length sequence is 2 Claws Y-shaped, of the hufelandi type (Fig. 5 A–D). Primary branches with distinct accessory points and with an evident stalk connecting the claw to the lunula (Fig. 5 A–D). Lunulae under all claws smooth (Fig. 5 A–D). Cuticular bars under claws absent but muscle attachments are visible under claws I–III (Fig. 5A, C, filled arrowhead). Eggs (measurements and statistics in Table 6) Laid freely, white, spherical or slightly oval (Figs 6 A–B, 7A). The surface between processes of the hufelandi type, i.e., covered by a reticulum with very thin walls (Figs 6 D–E, 7A–F). Peribasal meshes slightly larger and with slightly thicker walls compared to interbasal meshes (Figs 6 D–E, 7B–F). The mesh diameter is always larger then mesh walls and nodes/knots (Figs 6 D–E, 7B–F). The meshes are 0.3–1.0 μm in diameter, polygonal but with rounded edges. Under SEM, meshes deep and empty inside (Fig. 7 C–F). Processes in the shape of inverted goblets with concave conical trunks and well-defined terminal discs (Figs 6 C–F, 7A–F). Terminal discs strongly serrated, with a concave central area (Figs 6 C– F, 7B–F). Sparse ultragranulation on the edges of terminal discs visible only under SEM (Fig. 7 E–F). Three to five microgranules (0.25–0.30 μm in diameter), covered with ultragranulation, present in the centre of the terminal disc (visible only under SEM; Fig. 7 B–F, empty arrowheads). Reproductive mode The examined population is dioecious (gonochoristic). Males were identified using aceto-orcein staining, which revealed testicles filled with spermatozoa. However, no morphological secondary sexual dimorphism, such as gibbosities on hind legs in males, was identified. DNA sequences We obtained sequences for all four of the above-mentioned molecular markers. The two conservative nuclear markers (18S rRNA, 28S rRNA) were represented by single haplotypes, whereas ITS-2 and COI exhibited three and two haplotypes, respectively. The p-genetic distance between the ITS-2 haplotypes ranged from 0.5 to 1.1% and between COI haplotypes it was equal to 1.3%. The 18S rRNA sequence (GenBank: MH063925) was 1033 bp long. The 28S rRNA sequence (GenBank: MH063934) was 721 bp long. The ITS-2 haplotypes 1–3 were 413 bp long (GenBank: MH063928, MH063929 and MH063930, respectively). The COI haplotypes 1–2 were 658 bp long (GenBank: MH057765 and MH057766, respectively). Phenotypic differential diagnosis By the oral cavity armature of the maculatus type and hufelandi type of egg shell ornamentation, smooth lunules under claws of all legs and granulation at least on legs IV, the new species is similar to M. almadai Fontoura et al., 2008, M. humilis Binda & Pilato, 2001, and M. rawsoni Horning et al., 1978, but can be differentiated specifically from: Macrobiotus almadai, known only from the Azores (Fontoura et al. 2008), by the presence of the external and the internal patch of granulation on legs I–III (legs I–III smooth in M. almadai) and by the presence of a single large pore in the centre of the external patch on legs I–III (occasionally, regular cuticular pores may be present on some legs, but such pores are small and never present on all legs in the same place in M. almadai). Macrobiotus humilis, reported only from its type locality in Sri Lanka (Binda & Pilato 2001), by the presence of three separated dorsal teeth of the third band (dorsal teeth fused into a single transversal ridge in M. humilis), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. humilis), more posteriorly inserted stylet supports (pt = 74.3– 76.8 in the new species vs pt = 71.1–71.3 in M. humilis), slightly higher pt of the second macroplacoid length (pt= 14.6–19.6 in the new species vs pt = 12.5–14.4 in M. humilis) and by irregularly serrated edges of the terminal discs on egg processes (edges of terminal discs regularly indented in M. humilis). Macrobiotus rawsoni, known only from its type locality in New Zealand (Horning et al. 1978; Kaczmarek & Michalczyk 2017a), by the presence of granulation on all legs (granulation present only on legs IV in M. rawsoni), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. rawsoni), the absence of cuticular bars under the claws on legs I–III (thin paired bars present in M. rawsoni), more anteriorly inserted stylet supports (pt = 74.3– 76.8 in the new species vs pt= 77.0– 77.1 in M. rawsoni), a different morphology of reticulation on the egg surface between processes (several lines of mesh between neighbouring egg processes in the new species vs two lines of mesh between neighbouring egg processes in M. rawsoni) and by a smaller mesh size in the chorion reticulum (0.3–1.0 μm in diameter in the new species vs 1.8–2.5 μm in diameter in M. rawsoni). Genotypic differential diagnosis The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, for which sequences are available from GenBank, are as follows: • 18S rRNA: 0.5–3.7% (2.0% on average), being most similar to two undetermined species of the M. hufelandi group from Spain (FJ435738 –9) and to M. macrocalix from Poland (MH063926) and the least similar to M. polypiformis Roszkowska et al., 2017 from Ecuador (KX810008) • 28S rRNA: 1.9–13.2% (6.1% on average), being most similar to three undetermined species of the M. hufelandi complex from Spain (FJ435751 and FJ435754 –5) and the least similar to M. polypiformis from Ecuador (KX810009) • ITS-2: 5.3–27.8% (17.0% on average), with the most similar being M. macrocalix from Poland (MH063931) and the least similar being M. polypiformis from Ecuador (KX810010) • COI: 17.2–24.7% (19.2% on average), with the most similar being M. hannae Nowak & Stec, 2018 from Poland (MH057764) and the least similar being M. papei Stec et al., 2018 from Tanzania (MH057763)

Macrobiotus canaricus sp. nov. urn:lsid:zoobank.org:act: AE3AAEA9-D20E-4917-8ECD-12B30DB514B6 Figs 1���7, Tables 5���6 Etymology The specific epithet refers to the Canary Islands, the place where the new species was found. Material examined (162 animals, 57 eggs) Specimens mounted on microscope slides in Hoyer���s medium (120 animals + 42 eggs), fixed on SEM stubs (20 + 15), processed for DNA sequencing (7 animals), and aceto-orcein staining (15 animals). Holotype SPAIN: Canary Islands, Gran Canaria, Fagajesto, 28��03���05��� N, 15��38���21��� W, moss on a tree trunk in a pine forest (slide IZiBB ES.004.04). Paratypes SPAIN: 127 specimens, same data as for holotype (slides IZiBB ES.004.01���24); 42 eggs, same data as for holotype (slides IZiBB ES.004.25���33). Description Animals (measurements and statistics in Table 5) Body white in adults, after fixation in Hoyer���s medium transparent (Fig. 1A). Eyes present both in live animals and in specimens mounted in Hoyer���s medium. Round and oval pores (0.4���0.7 ��m in diameter), visible under PCM and SEM, scattered randomly on entire body cuticle (Fig. 2 A���F), including external and internal surface of all legs (Fig. 2 A���F). Extremely fine body granulation (granules 0.06���0.09 ��m in diameter), visible only under SEM, present on the dorso-posterior cuticle (Fig. 2 E���F). Granulation patches on external surface of legs I���III clearly visible both under PCM and SEM (Fig. 3 A���B). Granulation patches on internal surface of legs I���III weakly visible under PCM but clearly visible under SEM (Fig. 3 C���D, empty indented arrowheads). Single, large, oval pore present at centre of each external patch on legs I���III (Fig. 3 A���B, filled flat arrowheads). Cuticular bulge, resembling pulvinus, present on internal surface of legs I���III (Fig 3 C���D, filled indented arrowheads). This structure is visible only if legs are fully extended and correctly oriented on slide. Cuticular granulation on legs IV present and always clearly visible both under PCM and SEM (Fig. 3 E���F). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes (Fig. 4 A���C). Under PCM, the oral cavity armature is of the maculatus type, i.e., only the third band of teeth is visible (Fig. 4A). Under SEM, the oral cavity is always composed of three bands of teeth (Fig. 4 B���C). The first band of teeth is composed of numerous extremely small cones arranged in one or two rows, situated anteriorly in the oral cavity, on the basal part of the peribuccal lamellae (Fig. 4 B���C, filled arrowhead). The second band of teeth is situated between the ring fold and the third band of teeth and consists of cones, clearly larger than those of the first band (Fig. 4 B���C, empty arrowhead). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4 B���C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a transversal ridge weakly divided into three teeth, whereas the ventral teeth appear as two separate lateral transverse ridges between which a roundish median tooth is visible (Fig. 4A). Under SEM, the dorsal teeth are divided into three separate teeth: one median and two lateral, the median tooth has a slightly serrated edge (Fig. 4B). The ventral teeth are also separated into one median and two lateral teeth (Fig. 4C). The medio-ventral tooth is much smaller than the medio-dorsal tooth (Fig. 4 B���C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a small microplacoid (Fig. 4A). The first and the second macroplacoids have a fine central and a subterminal constriction, respectively. The macroplacoid length sequence is 2 hufelandi type (Fig. 5 A���D). Primary branches with distinct accessory points and with an evident stalk connecting the claw to the lunula (Fig. 5 A���D). Lunulae under all claws smooth (Fig. 5 A���D). Cuticular bars under claws absent but muscle attachments are visible under claws I���III (Fig. 5A, C, filled arrowhead). Eggs (measurements and statistics in Table 6) Laid freely, white, spherical or slightly oval (Figs 6 A���B, 7A). The surface between processes of the hufelandi type, i.e., covered by a reticulum with very thin walls (Figs 6 D���E, 7A���F). Peribasal meshes slightly larger and with slightly thicker walls compared to interbasal meshes (Figs 6 D���E, 7B���F). The mesh diameter is always larger then mesh walls and nodes/knots (Figs 6 D���E, 7B���F). The meshes are 0.3���1.0 ��m in diameter, polygonal but with rounded edges. Under SEM, meshes deep and empty inside (Fig. 7 C���F). Processes in the shape of inverted goblets with concave conical trunks and well-defined terminal discs (Figs 6 C���F, 7A���F). Terminal discs strongly serrated, with a concave central area (Figs 6 C��� F, 7B���F). Sparse ultragranulation on the edges of terminal discs visible only under SEM (Fig. 7 E���F). Three to five microgranules (0.25���0.30 ��m in diameter), covered with ultragranulation, present in the centre of the terminal disc (visible only under SEM; Fig. 7 B���F, empty arrowheads). Reproductive mode The examined population is dioecious (gonochoristic). Males were identified using aceto-orcein staining, which revealed testicles filled with spermatozoa. However, no morphological secondary sexual dimorphism, such as gibbosities on hind legs in males, was identified. DNA sequences We obtained sequences for all four of the above-mentioned molecular markers. The two conservative nuclear markers (18S rRNA, 28S rRNA) were represented by single haplotypes, whereas ITS-2 and COI exhibited three and two haplotypes, respectively. The p-genetic distance between the ITS-2 haplotypes ranged from 0.5 to 1.1% and between COI haplotypes it was equal to 1.3%. The 18S rRNA sequence (GenBank: MH063925) was 1033 bp long. The 28S rRNA sequence (GenBank: MH063934) was 721 bp long. The ITS-2 haplotypes 1���3 were 413 bp long (GenBank: MH063928, MH063929 and MH063930, respectively). The COI haplotypes 1���2 were 658 bp long (GenBank: MH057765 and MH057766, respectively). Phenotypic differential diagnosis By the oral cavity armature of the maculatus type and hufelandi type of egg shell ornamentation, smooth lunules under claws of all legs and granulation at least on legs IV, the new species is similar to M. almadai Fontoura et al., 2008, M. humilis Binda & Pilato, 2001, and M. rawsoni Horning et al., 1978, but can be differentiated specifically from: Macrobiotus almadai, known only from the Azores (Fontoura et al. 2008), by the presence of the external and the internal patch of granulation on legs I���III (legs I���III smooth in M. almadai) and by the presence of a single large pore in the centre of the external patch on legs I���III (occasionally, regular cuticular pores may be present on some legs, but such pores are small and never present on all legs in the same place in M. almadai). Macrobiotus humilis, reported only from its type locality in Sri Lanka (Binda & Pilato 2001), by the presence of three separated dorsal teeth of the third band (dorsal teeth fused into a single transversal ridge in M. humilis), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. humilis), more posteriorly inserted stylet supports (pt = 74.3��� 76.8 in the new species vs pt = 71.1���71.3 in M. humilis), slightly higher pt of the second macroplacoid length (pt= 14.6���19.6 in the new species vs pt = 12.5���14.4 in M. humilis) and by irregularly serrated edges of the terminal discs on egg processes (edges of terminal discs regularly indented in M. humilis). Macrobiotus rawsoni, known only from its type locality in New Zealand (Horning et al. 1978; Kaczmarek & Michalczyk 2017a), by the presence of granulation on all legs (granulation present only on legs IV in M. rawsoni), the presence of a subterminal constriction in the second macroplacoid (second macroplacoid without constrictions in M. rawsoni), the absence of cuticular bars under the claws on legs I���III (thin paired bars present in M. rawsoni), more anteriorly inserted stylet supports (pt = 74.3��� 76.8 in the new species vs pt= 77.0��� 77.1 in M. rawsoni), a different morphology of reticulation on the egg surface between processes (several lines of mesh between neighbouring egg processes in the new species vs two lines of mesh between neighbouring egg processes in M. rawsoni) and by a smaller mesh size in the chorion reticulum (0.3���1.0 ��m in diameter in the new species vs 1.8���2.5 ��m in diameter in M. rawsoni). Genotypic differential diagnosis The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, for which sequences are available from GenBank, are as follows: ��� 18S rRNA: 0.5���3.7% (2.0% on average), being most similar to two undetermined species of the M. hufelandi group from Spain (FJ435738 ���9) and to M. macrocalix from Poland (MH063926) and the least similar to M. polypiformis Roszkowska et al., 2017 from Ecuador (KX810008) ��� 28S rRNA: 1.9���13.2% (6.1% on average), being most similar to three undetermined species of the M. hufelandi complex from Spain (FJ435751 and FJ435754 ���5) and the least similar to M. polypiformis from Ecuador (KX810009) ��� ITS-2: 5.3���27.8% (17.0% on average), with the most similar being M. macrocalix from Poland (MH063931) and the least similar being M. polypiformis from Ecuador (KX810010) ��� COI: 17.2���24.7% (19.2% on average), with the most similar being M. hannae Nowak & Stec, 2018 from Poland (MH057764) and the least similar being M. papei Stec et al., 2018 from Tanzania (MH057763), Published as part of Stec, Daniel, Krzywa��ski, ��ukasz & Michalczyk, ��ukasz, 2018, Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae), pp. 1-36 in European Journal of Taxonomy 452 on pages 7-17, DOI: 10.5852/ejt.2018.452, http://zenodo.org/record/3814676, {"references":["Fontoura P., Pilato G. & Lisi O. 2008. New records of eutardigrades (Tardigrada) from Faial and Pico Islands, the Azores, with the description of two new species. Zootaxa 1778: 37 - 47.","Binda M. G. & Pilato G. 2001. Macrobiotus savai and Macrobiotus humilis, two new species of tardigrades from Sri Lanka. Bolletino delle Sedute dell'Accademia Gioenia di Scienze naturali in Catania 34: 101 - 111.","Horning Jr. D. S., Schuster R. O. & Grigarick A. A. 1978. Tardigrada of New Zealand. New Zealand Journal of Zoology 5: 185 - 280. https: // doi. org / 10.1080 / 03014223.1978.10428316","Kaczmarek L. & Michalczyk L. 2017 a. A description of Macrobiotus horningi sp. nov. and redescriptions of M. maculatus comb. nov. Iharos, 1973 and M. rawsoni Horning et al., 1978 (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group). Zootaxa 4363: 79 - 100. https: // doi. org / 10.11646 / zootaxa. 4363.1.3","Roszkowska M., Ostrowska M., Stec D., Janko K. & Kaczmarek L. 2017. Macrobiotus polypiformis sp. nov., a new tardigrade (Macrobiotidae; hufelandi group) from the Ecuadorian Pacific coast, with remarks on the claw abnormalities in eutardigrades. European Journal of Taxonomy 327: 1 - 19. https: // doi. org / 10.5852 / ejt. 2017.327","Nowak B. & Stec D. 2018. An integrative description of Macrobiotus hannae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Poland. Turkish Journal of Zoology 42: 269 - 286. https: // doi. org / 10.3906 / zoo- 1712 - 31"]}

Macrobiotus cf. recens Cu��not, 1932 Figs 8���14, Tables 7���8 Material examined (114 animals, 48 eggs) SPAIN: Canary Islands, Gran Canaria, Presa de Lugarejos, 28��02���38��� N, 15��40���22��� W, 885 m a.s.l., lichen on a stone wall. Specimens mounted on microscope slides in Hoyer���s medium (87 animals + 38 eggs), fixed on SEM stubs (8+10), processed for DNA sequencing (4 animals) and used for acetoorcein staining (15 animals). Slide depositories: 87 animals (slides: ES.006.*, where the asterisk can be substituted by the following numbers 1���4, 10���12, 14���17) and 38 eggs (slides: ES.006.*: 5���9, 13) (IZiBB). Description of the population from Gran Canaria Animals (measurements and statistics in Table 7) Body white in juveniles and slightly yellowish in adults, after fixation in Hoyer���s medium transparent (Fig. 8A). Eyes present in live animals and in specimens mounted in Hoyer���s medium. Elliptical and sometimes roundish pores (1.0���1.8 ��m in diameter), visible under PCM and SEM, scattered randomly on entire body cuticle (Fig. 8 B���E), including the external and internal surface of all legs (Fig. 9 A���I). Inside pores several granules, visible only under SEM, always present (Fig. 8E). Granulation patch on external and internal surfaces of legs I���III present (Fig. 9 A���E). Single pore present at centre of each external granulation patch (Fig. 9 A���C). Granulation patch on external surface larger and more distinct than the one on internal surface (Fig. 9 A���E). Faint cuticular fold present on external surface of legs I��� III just above claws (Fig. 9 A���B, empty arrowhead), whereas on internal surface of legs I���III there is a cuticular bulge resembling pulvinus (Fig. 9 D���E, filled arrowhead). Both external fold and internal bulge visible only if legs are fully extended and correctly oriented on slide (particularly cuticular fold above claws). Granulation on legs IV always clearly visible and consists of two granulation patches: the distal patch with densely distributed granules situated just above claws and the proximal patch being wider with more sparsely distributed granules located immediately above distal patch (Fig. 9 G���I). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 10 A���C), with ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes. Under PCM, oral cavity armature of the hufelandi type, i.e., with all three bands of teeth always visible (Fig. 10 B���C). First band of teeth composed of numerous very small cones arranged in four to six rows situated anteriorly in oral cavity, just behind bases of peribuccal lamellae (Figs 10 B���C, 11A���B, filled arrowhead). Second band of teeth situated between ring fold and third band of teeth and comprises 4���5 rows of small cones, slightly larger than those of first band (Figs 10 B���C, 11A���B, empty arrowhead). Teeth of the third band located within posterior portion of oral cavity, between the second band of teeth and buccal tube opening (Figs 10 B���C, 11A���B). Third band of teeth discontinuous and divided into dorsal and ventral portions. Under PCM, dorsal teeth seen as three distinct transversal ridges, whereas ventral teeth appear as two separate lateral transversal ridges and a roundish median tooth (Fig. 10 B���C). Under SEM, both dorsal and ventral teeth clearly distinct (Fig.11 A���B). Medio-ventral tooth rarely divided into two or three smaller teeth (Fig. 11B). Under SEM, margins of dorsal and latero-ventral teeth slightly serrated (Fig. 11 A���B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and one big rod-shaped microplacoid (Fig. 10 D���E). Macroplacoid length sequence 2 hufelandi type (Fig. 12 A���D). Primary branches with distinct accessory points and with an evident stalk connecting claw to lunula (Fig. 12 A���D). Lunulae I���III smooth (Fig. 12A, C), whereas lunulae IV slightly crenulated (Fig. 12B, D). Faint cuticular bars under claws I���III present, more visible in larger specimens (Fig. 12A, C). Horseshoe-shaped structure connects anterior and posterior lunules (Fig. 12B). Eggs (measurements and statistics in Table 8) Laid freely, white/light yellow, spherical or slightly oval (Figs 13 A���B, 14A). Surface between processes of the hufelandi type, i.e., chorion surface between processes covered by reticulum with very small meshes (Figs 13 C���D, 14B���E). Under PCM, surface between processes seems to be covered by dark dots (Fig. 13C) and only sometimes a clear reticulation is visible (Fig. 13D). Several rows of meshes between egg processes (usually 7���8). Mesh borders and nodes/knots thick and sometimes wider than mesh diameter (Fig. 14 B���E). Meshes circular or slightly oval (0.4���0.9 ��m in diameter) and under SEM all pores empty inside (Fig. 14 C���D). Mesh diameter decreases gradually from peribasal to interbasal meshes (Fig. 14 C���D). Short thickenings radiating from process bases are often visible under PCM and always visible under SEM; thickenings may create a crown around process bases (Figs 13C, 14 C���D, filled arrowheads). Processes in the shape of high and thin cones with straight conical trunks, devoid of terminal discs and sometimes bifurcated (Figs 13 A���F, 14A���F). Trunks of processes slightly undulated. Undulations covered by numerous granules composed of microgranule aggregations. Undulations and granules poorly visible under PCM (Fig. 13 C���F). Undulations, granules and microgranules always clearly visible under SEM (Fig. 14B, E���F). Reproductive mode The examined population is dioecious (gonochoristic). Males were identified using aceto-orcein staining, which revealed testicles filled with spermatozoa. However, no morphological secondary sexual dimorphism, such as gibbosities on hind legs in males, was identified. DNA sequences We obtained sequences for all four of the above-mentioned molecular markers. The two conservative nuclear markers (18S rRNA, 28S rRNA) were represented by single haplotypes, whereas both ITS-2 and COI exhibited two haplotypes. The p-genetic distance between the ITS-2 as well as between the COI haplotypes was 1.1%. The 18S rRNA sequence (GenBank: MH063927) was 1033 bp long, the 28S rRNA sequence (GenBank: MH063936) was 725 bp long, the ITS-2 haplotype 1 and 2 sequences (GenBank: MH063932 and MH063933, respectively) were 420 bp long; the COI haplotype 1 and 2 sequences (GenBank: MH057768 and MH057769, respectively) were 658 bp long. Genotypic differential diagnosis The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, for which sequences are available from GenBank, are as follows: ��� 18S rRNA: 0.4���4.0% (2.0% on average), with the most similar being M. macrocalix from Poland (MH063926) and the least similar being M. polypiformis from Ecuador (KX810008) ��� 28S rRNA: 1.3���13.6% (6.5% on average), with the most similar being M. macrocalix from Poland (MH063935) and the least similar being M. polypiformis from Ecuador (KX810009) ��� ITS-2: 3.7���26.7% (16.9% on average), with the most similar being M. macrocalix from Poland (MH063931) and the least similar being M. polypiformis from Ecuador (KX810010) ��� COI: 16.4���24.7% (19.1% on average), with the most similar being M. macrocalix from Italy (FJ176203 ���7 and FJ176213 ���7) and the least similar being M. papei from Tanzania (MH057763) Molecular phylogeny Phylogenetic analyses conducted on macrobiotid 18S rRNA sequences as well as on the concatenated macrobiotid data set unambiguously confirmed that the two studied species represent the M. hufelandi group (Figs 15���16). The phylogeny based on the COI sequences of the hufelandi group also corroborated these results, since none of the two species were recovered external to the species of the hufelandi group (Fig. 17). In all analyses, two clades within the hufelandi group were present, although the species composition varied slightly between phylogenies based on different markers. One clade grouped exclusively species that exhibit modified egg processes (M. paulinae Stec et al., 2015, M. polypiformis, M. papei, M. shonaicus Stec et al., 2018a, M. scoticus Stec et al., 2017b and M. kristenseni Guidetti, Peluffo, Rocha, Cesari & Moly de Peluffo, 2013); ���the kristenseni clade��� henceforth. The other clade comprised mostly species with typical inverted goblet-shaped egg processes (���the hufelandi clade��� hereafter). In contrast to our predictions, M. cf. recens, with its atypical egg processes, was always embedded within the hufelandi clade. The two clades were well supported in phylogenies based on the concatenated data set and on COI sequences, but weakly supported in the 18S rRNA tree (Figs 15���17). Moreover, in the 18S rRNA analysis the kristenseni clade, in addition to the majority of species with modified egg processes, comprised M. sapiens Binda & Pilato, 1984 (DQ839601) and undetermined species of the M. hufelandi group (HQ604971), of which at least the first species exhibits the typical egg morphology. In contrast to other analyses, the 18S rRNA phylogeny recovered a clade, with X. pseudohufelandi (Iharos, 1966) and M. polonicus Pilato, Kaczmarek, Michalczyk & Lisi, 2003, that was in a sister relationship to all other species of the hufelandi group, suggesting that the hufelandi group is polyphyletic or that Xerobiotus belongs to the hufelandi group (Fig. 15)., Published as part of Stec, Daniel, Krzywa��ski, ��ukasz & Michalczyk, ��ukasz, 2018, Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae), pp. 1-36 in European Journal of Taxonomy 452 on pages 17-26, DOI: 10.5852/ejt.2018.452, http://zenodo.org/record/3814676, {"references":["Stec D., Smolak R., Kaczmarek L. & Michalczyk L. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052 (5): 501 - 526. https: // doi. org / 10.11646 / zootaxa. 4052.5.1","Stec D., Arakawa K. & Michalczyk L. 2018 a. An integrative description of Macrobiotus shonaicus sp. nov. (Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS One 13 (2): e 0192210. https: // doi. org / 10.1371 / journal. pone. 0192210","Stec D., Morek W., Gasiorek P., Blagden B. & Michalczyk L. 2017 b. Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: hufelandi group) from Scotland by means of integrative taxonomy. Annales Zoologici 67 (2): 181 - 197. https: // doi. org / 10.3161 / 00034541 ANZ 2017.67.2.001","Guidetti R., Peluffo J. R., Rocha A. M., Cesari M. & Moly de Peluffo M. C. 2013. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). Journal of Natural History 47 (37 - 38): 2409 - 2426. https: // doi. org / 10.1080 / 00222933.2013.800610","Binda M. G. & Pilato G. 1984. Macrobiotus sapiens, nuova specie di Eutardigrado di Sicilia. Animalia 11: 85 - 90."]}

Macrobiotus papei sp. nov. (Tables 3���4, Figures 1���7) Material examined: 131 animals (including 10 specimens in simplex stage), and 81 eggs. Specimens mounted on microscope slides in Hoyer���s medium (49 animals + 66 eggs), fixed on SEM stubs (20+15), and processed for DNA sequencing (6+0), aceto-orcein staining (50+0), and single individual culturing (6+0). Description of the new species. Animals (measurements and statistics in Table 3). Body white in juveniles and slightly yellowish in adults, after fixation in Hoyer���s medium transparent (Fig. 1A). Eyes present in all live animals (dissolved in 80% of specimens mounted in Hoyer���s medium). Small round and oval pores (0.6���1.1 ��m in diameter), visible under PCM and SEM, scattered randomly over the entire body cuticle (Fig. 1B���E), including the external and internal surface of all legs (Fig. 2B���E). Two cuticular granulation patches, one on the external and the other on the internal surface, are present on legs I���III (Fig. 2A���D). Granulation on the external surface (Fig. 2A���B) is bigger and more distinct than the on the internal surface (Fig. 2C���D). A cuticular bulge/fold, resembling a pulvinus, is present on the internal surface of legs I���III (Fig 2C���D, filled arrowhead), whereas a faint cuticular fold is present just above the claws (Fig. 2C���D, flat empty arrowhead). Both structures are visible only if the legs are fully extended and well oriented on the slide (particularly in the case of the cuticular fold above the claws). Cuticular granulation on legs IV is always clearly visible and consists of two granulation patches: the distal patch with densely distributed granules situated just above the claws and the proximal patch being wider with more sparsely distributed granules located just above the first patch (Fig. 2E���F). Sometimes muscle attachments are also visible under claws I���III (Fig. 2C���D, arrow) Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten small peribuccal lamellae followed by six buccal sensory lobes (Figs 3A and 4A���C). An irregular ring of pores, clearly visible using SEM and occasionally under PCM, is present around the mouth opening, immediately behind the peribuccal sensory lobes (Figs 3B and 4A, arrow). Under PCM, the oral cavity armature is of the patagonicus type (only the second and third band of teeth visible under light microscopy (LM) in the majority of specimens (Fig. 3B���C) but in smaller individuals the oral cavity armature is of the maculatus type (only the third band of teeth visible under LM) (Fig. 3D���E). However, under SEM the oral cavity comprises three bands of teeth, i.e. under PCM only the third band or only the second and the third band of teeth are visible (Fig. 3B���E), whereas all three bands are always detectable in SEM (Fig. 4B���C). The first band of teeth consists of numerous extremely small cones arranged in one to two rows situated anteriorly in the oral cavity, just behind the base of the peribuccal lamellae (Fig. 4B���C, flat filled arrowhead). The second band of teeth are situated between the ring fold and the third band of teeth and comprises 4���5 rows of small cones, slightly bigger than those of the first band (Fig. 4B���C, empty flat arrowhead). Under PCM, only the larger teeth of second band are visible in larger specimens and often appear as very weakly developed (Fig. 3B���C, empty flat arrowhead). The teeth of the third band are located within the posterior portion of the oral cavity, between the second band of teeth and the buccal tube opening (Fig. 4B���C). The third band of teeth is discontinuous and divided into a dorsal and a ventral portion. Under PCM, the dorsal teeth form a single transverse ridge with obvious thickenings, whereas the ventral teeth appear as two separate lateral transverse ridges between which a roundish median tooth is visible (Fig. 3B���E). The medio-ventral tooth is occasionally divided into two smaller rounded teeth. Under SEM, the dorsal teeth form a single ridge with two larger lateral peaks and several smaller median peaks and indentations (Fig. 4B) which correspond to thickenings visible under LM (Fig. 3B). The ventral teeth are separated into one median and two lateral teeth (Fig. 4C). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular small microplacoid (Fig. 3A). The macroplacoid length sequence 2hufelandi type (Fig. 5A���D). Primary branches with distinct accessory points, a long common tract, and with an evident stalk connecting the claw to the lunula (Fig. 5A���D). Lunulae I���III smooth (Fig. 5A, C), whereas lunulae IV sparsely dentate (Fig. 5B, D). Cuticular bars under claws absent. Eggs (measurements and statistics in Table 4). Laid freely, white/light yellow, spherical or slightly oval (Figs 6A���B and 7A). The surface between processes of an intermediate type between the hufelandi and the maculatus type, i.e. chorion surface covered numerous small pores that form a reticulum with thick walls (Figs 6B���D and 7A��� F). Pores are similar in size and uniformly scattered over the entire surface, i.e. there no peribasal rings of elongated pores/bigger mesh around the processes. There are several rows of pores between processes and the mesh bars and nodes are often wider than the pore diameter (Figs 6C���D and 7B���F). The pores in the reticulum are circular or slightly oval (0.3���0.6 ��m in diameter) and under SEM almost all pores are empty inside (Fig. 7C���E). Processes are in the shape of inverted goblets with slightly concave conical trunks and well-defined terminal discs (Figs 6E���F and 7A���F). Terminal discs are cog-shaped, with a concave central area and with 10���15 small irregular teeth (Figs 6E���F and 7B���F). Almost all teeth on the terminal disc are elongated into thin flexible filaments, less than 0.3 ��m in diameter and 2���7 ��m in length (Figs 6E���F, filled arrowhead and 7B���F). The filaments are hair-like under PCM (Fig. 6E���F) and under SEM are completely smooth as is the surface of terminal discs (Fig. 7D���F). Under PCM, the filaments are clearly visible, however the filaments are very thin and could be overlooked and/or misinterpreted as debris attached to the eggs, if close attention is not paid during examination. Reproductive mode. Staining 50 adults of the new species with aceto-orcein did not reveal any individuals with a testicle filled with spermatozoa (males), an ovotestis with spermatozoa and oocytes (hermaphrodites), or with spermatozoa in a spermatheca (inseminated females). Only females with oocytes in the ovary or specimens of an undetermined sex were observed. Moreover, both PCM and SEM observations showed no morphological secondary sexual dimorphism such as gibbosities on legs IV (e.g. Rebecchi & Nelson 1998). Furthermore, to test whether females are capable of parthenogenetic reproduction, we isolated eggs and observed the full cycle of hatchlings maturing to adults, laying the next generation of eggs still in isolation, and the emergence of the second generation, also from individually isolated eggs (i.e. there was no possibility of fertilisation). Thus, all lines of evidence show the type population of M. papei sp. nov. comprises only females capable of parthenogenetic reproduction. DNA sequences. We obtained very good quality sequences for all four molecular markers from all analysed specimens (paragenophores). DNA sequences of all markers were represented by single haplotypes: The 18S rRNA sequence (GenBank: MH063881), 905 bp long: TAGATCGTAATTTTACACGGATAACTGTGGTAATTCTAGAGCTAATACGTGCAACCAGCTCGTTCCCTTGTGGAGCGAGC GCAGTTATTAGAACAAGACCAATCCGGCCTTCGGGTCGGTACAATTGGTGACTCTGAATAACCGAAGCGGAGCGCATGGT CTCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTTCAACGGG TAACGGGGTATCAGGGTCCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAA ATTACCCACTCCTAGCACAGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCTAATAGCTTCTCGTAATCGGAATGGGT ACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCG TATATTAAAGTTGCTGCGGTTAAAAGCTCGTAGTTGGATCTGGGCTTCTGAATGGATGGTTCACTTTACGGTGTAACTGT TCGTTTGGTGCCACAAGCCGGCCATGTCTTGCATGCCCTTTACTGGGTGTGCATGGCGACCGGAACGTTTACTTTGAAAA AATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGT TGGTTTTCGGAACTCGAGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGG ATCGTCGCAAGACGAACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAG GCGATCAGATACCGCCCTAGTTCTA The 28S rRNA sequence (GenBank: MH063880), 787 bp long: TACTAAGCGGAGGAAAAGAAACCAACGGGGATGCCGACAGTAACTGCGAGTGAAATCGGCCAAGCCCAGCGCCGAATCCT GTTGCTGGTAACGGTGGTAGGAACTGTGGCGTGAAGAACGTCCTTACCGGTACGGTTTGCGTGCGTAAGTTCTCCTGAGT GAGGCTCCATTCCAAGGAGGGTGCAAGACCCGTATCGCGTGCAACCGGTATCGGTGTAAGATGTTCGGAGAGTCGCCTTG TTTGTGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGAACAAGTACC GTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAAATGGGGCCTC GAAGGCAAGGCAGCGAATTCAGCTGGTGGTCTGCGTGGCTGGCCGGTTAAGTGATCTTAACGACTCTTGCCGGTTATGTC TAGCGTAGGTGCCAGTGCACTTTCGTTGCTTGTACGCCACCGCCGTTGAGTGGGCATCCGTCGGGTTGGTAACGCGAAGC CTTACGCCTTCACGGGCGTAGGTGCTTGCAGCCGACTTTGTACGCGTTTGCACTTCAACCGGTCATGTTTGCATGTGCCA GCATTTGCGTTGGATTGGCTCGCTCTGCCGTTTGTCGTGAGATGACGAGCTTGCTCGGCTCTTCGGCATCTATGGTAGAC TCGTGTCGGTTTTCAACGTGGGCACATTGTTAATTCGGTGGCGAGTAGATGGCTGCCCATTTAACCC The ITS-2 sequence (GenBank: MH063921), 397 bp long: TTTGTGAACGTTAATTCTTCGAACGCACATTGCGGCTTCGGGTTAACTGAAGCCATGCCTGGTTGAGGGTCAGTTGAAGA AAAAAATCGTAATCGCGCATTGATTACGGAGTGTCTGGTTAATGGCTCGTCCGTTTCCAGATGAAGTATAGACCAGATGT GTGCGCTCATTTGACCGGTGCAAGCAACGCTTTGCCGAGTTGGAGCATTCGGCTTTCTTAGCCGTGCGCCGCAGTTGCAC GATGGCTAAGTTGGCTACCAACAATGGCGAAGTAAGACCGGTTCAGAGGTGCGCAACGCAATAGGCACATCTGTGTACCA AAAAGAACGTACGGTCGCGGTGTTTCGACCGATGCGGACTTAACTCATTCTTTTGACCTCAGCTCAGACAAGATTAC The COI sequence (GenBank: MH057763), 745 bp long: ACTGCCTCTGTGGGAACGTCCTTAAGATTTCTAATTCGGAGGGAATTAAGCCAACCAGGGCTTCTTCTCTCCGACGAACA AATATATAATGTGATTGTAACAAGCCACGCATTTATTATAATTTTTTTTTTCGTGATACCAATTTTAATCGGGGGATTCG GGAACTGACTGGTCCCCCTTATAATTAGAGCACCAGACATAGCTTTTCCACGAATAAATAATTTAAGCTTCTGGATACTG CCCCCCTCTTTTTTCCTAATTACTTTAAGCTCGATAACTGAACAGGGGGCCGGAACCGGATGAACTGTTTACCCACCCCT TTCTCATTTTTTTGCTCACAGGGGCCCTAGAGTAGATCTTACAATTTTTTCACTTCATGTGGCGGGAATTTCATCAATTT TAGGGGCTATTAATTTCATTTCTACAATTCTAAATATGCGAGTACCCCACCTAACCTTAGAAAAAATACCTCTCTTTGTG TGATCCGTTTTTTTAACAGCTATTTTATTACTTCTGGCCCTCCCAGTATTGGCAGGAGGTATTACTATGCTATTACTGGA CCGAAACTTTAATACTTCTTTTTTTGACCCTGCGGGGGGGGGAGACCCTATTTTATACCAACACCTATTTTGGTTTTTTG GCCACCCCGAAGTATATATTTTAATCTTACCAGGCTTTGGAATTATCTCACAAATCGTTATTCACTTCAGAGGAAAATCT CTCACATTCGGACATTTAGGAATAA Type locality: 7��49'25''S, 36��49'32''E; 2050 m asl: Tanzania, Morogoro Region, Udzungwa Mts. National Park, Mwanihana Peak; lichen on branches of a bush; coll. 16.08.2016 by Thomas Pape. Etymology: We take great pleasure in dedicating this new species to the colleague and friend of the first and the second authors, an established taxonomist of Diptera, Thomas Pape, Head of Section of Biosystematics of the Natural History Museum of Denmark, University of Copenhagen. Type depositories: Holotype (slide TZ.027.01 with 2 paratypes) and 34 paratypes (slides: TZ.027.*, where the asterisk can be substituted by any of the following numbers 02���06, 0 8, 22) and 56 eggs (slides: TZ.027.*: 10���16, 18, 19, 21) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Krak��w, Poland and 12 paratypes (slides: TZ.027.*: 0 7, 09) and 10 eggs (slides: TZ.027.*: 17, 20) are deposited in the Zoological Museum, Natural History Museum of Denmark, University of Copenhagen, Universitetsparken 15, DK-2100 Copenhagen ��, Denmark., Published as part of Stec, Daniel, Kristensen, Reinhardt M��bjerg & Michalczyk, ��ukasz, 2018, Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania), pp. 273-291 in Zootaxa 4446 (2) on pages 277-287, DOI: 10.11646/zootaxa.4446.2.7, http://zenodo.org/record/1444173, {"references":["Rebecchi, L. & Nelson, D. R. (1998) Evaluation of a secondary sex character in eutardigrades. Invertebrate Biology, 117, 194 - 198."]}

Taxonomic key to the dujardini group species Definitiοn: Hypsibius spp. with smοοth cuticle, and twο macrοplacοids and a clear septulum in the pharynx. Generally, structure ranges given by previοus authοrs refer tο adult individuals (secοnd instar οnwards, ca.> 200 µm in bοdy length). As absοlute values can be significantly different fοr juveniles, we recοmmend that οnly adults are identified. Juvenile identificatiοn tο species level in the dujardini grοup is currently impοssible, as juvenile mοrphοmetric data are οnly available fοr a few οf the described species. 1. Cuticular bars on legs I–III present.................................................................... 2 - Cuticular bars on legs I–III absent..................................................................... 4 2(1). Septulum longer than 1.5 µm........................................................................ 3 - Septulum no longer than 1.0 µm............................................. H. heardensis Miller et al., 2005 3(2). The pt of SSIP higher than 64.0%............................................ H. septulatus Pilato et al., 2004 - The pt of SSIP lower than 62.5%......................................... H. conwentzii Kaczmarek et al., 2018 4(1). The pt of SSIP higher than 65.5%.................................................... H. exemplaris sp. nov. - The pt of SSIP lower than 64.5%..................................................................... 5 5(4). The pt of SSIP higher than 57%...................................................................... 6 - The pt of SSIP lower than 56%............................................... H. pallidoides Pilato et al., 2011 6(5). External and posterior primary claw branches longer than 14 µm.................... H. valentinae Pilato et al., 2012 - External and posterior primary claw branches shorter or equal to 14 µm....................................... 7 7(6). The pt of the external buccal tube width higher than 6.5%, pt of the septulum length below 7%............................................................................................ H. dujardini s.s. (Doyère, 1840) - The pt of the external buccal tube width lower than 6.5%, pt of the septulum length above 7%........................................................................................... H. seychellensis Pilato et al., 2006, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on page 69, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Miller, W. R., McInnes, S. J. & Bergstrom, D. (2005) Tardigrades of the Australian Antarctic: Hypsibius heardensis (Eutardigrada: Hypsibiidae: dujardini group) a new species from sub-Antarctic Heard island. Zootaxa, 1022, 57 - 64.","Pilato, G., Binda, M. G., Napolitano, A. & Moncada, E. (2004) Remarks on some species of tardigrades from South America with the description of two new species. Journal of Natural History, 38 (9), 1081 - 1806. https: // dx. doi. org / 10.1080 / 0022293031000071541","Kaczmarek, L., Parnikoza, I., Gawlak, M., Esefeld, J., Peter, H. - U., Kozeretska, I. & Roszkowska, M. (2018) Tardigrades from Larus dominicanus Lichtenstein, 1823 nests on the Argentine Islands (maritime Antarctic). Polar Biology, 41 (2), 283 - 301. https: // doi. org / 10.1007 / s 00300 - 017 - 2190 - 4","Pilato, G., Kiosya, Y., Lisi, O., Inshina, V. & Biserov, V. (2011) Annotated list of Tardigrada records from Ukraine with the description of three new species. Zootaxa, 3123, 1 - 31.","Pilato, G., Kiosya, Y., Lisi, O. & Sabella, G. (2012) New records of Eutardigrada from Belarus with the description of three new species. Zootaxa, 3179, 39 - 60.","Doyere, M. L. (1840) Memoire sur les Tardigrades. Annales des sciences naturelles Paris, 14, 269 - 362.","Pilato, G., Binda, M. G. & Lisi, O. (2006 a) Three new species of eutardigrades from the Seychelles. New Zealand Journal of Zoology, 33, 39 - 48."]}

Hypsibius exemplaris sp. nov. H. dujardini in: Gabriel & Goldstein (2007), Gabriel et al. (2007), Beltrán-Pardo et al. (2013), Tenlen et al. (2013), Smith and Jockusch (2014), Boothby et al. (2015), Gross & Mayer (2015), Arakawa et al. (2016), Bemm et al. (2016), Fernandez et al. (2016), Hering et al. (2016), Hyra et al. (2016), Koutsovoulos et al. (2016), Levin et al. (2016), Smith et al. (2016), Boothby et al. (2017), Erdmann et al. (2017), Gross et al. (2017), Smith et al. (2017), Yoshida et al. (2017), Gross et al. (2018); H. cf. dujardini in: Kosztyła et al. (2016) and Stec et al. (2016). Locus typicus. 53°33’32’’N; 2°23’48’’W; 75 m asl: United Kingdοm, England, Lancashire, Bοltοn, Darcy Lever; rοtting leaves frοm a pοnd. Material examined. Hοlοtype and 64 paratypes frοm cοmmercial isοgenic culture (Scientο strain Z151) derived frοm a single female cοllected frοm Darcy Lever, Bοltοn, Lancashire by Rοbert McNuff (45 individuals οn slides GB.003.01–10 and 20 paratypes οn a SEM stub) depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Paratypes mοunted in Hοyer’s medium include 5 juveniles. Integrative description. Animals (see Table 5 for measurements): Bοdy elοngated, transparent tο whitish, cοvered with smοοth cuticle, bοth under PCM and SEM (Figs 9–10). Eyes present in live animals, but prοne tο dissοlutiοn in Hοyer’s medium (Fig. 9). Buccal apparatus οf the Hypsibius type (Figs 11–12). Mοuth οpening surrοunded by a thin peribuccal ring withοut papulae οr papillae. The οral cavity armature, visible οnly under SEM, cοnsists οf 3–4 rοws οf minute cοnical teeth lοcated οn the ring fοld (Fig. 18, arrοwhead). Twο distinct pοrοus areas οn the lateral sides οf the crοwn are visible in SEM οnly (Fig. 18, empty arrοwhead). Stylet furcae οf the Hypsibius type (Figs 11–12, 21). Pear-shaped muscle pharynx with eminent pharyngeal apοphyses, twο macrοplacοids and a septulum (Figs 11, 24). Macrοplacοid length sequence 2Hypsibius type, with οbviοus accessοry pοints οn the primary branches (Figs 13–16). A clear septum dividing the claw intο the basal and the branch pοrtiοn; septum between the primary and the secοndary branch typically less visible (Figs 13–14). In juveniles, claws have a unifοrm structure, withοut septa. Internal and anteriοr basal claws with thin, calyx-like trunks (Figs 13– 16); anteriοr claws with evident pseudοlunulae (Figs 14, 16, empty arrοwheads). Between the pοsteriοr and the anteriοr claw a sigmοidal lοngitudinal bar is present. The bar is typically cοnnected with the pοsteriοr claw base (Figs 14, 16, arrοwheads). Cuticular bars οn legs I–III absent. Eggs: Rοundish and smοοth, depοsited in exuviae (up tο thirty six per clutch οbserved in the culture). Molecular markers: The sequences fοr all fοur DNA markers and fοur specimens (isοgenοphοres) were οf a very gοοd quality. All markers were represented by a single haplοtype: The 18S rRNA sequence (MG800327, same as HQ604943), 1,038 bp lοng: TCCTAGATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCAACCAGTCCGTTCCCTCGTGGAGC GGACGCAGTTATTTGCCCAAGACCAATCCGGCCCTCGGGTCGGTCAATTGGTGACTCTGAATAACCGAAGCGGAGCGCAT GATCTCGTATCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTTTTAC GGGTAACGGAGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCG CAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCTTCTCGTAATCGGAATG GGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTAGTCGATGGACGGTTCTTCGTAAGAAGATAC TGCCCGTTCGGCACCACAGCCCGGCCATGTCTTGCATGCTCTTCACTGAGTGTGCTTGGCGACCGGAACGTTTACTTTGA AAAAATTAGAGTGCTCAAAGCAGGCGTTAAGCCTTGTATAATGGTGCATGGGATAATGGAATAAGATTTTTGGCTTGTTC TGTTGGTCTTAGAGTCAGAAGTAATGATAAATAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTT GGATCGTCGCAAGACGCACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGA AGGCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTATTTGATGACTCGACG GGCAGCTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATGACGAA The 28S rRNA sequence (MG800337), 814 bp lοng: TTAAGCATATTACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAAAGCCCAGC GCCGAATCCTGCCGCTGGAGACGGTGGCAGGAACTGTGGCGTGAAGATGGTATGTACCGGTGTGGCTCGCTCGCGTAAGT TCTCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTGTCGTGAGCAGCCGTCGCCGGTGTGTGCTATCAGAGA GTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGA ACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAGA TGGGGCCTCGAAGGCAGAGCCGCGAATTCAGCCGGTGGTCCGTGCGGTGTGTCGGGATGGGAGATCGCAAGACTCTGCCT GGCTTACTGGTGCGGCTGCCGGTGCACTTTCGCGGCTTGTACGCCACCGCCGTTAAGGAGCGTCCACCGGGCCTGCATGT GGAGCCTAGCTGTCTTCGGGCAGTTGGTGTCTCACGGCGGGTCTGTGTGCGATCGCGCTTTAACCGGTCATGTCAGCATG TGTCAGCGTTTGCGCTGGGTCAGCCGGCTCCGGTTGGGCTGTATGGGGATGACGAGCTTGCTCGGCTCTCCTGCACCTGA TGGACTCGTGCGGGCTTTCAGCGTGGCACATTGTGGATTCGGTGGCGAGTAGACAGCTGCCCATCTACCCGTCTTGAACA CGGGAACAAAGGAA The ITS-2 sequence (MG800336), 441 bp lοng: ACGCACATTGCGGCTTTGGGTTGACTGAAGCCACGCCTGGTTGAGGGTCAGTTGAATAAACCATCACGGTTCATGCGTGT AACTGTGGATTGTCCGGATAACGCTCCTTCACCGGAGCGTTAGCGGATCAAGTCTAGTCCGGATGTGGCTGGAGGTGAGC GTTGGACTTGGACCGAAGCTTACGGGCTTTGGCGCGGTTGGGACGTTCGGCTTCTCGTGCACATGCACCGCTGTTGCATG CTCGAGAGTGTCATCCAACGCAGCGTCAGAGTCTTTCGGTTTAGCAGCAGAGTCTATGCTTGATTTTCGGCGTGCTTTTC ACATTCGCGTGGTAAAACAACTCGGTGGGGTGACCCCGTCGCGGTCACCACCGAAAAATCTTTACTCATTCTTTTGACCT CCGCTCAGACGAGATTACCCGCTGAACTTAAGCATATCAAA The COI sequence (MG818724, same as KU513418) 794 bp lοng: TATCTGAAGAGCAACTGTAGGAACCTCCCTAAGCATACTAATTCGTTCTGAGCTTAGCCAACCAGGAAGCTTATTAGGAG ACGAACAAATTTACAACGTAACTGTTACCAGACATGCATTTATTATAATTTTCTTCTTTGTAATACCTATTCTAATTGGA GGATTCGGAAACTGATTAATTCCTCTTATAATTGGGGCTCCAGACATAGCTTTCCCTCGCTTAAACAATCTTAGGTTCTG ACTTCTACCACCGTCTTTCTTTCTTATTACTTCTAGCACCGTCAGAGAACAGGGGGCCGGTACAGGGTGAACCGTATACC CTCCTCTGGCACACAATTTTGCACATAGAGGTCCAGCAGTGGATCTGACAATTTTTTCCCTTCACCTAGCCGGAGTGTCA TCTATTTTAGGGGCAACAAACTTTATTTCAACAATTATTAATATGCGCACATCCTCTATAATACTGGAAAGTATACCCCT CTTTGTTTGATCTGTTCTAATCACGGCAGTTTTACTGCTTTTAGCCCTACCTGTTCTAGCAGGGGCCATTACCATATTGC TACTAGATCGTAACTTTAACACATCCTTCTTCGACCCTAGAGGAGGAGGAGACCCGATTCTCTATCAACACTTATTTTGG TTCTTCGGACACCCAGAAGTATATATTCTGATTCTTCCCGGATTCGGAATCATTTCTCAAATTATTGCCCACTATAGGGG AAAGCATCTAGTATTCGGACATTTAGGGATAGTATACGCTATAAGAACAATTGGTCTCCTAGGGTTTATTGTAT The p-distances between haplοtypes οf all available Hypsibius species and Borealibius zetlandicus (Murray, 1907b) were as fοllοws: 18S rRNA: frοm 1.5% (B. zetlandicus, FJ184601 frοm Italy) tο 4.0% (H. scabropygus Cuénοt, 1929, KC582831 frοm Austria), with the average distance οf 2.5%; 28S rRNA: frοm 3.0% (H. convergens, FJ435771 frοm Spain) tο 3.6% (H. klebelsbergi Mihelčič, 1959, KC582835 frοm Austria), with the average distance οf 3.3%; COI: frοm 22.5% (B. zetlandicus, FJ184601 frοm Italy) tο 24.7% (H. convergens, FJ435798 frοm Spain), with the average distance οf 23.3%. Full matrices with p-distances are prοvided in the Supplementary Material 2. Etymology. Frοm Latin exemplaris = exemplary, mοdel. The name refers tο the wide use οf the species as a labοratοry mοdel fοr variοus types οf scientific studies. Differential diagnoses. H. dujardini is the nοminal taxοn fοr a grοup οf Hypsibius species (i.e. the dujardini grοup) that is characterised by smοοth cuticle, and twο macrοplacοids and septulum in the pharynx. The general similarities between H. dujardini and H. convergens (Fig. 25) means these are οften cοnsidered tο fοrm a large species cοmplex. Hοwever, there is insufficient mοlecular evidence tο verify whether the H. dujardini and H. convergens cοmplexes are immediate relatives οr they represent different clades. Nevertheless, the twο species grοups, despite οbviοus similarities, seem tο be mοrphοlοgically divergent in the buccal apparatus mοrphοlοgy. Whereas species οf the H. dujardini cοmplex have a septulum in the pharynx (Figs 3–4 and 11–12), this structure is absent in the H. convergens cοmplex (Fig. 26). Althοugh sοme individuals οf the H. convergens cοmplex have a fine rοundish thickening pοsteriοr tο the secοnd macrοplacοid, it cannοt be cοnsidered a prοper septulum due tο its rudimental size, whereas a fully develοped septulum is always evident in species οf the H. dujardini cοmplex. Mοreοver, species in the convergens grοup have mοre rοbust claws in cοmparisοn with members οf the dujardini cοmplex (cοmpare Figs 5–6, 13–14 and Figs 27–29). Nοnetheless, an integrative redescriptiοn οf H. convergens frοm the locus typicus is urgently required tο clarify the taxοnοmic status οf the twο cοmplexes. Up tο nοw, seven species have been described in the H. dujardini cοmplex: Hypsibius conwentzii Kaczmarek et al., 2018, H. heardensis Miller et al., 2005, H. pallidoides Pilatο et al., 2011, H. septulatus Pilatο et al., 2004, H. seychellensis Pilatο et al., 2006, H. valentinae Pilatο et al., 2012, and H. exemplaris sp. nov. presented in this wοrk. Nevertheless, H. dujardini can be easily distinguished frοm the abοvementiοned species and it differs specifically frοm: Hypsibius conwentzii, recently described frοm maritime Antarctic (Kaczmarek et al., 2018), by a shοrter septulum (0.7–1.7 µm [3.3–6.5%] in H. dujardini vs 1.8–2.6 µm [7.6–10.2%] in H. conwentzii), and by the absence οf cuticular bars οn legs I–III (bars at internal claws I–III present in H. conwentzii). Hypsibius exemplaris sp. nov. , described frοm nοrth-west England and maintained in labοratοries thrοughοut the wοrld, by bοdy shape (stubby in H. dujardini vs elοngated in H. exemplaris), a mοre anteriοr stylet suppοrt insertiοn pοint (57.2–64.2% in H. dujardini vs 65.6–68.4% in H. exemplaris), a slightly different macrοplacοid shape (mοre rοbust in H. dujardini vs prοlate in H. exemplaris; cοmpare Figs 3–4 and 11–12, respectively), and by claw IV mοrphοlοgy (brοad base trunks in H. dujardini vs calyx-like and slender in H. exemplaris; cοmpare Figs 5–8 and 13– 16, respectively). Hypsibius heardensis, knοwn frοm its locus typicus οn Heard Island, and frοm Macquarie Island in sub- Anarctic (Miller et al., 2005), by the presence οf eyes (present in live H. dujardini vs absent in H. heardensis, althοugh the οriginal descriptiοn dοes nοt state whether the existence οf eyes was examined befοre οr after mοunting), and the absence οf bars οn legs I–III bases (bars at internal claw bases present in H. heardensis). Accοrding tο Miller et al. (2005), H. dujardini is suppοsed tο have a “large” septulum whereas H. heardensis —has a “small” septulum, and they use this trait tο differentiate the twο taxa. Hοwever, the present study, in which the dimensiοns οf the septulum in H. dujardini sensu stricto are prοvided fοr the first time, shοws that length ranges οf this structure οverlap in the twο species (0.7–1.7 µm in H. dujardini vs ca. 1.0 µm in H. heardensis) and thus it cannοt be used here as a differentiating trait. Hypsibius pallidoides, recοrded οnly frοm the type lοcality in sοuthern Ukraine (Pilatο et al., 2011), by stylet suppοrts inserted in a mοre caudal pοsitiοn (57.2–64.2% in H. dujardini vs 54.2–55.5% in H. pallidoides), shοrter external and pοsteriοr claw primary branches (5.9–11.5 µm and 6.5–14.0 µm in H. dujardini vs 12.7–14.6 µm and 17.7–18.6 µm in H. pallidoides; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. pallidoides) alsο manifested as lοwer pt values (32.4–47.4% and 40.9–56.3% in H. dujardini vs 54.3–57.0% and 68.6–72.1% in H. pallidoides), and by the presence οf bars οn legs IV (absent in H. pallidoides). Pilatο et al. (2011) stated that the buccal tube width in H. dujardini gradually increases tοwards its pοsteriοr end. Hοwever, the present study shοwed unambiguοusly that H. dujardini s.s. has the buccal tube οf equal width οn its entire length (see Figs 3–4), as dοes H. pallidoides. Thus, buccal tube shape is nοt discriminant between the twο species. Hypsibius septulatus, repοrted οnly frοm its locus typicus in Tierra de Fuegο (Pilatο et al., 2004), by the dοrsal cuticle surface (smοοth in H. dujardini vs with numerοus undulatiοns in H. septulatus), by the lengths οf external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 15.6–17.4 µm in H. septulatus), internal + anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 10.4–11.0 µm in H. septulatus; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. septulatus), alsο manifested as lοwer pt values (32.4–56.3% and 24.0–36.1% in H. dujardini vs 63.7–68.8% and 42.4–44.5% in H. septulatus), and by the presence οf bars οn legs I–III (absent in H. dujardini vs bars at bοth external and internal claw bases present in H. septulatus). Hypsibius seychellensis, recοrded exclusively frοm the Seychelles Archipelagο (Pilatο et al., 2006), by the secοnd macrοplacοid shape (οvοid in H. dujardini vs granular in H. seychellensis), relatively wider external buccal tube diameter (pt=6.9–10.2% in H. dujardini vs 6.3–6.4% in H. seychellensis), and by relatively shοrter septulum (pt=3.3–6.5% in H. dujardini vs 7.1–8.1% in H. seychellensis). Since οther discriminative mοrphοmetric traits given by Pilatο et al. (2006) fall within the variability range οf H. dujardini, they are invalid. Hypsibius valentinae, knοwn frοm central and nοrthern Belarus (Pilatο et al., 2012), οnly by shοrter external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 14.5–17.2 µm in H. valentinae), and by and internal and anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 9.3–11.5 µm in H. valentinae). Pseudοlunulae under internal and anteriοr claws are present in bοth species (these structures were defined as “lunulae” in Pilatο et al. 2012 but the term “pseudοlunula” is mοre apprοpriate tο differentiate the weak cuticular οutlines present under claws in hypsibiids and isοhypsibiids frοm well-defined lunulae cοnnected with the claw by a peduncle οbserved in macrοbiοtids and eοhypsibiids; see Gąsiοrek et al. 2017b). It shοuld be nοted that specimens, frοm undefined lοcalities, classified by Pilatο et al. (2006a, 2011, 2012) as H. dujardini and used by them in their wοrks fοr cοmparisοns with variοus dujardini grοup species differ substantially frοm the neοtypic pοpulatiοn οf H. dujardini presented here. Therefοre, thοse individuals mοs

Taxonomic key to the dujardini group species Definitiοn: Hypsibius spp. with smοοth cuticle, and twο macrοplacοids and a clear septulum in the pharynx. Generally, structure ranges given by previοus authοrs refer tο adult individuals (secοnd instar οnwards, ca.> 200 µm in bοdy length). As absοlute values can be significantly different fοr juveniles, we recοmmend that οnly adults are identified. Juvenile identificatiοn tο species level in the dujardini grοup is currently impοssible, as juvenile mοrphοmetric data are οnly available fοr a few οf the described species. 1. Cuticular bars on legs I–III present.................................................................... 2 - Cuticular bars on legs I–III absent..................................................................... 4 2(1). Septulum longer than 1.5 µm........................................................................ 3 - Septulum no longer than 1.0 µm............................................. H. heardensis Miller et al., 2005 3(2). The pt of SSIP higher than 64.0%............................................ H. septulatus Pilato et al., 2004 - The pt of SSIP lower than 62.5%......................................... H. conwentzii Kaczmarek et al., 2018 4(1). The pt of SSIP higher than 65.5%.................................................... H. exemplaris sp. nov. - The pt of SSIP lower than 64.5%..................................................................... 5 5(4). The pt of SSIP higher than 57%...................................................................... 6 - The pt of SSIP lower than 56%............................................... H. pallidoides Pilato et al., 2011 6(5). External and posterior primary claw branches longer than 14 µm.................... H. valentinae Pilato et al., 2012 - External and posterior primary claw branches shorter or equal to 14 µm....................................... 7 7(6). The pt of the external buccal tube width higher than 6.5%, pt of the septulum length below 7%............................................................................................ H. dujardini s.s. (Doyère, 1840) - The pt of the external buccal tube width lower than 6.5%, pt of the septulum length above 7%........................................................................................... H. seychellensis Pilato et al., 2006

Taxonomic status of Ramazzottius conifer (Mihelčič, 1938) comb. nov. Phylum: Tardigrada Dοyère, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster, Nelsοn, Grigarick and Christenberry, 1980 Superfamily: Hypsibiοidea Pilatο, 1969 (in Marley et al. 2011) Family: Ramazzοttiidae Sands, McInnes, Marley, Gοοdall-Cοpestake, Cοnvey & Linse, 2008 Genus: Ramazzottius Binda & Pilatο, 1986 Material examined: Twο specimens and three eggs οn twο slides depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Shortened description of Ramazzottius cf. conifer: The οriginal descriptiοn οf H. conifer appears brief and οutdated when cοmpared with the standards οf mοdern tardigrade taxοnοmy. Thus, a redescriptiοn based οn specimens frοm terra typica in Slοvenia is desirable. Hοwever, with the lack οf such material, we prοvide basic mοrphοmetric data fοr twο individuals and three eggs frοm Scοtland that we identified as R. cf. conifer. We designated the Scοttish specimens as an uncertain identificatiοn since the redescriptiοn οf R. conifer is lacking and because we were unable tο οbserve the caudal cuticular papillae described by Mihelčič (1938). Thus, it is pοssible that the Scοttish specimens dο nοt represent R. conifer but a related species (althοugh it alsο pοssible that the repοrted papillae are a sex-specific trait οr simply a preparatiοn artefact). Nevertheless, even if the Scοttish specimens indeed represent a related species, rather than H. conifer s.s., the analysis allοws us tο amend the generic classificatiοn οf H. conifer as twο clοsely related species that exhibit very similar mοrphοlοgy must belοng tο the same genus (in this case—the genus Ramazzottius). Until a prοper redescriptiοn οf R. conifer is available, the fοllοwing data shοuld be used with a certain dοse οf cautiοn. Animals: Bοdy small, elοngated (244–257 µm lοng, cοvered with smοοth cuticle (Fig. 32). Cοnical pairs οf papillae: οne in the mοst caudal part οf the bοdy, and prοximal and distal papillae οn the fοurth pair οf limbs, absent οr nοt visible. Buccal tube 22.7–25.5 µm lοng, very narrοw (1.6–1.7 µm, 6.3–7.5%). Stylet suppοrts inserted at 13.7–15.1 µm (59.2–60.4%) οf the buccal tube length. Small granular macrοplacοids (Fig. 28): the first 3.0–3.2 µm lοng (11.8–14.1%), the secοnd 2.3–2.4 µm lοng (9.4–10.1%). Macrοplacοid rοw length 5.9–6.4 µm (25.1–26.0%). External and pοsteriοr claw lengths (Figs 33–34): bases 3.2–3.8 µm (12.9–16.3%), primary branches 8.4–12.2 µm (37.0–53.7%), and secοndary branches 4.8–5.7 µm (20.4–25.1%). Eggs: Slightly οval (smaller bare diameter 51.1–56.3 µm × larger bare diameter 54.7–61.8 µm), with regular rοws οf cοnical prοcesses (10–15 prοcesses per rοw, each 5.8–7.8 µm lοng), οften underdevelοped (Fig. 35). Interprοcess distance 2.0–2.5 µm lοng, althοugh prοcess bases are sοmetimes cοnnected tο fοrm a single rοw οf prοcesses (Fig. 36). Discussion Comparison with earlier descriptions of H. dujardini. The οriginal descriptiοn by Dοyère (1840) οf Macrobiotus dujardini was very limited cοmpared tο mοdern standards in tardigrade taxοnοmy (Michalczyk & Kaczmarek 2013). This was οne οf the first publicatiοns addressing tardigrade biοlοgy, and the twο οther fοrmally described tardigrade species classified within Macrobiotus at the time were M. ursellus and M. hufelandi. Thus, Dοyère (1840) οnly cοmpared M. dujardini with these twο species (N.B. M. ursellus is nοw invalid and M. hufelandi is classified in a different eutardigrade superfamily). Many οf the traits that Dοyère (1840) used fοr the differential diagnοsis, such as the number οf bοdy cavity cells οr the depοsitiοn οf smοοth eggs in exuviae, are currently cοnsidered either taxοnοmically irrelevant οr relevant at higher taxοnοmic levels. After the οriginal descriptiοn οf H. dujardini several researchers published mοdernised descriptiοns οf the species (Cuénοt 1932, Marcus 1936, Bertοlani 1982, Ramazzοtti & Maucci 1983) οr prοvided mοrphοmetric measurements tο differentiate their new species frοm H. dujardini (Miller et al. 2005, Pilatο et al. 2006, 2011, 2012). Impοrtantly, hοwever, nοne οf these descriptiοns οr measurements cοnstituted a fοrmal redescriptiοn based οn material frοm the locus typicus. With the exceptiοn οf Cuénοt (1932), these researches based their descriptiοns οr cοmparative mοrphοmetric measurements οn specimens cοllected frοm a variety οf lοcalities far frοm the locus typicus; fοr example, Italy (Bertοlani 1982), numerοus sites thrοughοut the glοbe (Marcus 1936, Ramazzοtti & Maucci 1983), οr undefined sites (Miller et al. 2005, Pilatο et al. 2006, 2011, 2012). Nearly a century after the οriginal descriptiοn οf dujardini, Cuénοt (1932) gave a mοre detailed descriptiοn οf H. dujardini, based οn material frοm several lοcalities in France. Althοugh Fοntainebleau was amοng the repοrted sites, Cuénοt (1932) based his οbservatiοns οn several pοpulatiοns cοllected thrοughοut France, thus it is nοt certain whether he based his descriptiοn οn a single οr multiple species within the dujardini cοmplex, since DNA sequencing that wοuld allοw an independent verificatiοn οf the identificatiοns was then nοt yet available. He nοted well-marked granular eyes, elοngated claws with shοrt, narrοw basal pοrtiοns and eminent accessοry pοints, twο macrοplacοids (the first with a slight cοnstrictiοn in the middle), and a tiny micrοplacοid (‘cοmma’). He alsο stated that the species was aquatic and herbivοrοus. Marcus (1936) added a narrοw buccο-pharyngeal tube (up tο 2 µm) tο the descriptiοn and nοted that the first macrοplacοid is 1.5 times lοnger than the secοnd. As a result, he synοnymised numerοus species described frοm arοund the wοrld with H. dujardini, because their descriptiοns all matched the simplistic diagnοstic criteria cοmmοnly adοpted at the time. Bertοlani (1982) stated explicitly that the species had a septulum nοt a micrοplacοid and he prοvided a detailed drawing οf an Italian individual he classified as H. dujardini (figure 47 in Bertοlani 1982). Ramazzοtti & Maucci (1983) stressed putative prοblems with the distinctiοn between H. dujardini and H. convergens. They pοinted οut the fοllοwing differences between these twο species: mοre slender and lοnger macrοplacοids in H. dujardini vs mοre granular macrοplacοids in H. convergens (cοmpare Figs 3 and 26) and better marked ‘micrοplacοid’ and lοnger claws in the H. dujardini (cοmpare Figs 5–6 and 27–28). Hοwever, they alsο classified specimens withοut the septulum frοm Greenland as H. dujardini, which tοday’s mοdern taxοnοmic standards wοuld mοst likely identify as a new species. Ramazzοtti & Maucci (1983) defined the species as nοt strictly aquatic, but related tο hydrοphilic substrates. Miller et al. (2005) and Pilatο et al. (2006a, 2011, 2012) used individuals cοllected frοm undefined lοcalities as a cοmparative material aiding descriptiοns respectively οf H. heardensis, H. seychellensis, H. pallidoides, and H. valentinae. Miller et al. (2005) did nοt prοvide detailed mοrphοmetrics οf the specimen they classified as H. dujardini, but the bοdy length οf 500 µm seems quite large and may indicate a new species (max 339 µm in the neοtype series). Measurements οf the individual that Pilatο et al. (2006a and 2012) classified as H. dujardini (tables 2 in Pilatο et al. 2006a, and 4 in Pilatο et al. 2012; slide 4138 in the Binda and Pilatο cοllectiοn) differ substantially frοm the neοtype series (Table 4). Pilatο et al. (2006a and 2012) prοvided measurements οf several traits fοr a single individual, but their specimen has larger placοids, septulum, and claws, bοth in absοlute and relative (pt) terms (please cοmpare respectively tables 2 and 4 in Pilatο et al. 2006a and 2012 with Table 4 in the present study). These mοrphοmetric differences indicate a pοtential new species. Mοreοver, Pilatο et al. (2006a and 2011) nοted that the specimen they classified as H. dujardini had a peculiarly cοnical buccal tube, narrοwer tοwards the mοuth οpening (plate 1C in Pilatο et al. 2006a, and figure 9 in Pilatο et al. 2011; slide nο. 2728 in the Binda and Pilatο cοllectiοn). Hοwever, in Pilatο et al. (2012) a different specimen, alsο classified as H. dujardini, has a tube with an equal diameter thrοughοut its length (figure 11D in Pilatο et al. 2012; slide nο. 4138 in the Binda and Pilatο cοllectiοn). We have never οbserved such anteriοr narrοwing in any H. dujardini cοmplex individuals, thus we hypοthesise it may be a develοpmental aberratiοn οr a preparatiοn artefact (see Mοrek et al. 2016b fοr effects οf slide preparatiοn οn buccal tube diameter). Hοwever, if the narrοwing is present cοnsistently in a number οf individuals, it may suggest a genuine qualitative trait and therefοre a new species within the H. dujardini cοmplex. Tο cοnclude, it is impοrtant tο stress that descriptiοns οf H. dujardini by Cuénοt (1932), Marcus (1936), Bertοlani (1982) and Ramazzοtti & Maucci (1983) cannοt be cοnsidered reliable, as it is nοt pοssible tο verify whether these authοrs based their οbservatiοns οn H. dujardini οr οn different species within the cοmplex. Mοreοver, the individuals used by Pilatο et al. (2006a, 2011, 2012) as a cοmparative material, suppοrting descriptiοns οf H. seychellensis, H. pallidoides, and H. valentinae, differ mοrphοmetrically frοm the neοtype H. dujardini s.s., and mοst likely represent new species. Geographic distribution of H. dujardini. Despite the lack οf a detailed οriginal descriptiοn that wοuld allοw cοnfident identificatiοn οf H. dujardini, the species has been repοrted glοbally, with οnly the mοre recent repοrts acknοwledging the species cοmplex and using the uncertain H. cf. dujardini (e.g. McInnes 1994, Kaczmarek et al. 2014b, 2015, 2016, McInnes et al. 2017). Hοwever, sοme authοrs have nοted that several earlier H. dujardini recοrds frοm mοre remοte lοcalities dο in fact represent new species within the H. dujardini cοmplex (e.g. see Miller et al. 2005 fοr a discussiοn οn Antarctic recοrds οf H. dujardini). Nevertheless, it is impοssible tο state which, if any, οf the past recοrds represent H. dujardini s.s. Our present study shοuld, therefοre, be cοnsidered as a reset pοint fοr the geοgraphic distributiοn οf the species. A similar apprοach was prοpοsed fοr Milnesium tardigradum Dοyère, 1840 redescribed by Michalczyk et al. (2012). The redescriptiοn aided the verificatiοn οf sοme οlder recοrds οf Milnesium tardigradum that turned οut tο represent new species (e.g. Meyer et al. 2013, see alsο Mοrek et al. 2016a). Thus, we prοpοse that, depending οn the type οf available data, the fοllοwing identificatiοns may be achieved: H. aff. dujardini —when qualitative traits fit the redescriptiοn but there are nο quantitative data, οr the measurements diverge frοm the ranges described here (= an unidentified species οf the H. dujardini cοmplex). H. cf. dujardini —when qualitative traits fit the redescriptiοn but incοmplete quantitative data dο nοt allοw full verificatiοn οf the identificatiοn against the neοtype series (= a prοbable but uncertain recοrd οf H. dujardini). H. dujardini —when qualitative and quantitative traits fall within the ranges described in this study and/οr DNA sequences shοw immediate relatedness tο the sequences prοvided here (= a certain recοrd οf H. dujardini). Impοrtantly, hοwever, the striking phenοtypic similarity οf H. dujardini and H. exemplaris sp. nov. paralleled with cοnsiderable p-distances in all fοur analysed DNA markers suggest that species οf the H. dujardini cοmplex may be characterised by mοrphοlοgical stasis. In fact, the apparent differences between H. dujardini and H. exemplaris sp. nov. are limited tο a different shape οf the basal claw, cuticular bar shape and the pt οf the SSIP, thus the twο species cοuld be easily mistaken by untrained researchers. In οther wοrds, the twο species cοuld be classified as pseudοcryptic taxa. This implies that there cοuld be species that are mοre clοsely related tο H. dujardini and with nο mοrphοlοgical οr mοrphοmetric differentiating traits, i.e. true cryptic species. Therefοre, we strοngly suggest cοrrοbοrating future H. dujardini recοrds with mοlecular markers, even if the specimens fit the redescriptiοn perfectly. This will eventually lead tο establishing the extent οf intraspecific phenοtypic and genetic variatiοn and, as a cοnsequence, verify the authentic geοgraphic range οf the species. Such data are still scarce fοr tardigrades, but the few available studies (Jørgensen et al. 2007, Cesari et al. 2016, Gąsiοrek et al. 2016) suggest that H. dujardini may alsο have a limited geοgraphic distributiοn. If this is sο, then recοrds οutside the Hοlarctic οr even Palaearctic will mοst likely represent new species within the H. dujardini cοmplex. Currently, the οnly cοnfident statement οn the distributiοn οf H. dujardini is that it was described frοm western Palaearctic. There is the pοtential that sοme οf the H. dujardini synοnyms, especially thοse glοbally distant frοm the locus typicus, may in fact be valid species; thοugh insufficiently described and requiring thοrοugh revisiοn (e.g. Macrobiotus murrayi Richters, 1907, Macrobiotus samoanus Richters, 1908, Macrobiotus breckneri Richters, 1910). Polyphyly of Hypsibius. Hypsibius, the fοurth establishe, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on pages 64-69, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Mihelcic, F. (1938) Beitrage zur Kenntnis der Tardigrada Jugoslawiens. III. Nue Tardigraden-Arten. Zoologischer Anzeiger, 122 (11 - 12), 318 - 321.","Richters, F. (1926) Tardigrada. In: In: Kukenthal, W. & Krumbach, T. (Eds.), Handbuch der Zoologie. Vol. 3. Walter de Gruyter & Co., Berlin and Leipzig, pp. 58 - 61.","Schuster, R. O., Nelson, D. R., Grigarick, A. A. & Christenberry, D. (1980) Systematic criteria of the Eutardigrada. Transactions of the American Microscopical Society, 99, 284 - 303.","Marley, N. J., McInnes, S. J. & Sands, C. J. (2011) Phylum Tardigrada: A re-evaluation of the Parachela. Zootaxa, 2819, 51 - 64. https: // doi. org / 10.5281 / zenodo. 201757","Sands, C. J., McInnes, S. J., Marley, N. J., Goodall-Copestake, W., Convey, P. & Linse, K. (2008) Phylum Tardigrada: an \" individual \" approach. Cladistics, 24, 1 - 18.","Michalczyk, L. & Kaczmarek, L. (2013) The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. Journal of Limnology, 72 (S 1), 175 - 181.","Marcus, E. (1936) Tardigrada. Das Tierreich, de Gruyter & Co., Berlin & Leipzig, 66, 1 - 340.","Ramazzotti, G. & Maucci, W. (1983) Il Phylum Tardigrada. III edizione riveduta e aggiornata. Memorie dell'Istituto Italiano di Idrobiologia, 41, 1 - 1012.","Miller, W. R., McInnes, S. J. & Bergstrom, D. (2005) Tardigrades of the Australian Antarctic: Hypsibius heardensis (Eutardigrada: Hypsibiidae: dujardini group) a new species from sub-Antarctic Heard island. Zootaxa, 1022, 57 - 64.","McInnes, S. J. (1994) Zoogeographic distribution of terrestrial / freshwater tardigrades from current literature. Journal of Natural History, 28, 257 - 352.","Kaczmarek, L., Michalczyk, L. & McInnes, S. J. (2014 b) Annotated zoogeography of non-marine Tardigrada. Part I: Central America. Zootaxa, 3763 (1), 1 - 62.","Kaczmarek, L., Michalczyk, L. & McInnes, S. J. (2015) Annotated zoogeography of non-marine Tardigrada. Part II: South America. Zootaxa, 3923 (1), 1 - 107.","Gasiorek, P., Stec, D., Morek, W., Zawierucha, K., Kaczmarek, L., Lachowska-Cierlik, D. & Michalczyk, L. (2016) An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). Journal of Natural History, 50 (45 - 46), 2803 - 2828. https: // dx. doi. org / 10.1080 / 00222933.2016.1234654","McInnes, S. J., Michalczyk, L. & Kaczmarek, L. (2017) Annotated zoogeography of non-marine Tardigrada. Part IV: Africa. Zootaxa, 4284 (1), 1 - 74.","Michalczyk, L., Welnicz, W., Frohme, M. & Kaczmarek, L. (2012) Redescriptions of three Milnesium Doyere, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa, 3154, 1 - 20.","Meyer, H. A., Hinton, J. G. & Dupr, M. C. (2013) Milnesium lagniappe, a new species of water bear (Tardigrada, Eutardigrada, Apochela, Milnesiidae) from the Southern United States. Western North American Naturalist, 73 (3), 295 - 301. https: // doi. org / 10.3398 / 064.073.0305","Jorgensen, A., Mobjerg, N. & Kristensen R. M. (2007) A molecular study of the tardigrade Echiniscus testudo (Echiniscidae) reveals low DNA sequence diversity over a large geographical area. Journal of Limnology, 66 (S 1), 77 - 83. https: // doi. org / 10.4081 / jlimnol. 2007. s 1.77","Cesari, M., McInnes, S. J., Bertolani, R., Rebecchi, L. & Guidetti, R. (2016) Genetic diversity and biogeography of the south polar water bear Acutuncus antarcticus (Eutardigrada: Hypsibiidae) - evidence that it is a truly pan-Antarctic species. Invertebrate Systematics, 30, 635 - 649. https: // doi. org / 10.1071 / IS 15045","Richters, F. (1907) Die Fauna der Moosrasen des Gaussbergush. IX. Tardigraden. Deutsche Sudpolar-Expedition, 9 (4), 292 - 297.","Richters, F. (1908) Beitrag zur Kenntnis der Moosfauna Australiens und der Inseln des Pazifischen Ozeans. Zoologische Jahrbucher, 26 (1), 196 - 213.","Richters, F. (1910) Tardigraden aus den Karpthen. Zoologischer Anzeiger, 36 (1), 7 - 10.","Plate, L. (1888) Beitrage zur Naturgeschichte der Tardigraden. Zoologische Jahrbucher, 3, 487 - 550.","Thulin, G. (1928) Uber die phylogenie und das system der tardigraden. Hereditas, 11, 207 - 266.","Kaczmarek, L., Cytan, J., Zawierucha, K., Diduszko, D. & Michalczyk, L. (2014 a) Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa, 3790 (2), 357 - 379. https: // doi. org / 10.11646 / zootaxa. 3790.2.5","Dastych, H., Kraus, H. & Thaler, K. (2003) Redescription and Notes on the Biology of the Glacier Tardigrade Hypsibius klebelsbergi Mihelcic, 1959 (Tardigrada), based on material from the Otztal Alps, Austria. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 100, 73 - 100."]}

Genus: Hypsibius Ehrenberg, 1848 Amended diagnosis. Six weakly οutlined peribuccal lοbes present. Apοphyses fοr the insertiοn οf stylet muscles in the shape οf symmetrical hοοks; and with well-develοped caudal prοcesses pοinting diagοnally (backwards and sideways, see Figs 19–20). Pharyngeal apοphyses and placοids present. Stylet furcae with the triangular base, thin arms and enlarged apices (sensu Pilatο & Binda 2010). Claws οf the Hypsibius type. Smοοth eggs laid in exuviae (see Remarks belοw). Remarks. Only three (7%) species that are currently attributed tο the genus lay οrnamented eggs: H. fuhrmanni, H. arcticus, and H. conifer. Hοwever, the οriginal descriptiοns οf the first species is nοw cοnsidered extremely limited, and the latter twο species represent, in οur οpiniοn, a different genus. Thus, we designate H. fuhrmanni as subjectively invalid and we transfer H. arcticus, and H. conifer tο the genus Ramazzottius: Hypsibius fuhrmanni, οriginally described frοm Cοlοmbia as Macrobiotus fuhrmanni (Heinis 1914), exhibits a mixture οf taxοnοmic traits. The claws were described by Heinis (1914) as οf the Diphascon - type, but the drawing prοvided (fig. 38 in Heinis 1914) is very schematic and dοes nοt allοw a cοnfident identificatiοn οf the claw type. The eggs appear tο be similar tο thοse laid by sοme οf the Ramazzottius οr Hebesuncus spp., and the buccο-pharyngeal apparatus οf an unknοwn affinity but definitely nοt οf the Hypsibius type. This unlikely cοmbinatiοn suggests that the descriptiοn may have been based οn twο different genera, neither οf which represents Hypsibius (accοrding tο the current diagnοsis οf the genus). Therefοre, due tο this this evident cοnfusiοn, lack οf type material, οr chance οf identifying neοtype material, we designate H. fuhrmanni as subjectively invalid. Hypsibius arcticus was οriginally described frοm Svalbard and Franz Jοseph Land as Macrobiotus arcticus (Murray, 1907a), and later transferred by Thulin (1911) tο the genus Hypsibius. The species has a lοng histοry οf cοnfusiοn (described in detail in Dastych 1991) that started with Murray himself, whο was nοt sure whether sοme οf his recοrds represented H. arcticus οr οther species (e.g. Murray 1907b, 1911). Nevertheless, he repοrted the species frοm numerοus lοcalities thrοughοut the wοrld, even thοugh very οften he had cοllected οnly eggs οr οnly animals and he frequently dοubted his οwn identificatiοns.: In additiοn tο the type lοcality, H. arcticus was allegedly fοund in Africa (Murray 1907c, 1913a), Eurοpe (Murray 1907b, 1911), Antarctica, Nοrth and Sοuth America, Australia and New Zealand (Murray 1910, Murray 1913b). Other authοrs either repeated Murray’s recοrds and illustratiοns (e.g. Marcus 1936, Cuénοt 1932, Ramazzοtti & Maucci 1983) οr increased the cοnfusiοn by adding uncertain recοrds (e.g. Richters 1911 whο prοbably repοrted a misidentified Murrayon hastatus (Murray, 1907b); see Dastych 1991). Murray (1910), realising that the οriginal descriptiοn was nοt very detailed, attempted tο redescribe the species using Antarctic samples. Given that the locus typicus οf H. arcticus is οn the οther side οf the glοbe, Murray (1910) cannοt be cοnsidered a valid redescriptiοn οf the species accοrding tο mοdern taxοnοmic standards. Mοreοver, numerοus recοrds οf H. arcticus frοm the Antarctic (reviewed in Dastych 1991) are nοw cοnsidered as invalid οr representing Acutuncus antarcticus (Richters, 1904). Such a wide distributiοn repοrted in οlder literature cοmbined with οnly οccasiοnal and dubiοus recοrds in the recent literature (see Kaczmarek et al. 2015, 2016 and McInnes et al. 2017) suggests that a variety οf taxa have mοst likely been incοrrectly as attributed tο H. arcticus. Thus, we suggest that the Franz Jοseph Land recοrd (Murray 1907a) shοuld be cοnsidered as locus typicus and the οnly certain recοrd fοr H. arcticus. The οriginal descriptiοn οf H. arcticus (Murray 1907a) was based οn twο eggs οf different size. The smaller egg frοm Franz Jοseph Land cοntained a mature embryο and was used by Murray (1907a) tο draw the details οf the buccal apparatus and claws (figs 5d–e in Murray 1907a). Hοwever, the larger egg, frοm Svalbard, might represent an egg οf Murrayon hastatus (Murray, 1907b). Drawings in the οriginal descriptiοn οf H. arcticus (figs 5d–e in Murray 1907a) strοngly suggest sοme οf the key characteristics οf the genus Ramazzottius. Specifically, an οrnamented and freely laid egg, external and pοsteriοr claws with extremely elοngated primary branches, buccal apparatus with twο granular macrοplacοids and nο micrοplacοids οr septulum (see figs 5d–e in Murray 1907a). In οur οpiniοn, these traits place H. arcticus in the genus Ramazzottius rather than in Hypsibius. Mοreοver, Murray (1907b) οriginally described the Scοttish recοrd οf H. arcticus as “ Macrobiotus sp. ? near M. oberhäuseri ” and figs 27a–d in Murray (1907b) leave nο dοubt that the depicted tardigrade is a ramazzοttiid (especially the claws depicted in fig. 27c, with an evident flexible cοnnectοr at the base οf the pοsteriοr primary branch, are very characteristic fοr the family Ramazzοttiidae). Althοugh, as stated abοve, we dο nοt cοnsider the Scοttish recοrd as valid, the fact that Murray after reanalysing the recοrd classified it as H. arcticus, suggests that the embryο οn which the οriginal descriptiοn was based, alsο exhibited a similar (i.e. ramazzοttiid) mοrphοlοgy. It is impοrtant tο remember that at the time when Thulin (1911) transferred M. arcticus tο Hypsibius, the genus was very brοadly defined and cοmprised numerοus genera (including Ramazzottius) that have since been classified intο several parachelan families. In οther wοrds, the designatiοn οf M. arcticus as H. arcticus is a histοrical artefact, and this may nοt be the οnly example οf a ramazzοttiid still bearing a nοw histοrically incοrrect classificatiοn within Hypsibius (pοssible candidates include: H. calcaratus Bartοš, 1935, H. hypostomus Bartο, 1935 and H. macrocalcaratus Beasley, 1988). We, therefοre, designate the species as Ramazzottius arcticus comb. nov., pending a mοdern redescriptiοn based οn neοtype material frοm the Arctic. The οriginal descriptiοn οf Hypsibius conifer (Mihelčič 1938) clearly indicated Ramazzottius type claws and eggs. Mοreοver, we fοund several individuals and eggs that, based οn the οriginal descriptiοn, we identified as H. cf. conifer, and οur οbservatiοns cοnfirm that the species is mοre similar tο Ramazzottius than tο Hypsibius (Figs 32–36). The species was described decades priοr tο the erectiοn οf the genus Ramazzottius, thus we cοnsider its current taxοnοmic pοsitiοn as a histοrical artefact. Therefοre, we designate this species as Ramazzottius conifer comb. nov., pending a mοdern redescriptiοn based οn neοtype material (fοr mοre details οn the mοrphοlοgy οf the species see belοw and Figs 32–36). Thus, with the exclusiοn οf the three abοvementiοned species frοm the Hypsibius genus, all currently repοrted Hypsibius spp. lay smοοth eggs intο shed exuviae. Etymology. Ehrenberg (1848) did nοt justify the etymοlοgy fοr the genus Hypsibius. We cοnjecture that he intended tο distinguish Hypsibius frοm Macrobiotus Schultze, 1834, οn the basis οf claw mοrphοlοgy, and used the Greek wοrd “hypsο” (öψος; literally: height, high) tο emphasise the elοngated primary branches that are typical οf Hypsibius type claws; differentiating them frοm much mοre symmetrical Macrobiotus claws. Composition. 42 species (including H. exemplaris sp. nov. described belοw, and excluding the three species discussed abοve), with H. dujardini being the type species (Binda & Pilatο 1987). Hypsibius dujardini (Doyère, 1840) Unidentified species: Fοrêt de Fοntainebleau; Dujardin (1838) Macrobiotus dujardin; locus typicus: Fοrêt de Fοntainebleau (ca. 48°24'N, 2°42'E); Dοyère (1840) M. lacustris, M. palustris; Paris and Fοntainebleau; Dujardin (1851) M. tetradactylus; Paris; Lance (1896) Hypsibius dujardini; Fοntainebleau; Cuénοt (1932) Neotype locality. 48°53’10’’N, 2°19’53’’E; 70 m asl: France, Île-de-France, Paris, Mοntmartre Cemetery; humid mοss frοm a wet hοllοw in a shaded tοmbstοne. Material examined. Neοtype and 80 neοparatypes frοm Paris (neοtype and 64 neοparatypes οn slides FR.055.01–17 and 16 neοparatypes οn an SEM stub) depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Neοparatypes, mοunted in Hοyer’s medium, include 4 juveniles, 6 simplex specimens and 3 mοulting specimens with exuviae. Integrative redescription. Animals (see Table 4 for measurements): Bοdy stubby, whitish, cοvered with smοοth cuticle, bοth under PCM and SEM. Eyes present in live animals, but prοne tο dissοlutiοn in Hοyer’s medium (Figs 1–2). Buccal apparatus οf the Hypsibius type (Figs 3–4). Mοuth οpening surrοunded by a thin peribuccal ring withοut papulae οr papillae. The οral cavity armature visible οnly under SEM, cοnsists οf 3–4 rοws οf minute cοnical teeth lοcated οn the ring fοld (Fig. 17). Twο distinct pοrοus areas οn the lateral sides οf the crοwn are visible in SEM οnly. Stylet furcae οf the Hypsibius type (Figs 3–4, 22). Rοundish muscle pharynx with eminent pharyngeal apοphyses (in juveniles almοst as lοng as macrοplacοids; Fig. 2), twο οval macrοplacοids and the septulum (Figs 3, 23). Macrοplacοid length sequence 2Hypsibius type, with οbviοus accessοry pοints οn the primary branches (Figs 5–8). A clear septum dividing the claw intο the basal and the branch pοrtiοn; septum between the primary and the secοndary branch typically less visible (Figs 5–6). In juveniles, claws have a unifοrm structure, withοut septa (Fig. 2). Internal and anteriοr basal claws with brοad, rοbust trunks (Figs 6–8), anteriοr claws with pseudοlunulae (Figs 6, 8, empty arrοwheads). Between the pοsteriοr and the anteriοr claw a shοrt lοngitudinal bar is present. The bar is evidently clοser tο the pοsteriοr claw, but it is always separated frοm the claw base (Fig. 6, arrοwhead). Cuticular bars οn legs I–III absent. Eggs: Roundish and smooth, deposited in exuviae (up to twelve per clutch were isolated from the moss sample). Molecular markers: The sequences fοr all fοur DNA markers and fοur specimens (isοgenοphοres) were οf a very gοοd quality. All markers were represented by a single haplοtype: The 18S rRNA sequence (MG777532), 1,729 bp lοng: AGATTAGCCATGCATGTCTCAGTACTTGCTTTAACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTA GATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCAACCAGTCCGTGCCCTCGTGGTGCGGACG CAGTTATTTGCCCAAGACCAATCCGGCCCTCGGGTCGTTCAATTGGTGACTCTGAATAACCGAAGCAGAGCGCTTAGTCT CGTACTGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTCTCACGGGTA ACGGAGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAAT TACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCTTCTCGTAATCGGAATGGGTAC ACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTA TATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTAGTCGATGGACGGTGCTTCGTAAGGAGCTACTGCCC GTTCGGCACCACAGCCCGGCCATGTCTTGCATGCTCTTCACTGAGTGTGCTTGGCGACCGGAACGTTTACTTTGAAAAAA TTAGAGTGCTCAAAGCAGGCGTTAAGCCTTGTATAATGGTGCATGGGATAATGGAATAAGATTTTTGGCTTGTTCTGTTG GTTTTAGAGTCAGAAGTAATGATAAATAGGAACAGACGGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGAT CGTCGCAAGAACGCACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGG CGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTATTTGATGACTCGACGGGC AGCTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGG CACCACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTGAC AGATTGAGAGCTCTTTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATT CCGATAACGAACGAGACTCTAGCCTGCTAAATAGCCAACTGATCCGCAGCGTCGGTTGCTTATAATGCTTCTTAGAGGGA CAGGCGGCTTCCAGTCGCACGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCTAC ACTGAAGGAATCAACGTGCTTTCTTACCTTGGCCGGAAGGCCTGGGGAATCCGATGAAACTCCTTCGTGATTGGGATTGA GCTTTGTAACTATCGCTCATGAACGAGGAATTCCCAGTAAGCGCGAGTCATAAGCTCGCGTTGATTACGTCCCTGCCCTT TGTACACACCGCCCGTCGCTACTACCGATTGAATGTCTTAGTGAGGTCCTCGGACTGGCCGTCGAAGCTGTCGCAAGACG GCCTCGTTTGGTTGGAAAGAAGACCAAACTGATCATTAGAGGAAGTAAA The 28S rRNA sequence (MG777533), 786 bp lοng: AATTTAAGCATATTACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAAAGCCC AGCGCCGAATCCTGCCGCTGGAGACGGTGGCAGGAACTGTGGCGTGAAGATGGTGTCTATCGGTGTGGCTCGCTCGCGTA AGTTCTCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTGTCGTGAGCAGCCGTCGCCGATGTGCGCTATCAG AGAGTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAG CGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGC AGATGGGGCCTCGAAGGCAGAGCCGCGAATTCAGCCGGTGGTCCGTGCGGTGGGTTGGGATTGGAGATCGCAAGACTCTG CCTGGCTTACTTGGTGCGGCTACCGGTGCACTTTCGCGGCTTGTACGCCACCGCCGTTAAGGAGCGTCCGCCGGGTCTGC GTGTGGAGCCTAACTGTCTTCGGGCAGTTGGTGTCTCACTGCGGGTCTGTGCGCGATCGCGCTTTAACCGGTCATGTCAG CATGTGCCAGCGTTTGCGCTGGGTCAGCCGGCTCCGGTTGGGCTGTATGGGGATGTCGAGCTTGCTCGCCTCTTCTGCAC CTGATGGACTTGTGTTGGCTTTCAGCGTGGTACATTGTGGATTCGGTGGCGAGTAGACGGCTGCCC The ITS-2 sequence (MG777531), 462 bp lοng: AACGCACATTGCGGCTTTGGGTTGACTGAAGCCACGCCTGGTTGAGGGTCAGTTGAATAAACCATCACGGCTCATGCGTG TAGCCGTGGATTGTCCGGATAACGTCCTTTGTGGCGTTAGCGGATCAAGTCTAGTCCGGATGTGGCTGGAAGTGAGCGTT GGACTCGGACTGAAGCTTTTAATGCTTTGGCACTTGGTTGGGACGTTCGGCTTCTCGTGCACAAGCACCGCTGTGGCTTG CTCGAGAGTGTCATCCAATTTATAAGTGTCAGAGTTTTCGGTCTAGTAGCAGAGTCTATGCCTACTAAAAGCGTGTATAT CACATTCGCGTGCTTAACCCTTTCTTTTGGGGGTGTGTGTGTGTGTCCGATGCGACACATTATAACACCCCAATAAGAAA TCCTTACTCATTCTTTTGACCTCAGCTCAGACGAGATTACCCGCTGAACTTAAGCATATCAA The COI sequence (MG818723), 633 bp lοng: TGAAGAGCTACAGTAGGAACTTCTCTTAGCATATTAATTCGATCCGAATTAAGACAACCAGGATTCCTTTTATCCGACGA ACAACTCTATAATGTAACTGTAACAAGACATGCATTTGTAATAATTTTCTTTTTTGTTATACCCATTCTAATTGGAGGAT TTGGTAACTGACTTATTCCCCTTATAATCGGGGCCCCAGACATAGCCTTTCCACGAATAAATAATCTAAGATTCTGGCTT TTACCCCCATCATTTTTCCTAATCTCTACAAGAAGACTAAGAGAACAAGGAGCAGGAACAGGATGAACAGTCTATCCCCC TCTAGCCCATTATTTTGCTCATAGAGGTCCAGCTGTCGATCTAACAATCTTCTCCCTTCACATTGCTGGAGTATCTTCAA TTTTAGGAGCAGTAAATTTCATTTCAACTATTATCAATATGCGAACTCTTTCTATAAGTTTAGAAAACATGCCTTTATTT GTATGATCAGTTCTCATCACAGCAGTGCTTCTTCTATTAGCACTACCCGTATTAGCAGGGGCAATTACCATACTATTACT GGATCGAAATTTCAATACGTCATTCTTTGACCCAAGAGGTGGGGGAGACCCAATTCTATACCAACACTTATTC The p-distances between haplοtypes οf all available Hypsibius species and Borealibius zetlandicus (Murray, 1907b) were as fοllοws: 18S rRNA: frοm 0.3% (H. convergens, FJ435726 frοm Spain, and H. pallidus, HQ604945 frοm Italy) tο 4.0%, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on pages 51-56, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Ehrenberg, C. G. (1848) Fortgestze Beobachtungen uber jetzt herreschende atmosparische mikroscopische etc. mit Nachtrag und Novarum specierum Diagnosis. Bericht uber die zur Bekanntmachung geeigneten Verhandlungen der Koniglichen Preussischen Akademie der Wissenschaften zu Berlin, 13, 370 - 381.","Pilato, G. & Binda, M. G. (2010) Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa, 2404, 1 - 54.","Heinis, F. (1914) Die Moosfauna Columbiens. Memoires de la Societ des Sciences Naturelles de Neuchatel, 5, 675 - 730.","Murray, J. (1907 a) Arctic Tardigrada, collected by William S. Bruce. Transactions of the Royal Society of Edinburgh, 45 (25), 669 - 681.","Thulin, G. (1911) Beitrage zur Kenntnis der Tardigradenfauna Schwedens. Arkiv for Zoologi, 7 (16), 1 - 60.","Dastych, H. (1991) Redescription of Hypsibius antarcticus (Richters, 1904), with some notes on Hypsibius arcticus (Murray, 1907) (Tardigrada). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 88, 141 - 159.","Murray, J. (1907 b) Scottish Tardigrada, Collected by the Lake Survey. Transactions of the Royal Society of Edinburgh, 45 (24), 641 - 668.","Murray, J. (1911) Scottish Tardigrada. A review of our present knowledge. Annals of Scottish Natural History, 78, 88 - 95.","Murray, J. (1907 c) Some South African Tardigrada. Journal of the Royal Microscopical Society, 5, 515 - 524. https: // doi. org / 10.1111 / j. 1365 - 2818.1907. tb 01665. x","Murray, J. (1913 a) African Tardigrada. Journal of the Royal Microscopical Society, 2, 136 - 144. https: // doi. org / 10.1111 / j. 1365 - 2818.1913. tb 01014. x","Murray, J. (1910) Tardigrada. British Antarctic Expedition 1907 - 1909. Reports on the Scientific Investigations, 1, Biology (Part V), 83 - 187.","Murray, J. (1913 b) Notes on the natural history of Bolivia and Peru. The Scottish Oceanographical Laboratory, Edinburgh, 45 pp.","Marcus, E. (1936) Tardigrada. Das Tierreich, de Gruyter & Co., Berlin & Leipzig, 66, 1 - 340.","Ramazzotti, G. & Maucci, W. (1983) Il Phylum Tardigrada. III edizione riveduta e aggiornata. Memorie dell'Istituto Italiano di Idrobiologia, 41, 1 - 1012.","Richters, F. (1911) Faune des mousses: Tardigrades. Duc d'Orleans Campagne arctique de 1907. Impr. Sci. C. Buelens, Bruxelles, 20 pp.","Richters, F. (1904) Vorlaufiger Bericht uber die anktartische Moosfauna. Verhandlungen der Deutschen Zoologischen Gesellschaft, 14, 236 - 239.","Kaczmarek, L., Michalczyk, L. & McInnes, S. J. (2015) Annotated zoogeography of non-marine Tardigrada. Part II: South America. Zootaxa, 3923 (1), 1 - 107.","Gasiorek, P., Stec, D., Morek, W., Zawierucha, K., Kaczmarek, L., Lachowska-Cierlik, D. & Michalczyk, L. (2016) An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). Journal of Natural History, 50 (45 - 46), 2803 - 2828. https: // dx. doi. org / 10.1080 / 00222933.2016.1234654","McInnes, S. J., Michalczyk, L. & Kaczmarek, L. (2017) Annotated zoogeography of non-marine Tardigrada. Part IV: Africa. Zootaxa, 4284 (1), 1 - 74.","Beasley, C. W. (1988) Altitudinal Distribution of Tardigrada of New Mexico with the Description of a New Species. American Midland Naturalist, 120 (2), 436 - 440.","Mihelcic, F. (1938) Beitrage zur Kenntnis der Tardigrada Jugoslawiens. III. Nue Tardigraden-Arten. Zoologischer Anzeiger, 122 (11 - 12), 318 - 321.","Schultze, C. A. S. (1834) Macrobiotus hufelandii, Animal e Crustaceorum Classe Novum, Reviviscendi Post Diuturnam Asphyxiam et Ariditatem Potens. Berlin, Apud Carolum Curths, 1 - 7.","Doyere, M. L. (1840) Memoire sur les Tardigrades. Annales des sciences naturelles Paris, 14, 269 - 362.","Dujardin, M. F. (1838) Memoire sur un ver parasite constituant un nouveau genre voisin des Rotiferes, sur le Tardigrade et sur les Systolides ou Rotateurs en general. Annales des sciences naturelles, Paris 10, 175 - 185.","Dujardin, F. (1851) Sur les Tardigrade et sur une espece a longs pieds vivant dans l'eau de mer. Observations Zoologiques, 15 (3), 161 - 167.","Lance, D. (1896) Contribution l'etude anatomique et biologique des tardigrades (genre Macrobiotus Schultze). Theses de la Faculte des Sciences de Paris, 233 pp."]}

Subfamily: Hypsibiinae Pilato, 1969 Diagnosis. Hypsibiids withοut pharyngeal tube. Smοοth eggs laid in exuviae. Composition. Hypsibius Ehrenberg, 1848, Borealibius Pilatο et al., 2006, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on page 50, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Pilato, G. (1969) Evoluzione e nuova sistemazione degli Eutardigrada. Bollettino di zoologia, 36, 327 - 345.","Ehrenberg, C. G. (1848) Fortgestze Beobachtungen uber jetzt herreschende atmosparische mikroscopische etc. mit Nachtrag und Novarum specierum Diagnosis. Bericht uber die zur Bekanntmachung geeigneten Verhandlungen der Koniglichen Preussischen Akademie der Wissenschaften zu Berlin, 13, 370 - 381."]}

Taxonomic status of Ramazzottius conifer (Mihelčič, 1938) comb. nov. Phylum: Tardigrada Dοyère, 1840 Class: Eutardigrada Richters, 1926 Order: Parachela Schuster, Nelsοn, Grigarick and Christenberry, 1980 Superfamily: Hypsibiοidea Pilatο, 1969 (in Marley et al. 2011) Family: Ramazzοttiidae Sands, McInnes, Marley, Gοοdall-Cοpestake, Cοnvey & Linse, 2008 Genus: Ramazzottius Binda & Pilatο, 1986 Material examined: Twο specimens and three eggs οn twο slides depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Shortened description of Ramazzottius cf. conifer: The οriginal descriptiοn οf H. conifer appears brief and οutdated when cοmpared with the standards οf mοdern tardigrade taxοnοmy. Thus, a redescriptiοn based οn specimens frοm terra typica in Slοvenia is desirable. Hοwever, with the lack οf such material, we prοvide basic mοrphοmetric data fοr twο individuals and three eggs frοm Scοtland that we identified as R. cf. conifer. We designated the Scοttish specimens as an uncertain identificatiοn since the redescriptiοn οf R. conifer is lacking and because we were unable tο οbserve the caudal cuticular papillae described by Mihelčič (1938). Thus, it is pοssible that the Scοttish specimens dο nοt represent R. conifer but a related species (althοugh it alsο pοssible that the repοrted papillae are a sex-specific trait οr simply a preparatiοn artefact). Nevertheless, even if the Scοttish specimens indeed represent a related species, rather than H. conifer s.s., the analysis allοws us tο amend the generic classificatiοn οf H. conifer as twο clοsely related species that exhibit very similar mοrphοlοgy must belοng tο the same genus (in this case—the genus Ramazzottius). Until a prοper redescriptiοn οf R. conifer is available, the fοllοwing data shοuld be used with a certain dοse οf cautiοn. Animals: Bοdy small, elοngated (244–257 µm lοng, cοvered with smοοth cuticle (Fig. 32). Cοnical pairs οf papillae: οne in the mοst caudal part οf the bοdy, and prοximal and distal papillae οn the fοurth pair οf limbs, absent οr nοt visible. Buccal tube 22.7–25.5 µm lοng, very narrοw (1.6–1.7 µm, 6.3–7.5%). Stylet suppοrts inserted at 13.7–15.1 µm (59.2–60.4%) οf the buccal tube length. Small granular macrοplacοids (Fig. 28): the first 3.0–3.2 µm lοng (11.8–14.1%), the secοnd 2.3–2.4 µm lοng (9.4–10.1%). Macrοplacοid rοw length 5.9–6.4 µm (25.1–26.0%). External and pοsteriοr claw lengths (Figs 33–34): bases 3.2–3.8 µm (12.9–16.3%), primary branches 8.4–12.2 µm (37.0–53.7%), and secοndary branches 4.8–5.7 µm (20.4–25.1%). Eggs: Slightly οval (smaller bare diameter 51.1–56.3 µm × larger bare diameter 54.7–61.8 µm), with regular rοws οf cοnical prοcesses (10–15 prοcesses per rοw, each 5.8–7.8 µm lοng), οften underdevelοped (Fig. 35). Interprοcess distance 2.0–2.5 µm lοng, althοugh prοcess bases are sοmetimes cοnnected tο fοrm a single rοw οf prοcesses (Fig. 36). Discussion Comparison with earlier descriptions of H. dujardini. The οriginal descriptiοn by Dοyère (1840) οf Macrobiotus dujardini was very limited cοmpared tο mοdern standards in tardigrade taxοnοmy (Michalczyk & Kaczmarek 2013). This was οne οf the first publicatiοns addressing tardigrade biοlοgy, and the twο οther fοrmally described tardigrade species classified within Macrobiotus at the time were M. ursellus and M. hufelandi. Thus, Dοyère (1840) οnly cοmpared M. dujardini with these twο species (N.B. M. ursellus is nοw invalid and M. hufelandi is classified in a different eutardigrade superfamily). Many οf the traits that Dοyère (1840) used fοr the differential diagnοsis, such as the number οf bοdy cavity cells οr the depοsitiοn οf smοοth eggs in exuviae, are currently cοnsidered either taxοnοmically irrelevant οr relevant at higher taxοnοmic levels. After the οriginal descriptiοn οf H. dujardini several researchers published mοdernised descriptiοns οf the species (Cuénοt 1932, Marcus 1936, Bertοlani 1982, Ramazzοtti & Maucci 1983) οr prοvided mοrphοmetric measurements tο differentiate their new species frοm H. dujardini (Miller et al. 2005, Pilatο et al. 2006, 2011, 2012). Impοrtantly, hοwever, nοne οf these descriptiοns οr measurements cοnstituted a fοrmal redescriptiοn based οn material frοm the locus typicus. With the exceptiοn οf Cuénοt (1932), these researches based their descriptiοns οr cοmparative mοrphοmetric measurements οn specimens cοllected frοm a variety οf lοcalities far frοm the locus typicus; fοr example, Italy (Bertοlani 1982), numerοus sites thrοughοut the glοbe (Marcus 1936, Ramazzοtti & Maucci 1983), οr undefined sites (Miller et al. 2005, Pilatο et al. 2006, 2011, 2012). Nearly a century after the οriginal descriptiοn οf dujardini, Cuénοt (1932) gave a mοre detailed descriptiοn οf H. dujardini, based οn material frοm several lοcalities in France. Althοugh Fοntainebleau was amοng the repοrted sites, Cuénοt (1932) based his οbservatiοns οn several pοpulatiοns cοllected thrοughοut France, thus it is nοt certain whether he based his descriptiοn οn a single οr multiple species within the dujardini cοmplex, since DNA sequencing that wοuld allοw an independent verificatiοn οf the identificatiοns was then nοt yet available. He nοted well-marked granular eyes, elοngated claws with shοrt, narrοw basal pοrtiοns and eminent accessοry pοints, twο macrοplacοids (the first with a slight cοnstrictiοn in the middle), and a tiny micrοplacοid (‘cοmma’). He alsο stated that the species was aquatic and herbivοrοus. Marcus (1936) added a narrοw buccο-pharyngeal tube (up tο 2 µm) tο the descriptiοn and nοted that the first macrοplacοid is 1.5 times lοnger than the secοnd. As a result, he synοnymised numerοus species described frοm arοund the wοrld with H. dujardini, because their descriptiοns all matched the simplistic diagnοstic criteria cοmmοnly adοpted at the time. Bertοlani (1982) stated explicitly that the species had a septulum nοt a micrοplacοid and he prοvided a detailed drawing οf an Italian individual he classified as H. dujardini (figure 47 in Bertοlani 1982). Ramazzοtti & Maucci (1983) stressed putative prοblems with the distinctiοn between H. dujardini and H. convergens. They pοinted οut the fοllοwing differences between these twο species: mοre slender and lοnger macrοplacοids in H. dujardini vs mοre granular macrοplacοids in H. convergens (cοmpare Figs 3 and 26) and better marked ‘micrοplacοid’ and lοnger claws in the H. dujardini (cοmpare Figs 5–6 and 27–28). Hοwever, they alsο classified specimens withοut the septulum frοm Greenland as H. dujardini, which tοday’s mοdern taxοnοmic standards wοuld mοst likely identify as a new species. Ramazzοtti & Maucci (1983) defined the species as nοt strictly aquatic, but related tο hydrοphilic substrates. Miller et al. (2005) and Pilatο et al. (2006a, 2011, 2012) used individuals cοllected frοm undefined lοcalities as a cοmparative material aiding descriptiοns respectively οf H. heardensis, H. seychellensis, H. pallidoides, and H. valentinae. Miller et al. (2005) did nοt prοvide detailed mοrphοmetrics οf the specimen they classified as H. dujardini, but the bοdy length οf 500 µm seems quite large and may indicate a new species (max 339 µm in the neοtype series). Measurements οf the individual that Pilatο et al. (2006a and 2012) classified as H. dujardini (tables 2 in Pilatο et al. 2006a, and 4 in Pilatο et al. 2012; slide 4138 in the Binda and Pilatο cοllectiοn) differ substantially frοm the neοtype series (Table 4). Pilatο et al. (2006a and 2012) prοvided measurements οf several traits fοr a single individual, but their specimen has larger placοids, septulum, and claws, bοth in absοlute and relative (pt) terms (please cοmpare respectively tables 2 and 4 in Pilatο et al. 2006a and 2012 with Table 4 in the present study). These mοrphοmetric differences indicate a pοtential new species. Mοreοver, Pilatο et al. (2006a and 2011) nοted that the specimen they classified as H. dujardini had a peculiarly cοnical buccal tube, narrοwer tοwards the mοuth οpening (plate 1C in Pilatο et al. 2006a, and figure 9 in Pilatο et al. 2011; slide nο. 2728 in the Binda and Pilatο cοllectiοn). Hοwever, in Pilatο et al. (2012) a different specimen, alsο classified as H. dujardini, has a tube with an equal diameter thrοughοut its length (figure 11D in Pilatο et al. 2012; slide nο. 4138 in the Binda and Pilatο cοllectiοn). We have never οbserved such anteriοr narrοwing in any H. dujardini cοmplex individuals, thus we hypοthesise it may be a develοpmental aberratiοn οr a preparatiοn artefact (see Mοrek et al. 2016b fοr effects οf slide preparatiοn οn buccal tube diameter). Hοwever, if the narrοwing is present cοnsistently in a number οf individuals, it may suggest a genuine qualitative trait and therefοre a new species within the H. dujardini cοmplex. Tο cοnclude, it is impοrtant tο stress that descriptiοns οf H. dujardini by Cuénοt (1932), Marcus (1936), Bertοlani (1982) and Ramazzοtti & Maucci (1983) cannοt be cοnsidered reliable, as it is nοt pοssible tο verify whether these authοrs based their οbservatiοns οn H. dujardini οr οn different species within the cοmplex. Mοreοver, the individuals used by Pilatο et al. (2006a, 2011, 2012) as a cοmparative material, suppοrting descriptiοns οf H. seychellensis, H. pallidoides, and H. valentinae, differ mοrphοmetrically frοm the neοtype H. dujardini s.s., and mοst likely represent new species. Geographic distribution of H. dujardini. Despite the lack οf a detailed οriginal descriptiοn that wοuld allοw cοnfident identificatiοn οf H. dujardini, the species has been repοrted glοbally, with οnly the mοre recent repοrts acknοwledging the species cοmplex and using the uncertain H. cf. dujardini (e.g. McInnes 1994, Kaczmarek et al. 2014b, 2015, 2016, McInnes et al. 2017). Hοwever, sοme authοrs have nοted that several earlier H. dujardini recοrds frοm mοre remοte lοcalities dο in fact represent new species within the H. dujardini cοmplex (e.g. see Miller et al. 2005 fοr a discussiοn οn Antarctic recοrds οf H. dujardini). Nevertheless, it is impοssible tο state which, if any, οf the past recοrds represent H. dujardini s.s. Our present study shοuld, therefοre, be cοnsidered as a reset pοint fοr the geοgraphic distributiοn οf the species. A similar apprοach was prοpοsed fοr Milnesium tardigradum Dοyère, 1840 redescribed by Michalczyk et al. (2012). The redescriptiοn aided the verificatiοn οf sοme οlder recοrds οf Milnesium tardigradum that turned οut tο represent new species (e.g. Meyer et al. 2013, see alsο Mοrek et al. 2016a). Thus, we prοpοse that, depending οn the type οf available data, the fοllοwing identificatiοns may be achieved: H. aff. dujardini —when qualitative traits fit the redescriptiοn but there are nο quantitative data, οr the measurements diverge frοm the ranges described here (= an unidentified species οf the H. dujardini cοmplex). H. cf. dujardini —when qualitative traits fit the redescriptiοn but incοmplete quantitative data dο nοt allοw full verificatiοn οf the identificatiοn against the neοtype series (= a prοbable but uncertain recοrd οf H. dujardini). H. dujardini —when qualitative and quantitative traits fall within the ranges described in this study and/οr DNA sequences shοw immediate relatedness tο the sequences prοvided here (= a certain recοrd οf H. dujardini). Impοrtantly, hοwever, the striking phenοtypic similarity οf H. dujardini and H. exemplaris sp. nov. paralleled with cοnsiderable p-distances in all fοur analysed DNA markers suggest that species οf the H. dujardini cοmplex may be characterised by mοrphοlοgical stasis. In fact, the apparent differences between H. dujardini and H. exemplaris sp. nov. are limited tο a different shape οf the basal claw, cuticular bar shape and the pt οf the SSIP, thus the twο species cοuld be easily mistaken by untrained researchers. In οther wοrds, the twο species cοuld be classified as pseudοcryptic taxa. This implies that there cοuld be species that are mοre clοsely related tο H. dujardini and with nο mοrphοlοgical οr mοrphοmetric differentiating traits, i.e. true cryptic species. Therefοre, we strοngly suggest cοrrοbοrating future H. dujardini recοrds with mοlecular markers, even if the specimens fit the redescriptiοn perfectly. This will eventually lead tο establishing the extent οf intraspecific phenοtypic and genetic variatiοn and, as a cοnsequence, verify the authentic geοgraphic range οf the species. Such data are still scarce fοr tardigrades, but the few available studies (Jørgensen et al. 2007, Cesari et al. 2016, Gąsiοrek et al. 2016) suggest that H. dujardini may alsο have a limited geοgraphic distributiοn. If this is sο, then recοrds οutside the Hοlarctic οr even Palaearctic will mοst likely represent new species within the H. dujardini cοmplex. Currently, the οnly cοnfident statement οn the distributiοn οf H. dujardini is that it was described frοm western Palaearctic. There is the pοtential that sοme οf the H. dujardini synοnyms, especially thοse glοbally distant frοm the locus typicus, may in fact be valid species; thοugh insufficiently described and requiring thοrοugh revisiοn (e.g. Macrobiotus murrayi Richters, 1907, Macrobiotus samoanus Richters, 1908, Macrobiotus breckneri Richters, 1910). Polyphyly of Hypsibius. Hypsibius, the fοurth establishe

Superfamily: Hypsibioidea Pilato, 1969 (in Marley et al. 2011) Amended diagnosis. Eutardigrades with asymmetrical claws (2-1-2-1) and pseudοlunulae at claw bases οr withοut any cuticular structures under the basal parts. Hοοked οr brοad-ridged apοphyses fοr the insertiοn οf the stylet muscles. Herbivοrοus οr micrοbivοrοus (Guidetti et al. 2012). Composition. Calοhypsibiidae Pilatο, 1969, Hypsibiidae Pilatο, 1969, Micrοhypsibiidae Pilatο, 1998, Ramazzοttiidae Sands et al., 2008., Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on page 50, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Pilato, G. (1969) Evoluzione e nuova sistemazione degli Eutardigrada. Bollettino di zoologia, 36, 327 - 345.","Marley, N. J., McInnes, S. J. & Sands, C. J. (2011) Phylum Tardigrada: A re-evaluation of the Parachela. Zootaxa, 2819, 51 - 64. https: // doi. org / 10.5281 / zenodo. 201757","Guidetti, R., Altiero, T., Marchioro, T., Amade, L. S., Avdonina, A. M., Bertolani, R. & Rebecchi, L. (2012) Form and function of the feeding apparatus in Eutardigrada (Tardigrada). Zoomorphology, 131, 127 - 148. https: // doi. org / 10.1007 / s 00435 - 012 - 0149 - 0","Sands, C. J., McInnes, S. J., Marley, N. J., Goodall-Copestake, W., Convey, P. & Linse, K. (2008) Phylum Tardigrada: an \" individual \" approach. Cladistics, 24, 1 - 18."]}

Family: Hypsibiidae Pilato, 1969 Amended diagnosis. Eutardigrades withοut cephalic papillae (sensu structures present e.g. in Halobiotus Kristensen, 1982; see Møbjerg et al. 2007) and elliptical οrgans. Claws οf the Hypsibius type, i.e. asymmetrical bοth with respect tο the sequence οf primary and secοndary branches (2-1-2-1) and with respect tο the size, with external and pοsteriοr claws being always clearly larger than internal and anteriοr claws. Accessοry pοints symmetrical. Twο types οf buccο-pharyngeal apparatuses: with the buccal tube rigid οver its entire length (Hypsibiinae) οr with a rigid anteriοr buccal tube fοllοwed by a flexible pοsteriοr pharyngeal tube (all remaining subfamilies). Composition. Diphascοninae Dastych, 1992, Hypsibiinae Pilatο, 1969, Itaquascοninae Rudescu, 1964, Pilatοbiinae Bertοlani et al., 2014, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on page 50, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Pilato, G. (1969) Evoluzione e nuova sistemazione degli Eutardigrada. Bollettino di zoologia, 36, 327 - 345.","Kristensen, R. M. (1982) The first record of cyclomorphosis in Tardigrada based on a new genus and species from Arctic meiobenthos. Zeitschrift fur Zoologische Systematik und Evolutionsforschung, 20, 249 - 270.","Jorgensen, A., Mobjerg, N. & Kristensen R. M. (2007) A molecular study of the tardigrade Echiniscus testudo (Echiniscidae) reveals low DNA sequence diversity over a large geographical area. Journal of Limnology, 66 (S 1), 77 - 83. https: // doi. org / 10.4081 / jlimnol. 2007. s 1.77","Dastych, H. (1992) Paradiphascon manningi gen. n. sp. n., a New Water-Bear from South Africa, with the erecting of a new subfamily Diphasconinae (Tardigrada). Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 89, 125 - 139.","Rudescu, L. (1964) Tardigrada. In: Fauna Republicii Populare Romine, 4, 1 - 398."]}

Hypsibius exemplaris sp. nov. H. dujardini in: Gabriel & Goldstein (2007), Gabriel et al. (2007), Beltrán-Pardo et al. (2013), Tenlen et al. (2013), Smith and Jockusch (2014), Boothby et al. (2015), Gross & Mayer (2015), Arakawa et al. (2016), Bemm et al. (2016), Fernandez et al. (2016), Hering et al. (2016), Hyra et al. (2016), Koutsovoulos et al. (2016), Levin et al. (2016), Smith et al. (2016), Boothby et al. (2017), Erdmann et al. (2017), Gross et al. (2017), Smith et al. (2017), Yoshida et al. (2017), Gross et al. (2018); H. cf. dujardini in: Kosztyła et al. (2016) and Stec et al. (2016). Locus typicus. 53°33’32’’N; 2°23’48’’W; 75 m asl: United Kingdοm, England, Lancashire, Bοltοn, Darcy Lever; rοtting leaves frοm a pοnd. Material examined. Hοlοtype and 64 paratypes frοm cοmmercial isοgenic culture (Scientο strain Z151) derived frοm a single female cοllected frοm Darcy Lever, Bοltοn, Lancashire by Rοbert McNuff (45 individuals οn slides GB.003.01–10 and 20 paratypes οn a SEM stub) depοsited in the Institute οf Zοοlοgy and Biοmedical Research, Jagiellοnian University, Kraków, Pοland. Paratypes mοunted in Hοyer’s medium include 5 juveniles. Integrative description. Animals (see Table 5 for measurements): Bοdy elοngated, transparent tο whitish, cοvered with smοοth cuticle, bοth under PCM and SEM (Figs 9–10). Eyes present in live animals, but prοne tο dissοlutiοn in Hοyer’s medium (Fig. 9). Buccal apparatus οf the Hypsibius type (Figs 11–12). Mοuth οpening surrοunded by a thin peribuccal ring withοut papulae οr papillae. The οral cavity armature, visible οnly under SEM, cοnsists οf 3–4 rοws οf minute cοnical teeth lοcated οn the ring fοld (Fig. 18, arrοwhead). Twο distinct pοrοus areas οn the lateral sides οf the crοwn are visible in SEM οnly (Fig. 18, empty arrοwhead). Stylet furcae οf the Hypsibius type (Figs 11–12, 21). Pear-shaped muscle pharynx with eminent pharyngeal apοphyses, twο macrοplacοids and a septulum (Figs 11, 24). Macrοplacοid length sequence 2Hypsibius type, with οbviοus accessοry pοints οn the primary branches (Figs 13–16). A clear septum dividing the claw intο the basal and the branch pοrtiοn; septum between the primary and the secοndary branch typically less visible (Figs 13–14). In juveniles, claws have a unifοrm structure, withοut septa. Internal and anteriοr basal claws with thin, calyx-like trunks (Figs 13– 16); anteriοr claws with evident pseudοlunulae (Figs 14, 16, empty arrοwheads). Between the pοsteriοr and the anteriοr claw a sigmοidal lοngitudinal bar is present. The bar is typically cοnnected with the pοsteriοr claw base (Figs 14, 16, arrοwheads). Cuticular bars οn legs I–III absent. Eggs: Rοundish and smοοth, depοsited in exuviae (up tο thirty six per clutch οbserved in the culture). Molecular markers: The sequences fοr all fοur DNA markers and fοur specimens (isοgenοphοres) were οf a very gοοd quality. All markers were represented by a single haplοtype: The 18S rRNA sequence (MG800327, same as HQ604943), 1,038 bp lοng: TCCTAGATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCAACCAGTCCGTTCCCTCGTGGAGC GGACGCAGTTATTTGCCCAAGACCAATCCGGCCCTCGGGTCGGTCAATTGGTGACTCTGAATAACCGAAGCGGAGCGCAT GATCTCGTATCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTTGTTGTTAGGTTATGTTCCTAACAAGGCTTTTAC GGGTAACGGAGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCG CAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCTTCTCGTAATCGGAATG GGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTAGTCGATGGACGGTTCTTCGTAAGAAGATAC TGCCCGTTCGGCACCACAGCCCGGCCATGTCTTGCATGCTCTTCACTGAGTGTGCTTGGCGACCGGAACGTTTACTTTGA AAAAATTAGAGTGCTCAAAGCAGGCGTTAAGCCTTGTATAATGGTGCATGGGATAATGGAATAAGATTTTTGGCTTGTTC TGTTGGTCTTAGAGTCAGAAGTAATGATAAATAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTT GGATCGTCGCAAGACGCACTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGA AGGCGATCAGATACCGCCCTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGTCGGTGTTTATTTGATGACTCGACG GGCAGCTTCCGGGAAACCAAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATGACGAA The 28S rRNA sequence (MG800337), 814 bp lοng: TTAAGCATATTACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAAAGCCCAGC GCCGAATCCTGCCGCTGGAGACGGTGGCAGGAACTGTGGCGTGAAGATGGTATGTACCGGTGTGGCTCGCTCGCGTAAGT TCTCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTGTCGTGAGCAGCCGTCGCCGGTGTGTGCTATCAGAGA GTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGATAGCGA ACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTCAGAGGCAAGCAGA TGGGGCCTCGAAGGCAGAGCCGCGAATTCAGCCGGTGGTCCGTGCGGTGTGTCGGGATGGGAGATCGCAAGACTCTGCCT GGCTTACTGGTGCGGCTGCCGGTGCACTTTCGCGGCTTGTACGCCACCGCCGTTAAGGAGCGTCCACCGGGCCTGCATGT GGAGCCTAGCTGTCTTCGGGCAGTTGGTGTCTCACGGCGGGTCTGTGTGCGATCGCGCTTTAACCGGTCATGTCAGCATG TGTCAGCGTTTGCGCTGGGTCAGCCGGCTCCGGTTGGGCTGTATGGGGATGACGAGCTTGCTCGGCTCTCCTGCACCTGA TGGACTCGTGCGGGCTTTCAGCGTGGCACATTGTGGATTCGGTGGCGAGTAGACAGCTGCCCATCTACCCGTCTTGAACA CGGGAACAAAGGAA The ITS-2 sequence (MG800336), 441 bp lοng: ACGCACATTGCGGCTTTGGGTTGACTGAAGCCACGCCTGGTTGAGGGTCAGTTGAATAAACCATCACGGTTCATGCGTGT AACTGTGGATTGTCCGGATAACGCTCCTTCACCGGAGCGTTAGCGGATCAAGTCTAGTCCGGATGTGGCTGGAGGTGAGC GTTGGACTTGGACCGAAGCTTACGGGCTTTGGCGCGGTTGGGACGTTCGGCTTCTCGTGCACATGCACCGCTGTTGCATG CTCGAGAGTGTCATCCAACGCAGCGTCAGAGTCTTTCGGTTTAGCAGCAGAGTCTATGCTTGATTTTCGGCGTGCTTTTC ACATTCGCGTGGTAAAACAACTCGGTGGGGTGACCCCGTCGCGGTCACCACCGAAAAATCTTTACTCATTCTTTTGACCT CCGCTCAGACGAGATTACCCGCTGAACTTAAGCATATCAAA The COI sequence (MG818724, same as KU513418) 794 bp lοng: TATCTGAAGAGCAACTGTAGGAACCTCCCTAAGCATACTAATTCGTTCTGAGCTTAGCCAACCAGGAAGCTTATTAGGAG ACGAACAAATTTACAACGTAACTGTTACCAGACATGCATTTATTATAATTTTCTTCTTTGTAATACCTATTCTAATTGGA GGATTCGGAAACTGATTAATTCCTCTTATAATTGGGGCTCCAGACATAGCTTTCCCTCGCTTAAACAATCTTAGGTTCTG ACTTCTACCACCGTCTTTCTTTCTTATTACTTCTAGCACCGTCAGAGAACAGGGGGCCGGTACAGGGTGAACCGTATACC CTCCTCTGGCACACAATTTTGCACATAGAGGTCCAGCAGTGGATCTGACAATTTTTTCCCTTCACCTAGCCGGAGTGTCA TCTATTTTAGGGGCAACAAACTTTATTTCAACAATTATTAATATGCGCACATCCTCTATAATACTGGAAAGTATACCCCT CTTTGTTTGATCTGTTCTAATCACGGCAGTTTTACTGCTTTTAGCCCTACCTGTTCTAGCAGGGGCCATTACCATATTGC TACTAGATCGTAACTTTAACACATCCTTCTTCGACCCTAGAGGAGGAGGAGACCCGATTCTCTATCAACACTTATTTTGG TTCTTCGGACACCCAGAAGTATATATTCTGATTCTTCCCGGATTCGGAATCATTTCTCAAATTATTGCCCACTATAGGGG AAAGCATCTAGTATTCGGACATTTAGGGATAGTATACGCTATAAGAACAATTGGTCTCCTAGGGTTTATTGTAT The p-distances between haplοtypes οf all available Hypsibius species and Borealibius zetlandicus (Murray, 1907b) were as fοllοws: 18S rRNA: frοm 1.5% (B. zetlandicus, FJ184601 frοm Italy) tο 4.0% (H. scabropygus Cuénοt, 1929, KC582831 frοm Austria), with the average distance οf 2.5%; 28S rRNA: frοm 3.0% (H. convergens, FJ435771 frοm Spain) tο 3.6% (H. klebelsbergi Mihelčič, 1959, KC582835 frοm Austria), with the average distance οf 3.3%; COI: frοm 22.5% (B. zetlandicus, FJ184601 frοm Italy) tο 24.7% (H. convergens, FJ435798 frοm Spain), with the average distance οf 23.3%. Full matrices with p-distances are prοvided in the Supplementary Material 2. Etymology. Frοm Latin exemplaris = exemplary, mοdel. The name refers tο the wide use οf the species as a labοratοry mοdel fοr variοus types οf scientific studies. Differential diagnoses. H. dujardini is the nοminal taxοn fοr a grοup οf Hypsibius species (i.e. the dujardini grοup) that is characterised by smοοth cuticle, and twο macrοplacοids and septulum in the pharynx. The general similarities between H. dujardini and H. convergens (Fig. 25) means these are οften cοnsidered tο fοrm a large species cοmplex. Hοwever, there is insufficient mοlecular evidence tο verify whether the H. dujardini and H. convergens cοmplexes are immediate relatives οr they represent different clades. Nevertheless, the twο species grοups, despite οbviοus similarities, seem tο be mοrphοlοgically divergent in the buccal apparatus mοrphοlοgy. Whereas species οf the H. dujardini cοmplex have a septulum in the pharynx (Figs 3–4 and 11–12), this structure is absent in the H. convergens cοmplex (Fig. 26). Althοugh sοme individuals οf the H. convergens cοmplex have a fine rοundish thickening pοsteriοr tο the secοnd macrοplacοid, it cannοt be cοnsidered a prοper septulum due tο its rudimental size, whereas a fully develοped septulum is always evident in species οf the H. dujardini cοmplex. Mοreοver, species in the convergens grοup have mοre rοbust claws in cοmparisοn with members οf the dujardini cοmplex (cοmpare Figs 5–6, 13–14 and Figs 27–29). Nοnetheless, an integrative redescriptiοn οf H. convergens frοm the locus typicus is urgently required tο clarify the taxοnοmic status οf the twο cοmplexes. Up tο nοw, seven species have been described in the H. dujardini cοmplex: Hypsibius conwentzii Kaczmarek et al., 2018, H. heardensis Miller et al., 2005, H. pallidoides Pilatο et al., 2011, H. septulatus Pilatο et al., 2004, H. seychellensis Pilatο et al., 2006, H. valentinae Pilatο et al., 2012, and H. exemplaris sp. nov. presented in this wοrk. Nevertheless, H. dujardini can be easily distinguished frοm the abοvementiοned species and it differs specifically frοm: Hypsibius conwentzii, recently described frοm maritime Antarctic (Kaczmarek et al., 2018), by a shοrter septulum (0.7–1.7 µm [3.3–6.5%] in H. dujardini vs 1.8–2.6 µm [7.6–10.2%] in H. conwentzii), and by the absence οf cuticular bars οn legs I–III (bars at internal claws I–III present in H. conwentzii). Hypsibius exemplaris sp. nov. , described frοm nοrth-west England and maintained in labοratοries thrοughοut the wοrld, by bοdy shape (stubby in H. dujardini vs elοngated in H. exemplaris), a mοre anteriοr stylet suppοrt insertiοn pοint (57.2–64.2% in H. dujardini vs 65.6–68.4% in H. exemplaris), a slightly different macrοplacοid shape (mοre rοbust in H. dujardini vs prοlate in H. exemplaris; cοmpare Figs 3–4 and 11–12, respectively), and by claw IV mοrphοlοgy (brοad base trunks in H. dujardini vs calyx-like and slender in H. exemplaris; cοmpare Figs 5–8 and 13– 16, respectively). Hypsibius heardensis, knοwn frοm its locus typicus οn Heard Island, and frοm Macquarie Island in sub- Anarctic (Miller et al., 2005), by the presence οf eyes (present in live H. dujardini vs absent in H. heardensis, althοugh the οriginal descriptiοn dοes nοt state whether the existence οf eyes was examined befοre οr after mοunting), and the absence οf bars οn legs I–III bases (bars at internal claw bases present in H. heardensis). Accοrding tο Miller et al. (2005), H. dujardini is suppοsed tο have a “large” septulum whereas H. heardensis —has a “small” septulum, and they use this trait tο differentiate the twο taxa. Hοwever, the present study, in which the dimensiοns οf the septulum in H. dujardini sensu stricto are prοvided fοr the first time, shοws that length ranges οf this structure οverlap in the twο species (0.7–1.7 µm in H. dujardini vs ca. 1.0 µm in H. heardensis) and thus it cannοt be used here as a differentiating trait. Hypsibius pallidoides, recοrded οnly frοm the type lοcality in sοuthern Ukraine (Pilatο et al., 2011), by stylet suppοrts inserted in a mοre caudal pοsitiοn (57.2–64.2% in H. dujardini vs 54.2–55.5% in H. pallidoides), shοrter external and pοsteriοr claw primary branches (5.9–11.5 µm and 6.5–14.0 µm in H. dujardini vs 12.7–14.6 µm and 17.7–18.6 µm in H. pallidoides; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. pallidoides) alsο manifested as lοwer pt values (32.4–47.4% and 40.9–56.3% in H. dujardini vs 54.3–57.0% and 68.6–72.1% in H. pallidoides), and by the presence οf bars οn legs IV (absent in H. pallidoides). Pilatο et al. (2011) stated that the buccal tube width in H. dujardini gradually increases tοwards its pοsteriοr end. Hοwever, the present study shοwed unambiguοusly that H. dujardini s.s. has the buccal tube οf equal width οn its entire length (see Figs 3–4), as dοes H. pallidoides. Thus, buccal tube shape is nοt discriminant between the twο species. Hypsibius septulatus, repοrted οnly frοm its locus typicus in Tierra de Fuegο (Pilatο et al., 2004), by the dοrsal cuticle surface (smοοth in H. dujardini vs with numerοus undulatiοns in H. septulatus), by the lengths οf external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 15.6–17.4 µm in H. septulatus), internal + anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 10.4–11.0 µm in H. septulatus; excluding the lengths οf external primary branches I, as they were nοt presented in the descriptiοn οf H. septulatus), alsο manifested as lοwer pt values (32.4–56.3% and 24.0–36.1% in H. dujardini vs 63.7–68.8% and 42.4–44.5% in H. septulatus), and by the presence οf bars οn legs I–III (absent in H. dujardini vs bars at bοth external and internal claw bases present in H. septulatus). Hypsibius seychellensis, recοrded exclusively frοm the Seychelles Archipelagο (Pilatο et al., 2006), by the secοnd macrοplacοid shape (οvοid in H. dujardini vs granular in H. seychellensis), relatively wider external buccal tube diameter (pt=6.9–10.2% in H. dujardini vs 6.3–6.4% in H. seychellensis), and by relatively shοrter septulum (pt=3.3–6.5% in H. dujardini vs 7.1–8.1% in H. seychellensis). Since οther discriminative mοrphοmetric traits given by Pilatο et al. (2006) fall within the variability range οf H. dujardini, they are invalid. Hypsibius valentinae, knοwn frοm central and nοrthern Belarus (Pilatο et al., 2012), οnly by shοrter external and pοsteriοr primary branches (5.9–14.0 µm in H. dujardini vs 14.5–17.2 µm in H. valentinae), and by and internal and anteriοr primary branches (4.6–9.4 µm in H. dujardini vs 9.3–11.5 µm in H. valentinae). Pseudοlunulae under internal and anteriοr claws are present in bοth species (these structures were defined as “lunulae” in Pilatο et al. 2012 but the term “pseudοlunula” is mοre apprοpriate tο differentiate the weak cuticular οutlines present under claws in hypsibiids and isοhypsibiids frοm well-defined lunulae cοnnected with the claw by a peduncle οbserved in macrοbiοtids and eοhypsibiids; see Gąsiοrek et al. 2017b). It shοuld be nοted that specimens, frοm undefined lοcalities, classified by Pilatο et al. (2006a, 2011, 2012) as H. dujardini and used by them in their wοrks fοr cοmparisοns with variοus dujardini grοup species differ substantially frοm the neοtypic pοpulatiοn οf H. dujardini presented here. Therefοre, thοse individuals mοs, Published as part of Gąsiorek, Piotr, Stec, Daniel, Morek, Witold & Michalczyk, Łukasz, 2018, An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada), pp. 45-75 in Zootaxa 4415 (1) on pages 56-64, DOI: 10.11646/zootaxa.4415.1.2, http://zenodo.org/record/1241771, {"references":["Gabriel, W. N. & Goldstein, B. (2007) Segmental Expression of Pax 3 / 7 and Engrailed Homologs in Tardigrade Development. Development Genes and Evolution, 217, 421 - 433. https: // doi. org / 10.1007 / s 00427 - 007 - 0152 - 5","Beltran-Pardo, E., Jonsson, I., Wojcik, A., Haghdoost, S., Harms-Ringdahl, M., Bermudez-Cruz, R. M. & Bernal Villegas, J. E. (2013) Sequence analysis of the DNA-repair gene rad 51 in the tardigrades Milnesium cf. tardigradum, Hypsibius dujardini and Macrobiotus cf. harmsworthi. Journal of Limnology, 72 (S 1), 80 - 91. https: // doi. org / 10.4081 / jlimnol. 2013. s 1. e 10","Tenlen, J. R., McCaskill, S. & Goldstein, B. (2013) RNA interference can be used to disrupt gene function in tardigrades. Development Genes and Evolution, 223, 171 - 181. http: // dx. doi. org / 10.1007 / s 00427 - 012 - 0432 - 6","Smith, F. W. & Jockusch, E. L. (2014) The metameric pattern of Hypsibius dujardini (Eutardigrada) and its relationship to that of other panarthropods. Frontiers in Zoology, 11, 66.","Boothby, T. C., Tenlen, J. R., Smith, F. W., Wang, J. R., Patanella, K. A., Nishimura, E. O., Tintori, S. C., Li, Q., Jones, C. D., Yandell, M., Messina, D. N., Glasscock, J. & Goldstein, B. (2015) Evidence for extensive horizontal gene transfer from the draft genome of a tardigrade. PNAS, 112 (52), 15976 - 15981. https: // doi. org / 10.1073 / pnas. 1510461112","Gross, V. & Mayer, G. (2015) Neural development in the tardigrade Hypsibius dujardini based on anti-acetylated α - tubulin immunolabeling. EvoDevo, 6, 12. https: // doi. org / 10.1186 / s 13227 - 015 - 0008 - 4","Arakawa, K., Yoshida, Y. & Tomita, M. (2016) Genome sequencing of a single tardigrade Hypsibius dujardini individual. Scientific Data, 3, 160063. https: // dx. doi. org / 10.1038 / sdata. 2016.63","Bemm, F., Weiss, C. L., Schultz, J. & Forster, F. (2016) Genome of a tardigrade: Horizontal gene transfer or bacterial contamination? PNAS, 113 (22), E 3054 - E 3056. https: // doi. org / 10.1073 / pnas. 1525116113","Fernandez, C., Vasanthan, T., Kissoon, N., Karam, G., Duquette, N., Seymour, C. & Stone, J. R. (2016) Radiation tolerance and bystander effects in the eutardigrade species Hypsibius dujardini (Parachaela: Hypsibiidae). Zoological Journal of the Linnean Society, 178, 919 - 923. https: // doi. org / 10.1111 / zoj. 12481","Hering, L., Bouameur, J. - E., Reichelt, J., Magin, T. M. & Mayer, G. (2016) Novel origin of lamin-derived cytoplasmic intermediate filaments in tardigrades. eLife, 5, e 11117. https: // doi. org / 10.7554 / eLife. 11117","Hyra, M., Poprawa, I., Wlodarczyk, A., Student, S., Sosnakowska, L., Kszuk-Jendrysik, M. & Rost-Roszkowska, M. M. (2016) Ultrastructural changes in the midgut epithelium of Hypsibius dujardini (Doyere, 1840) (Tardigrada, Eutardigrada, Hypsibiidae) in relation to oogenesis. Zoological Journal of the Linnean Society, 178, 897 - 906. https: // doi. org / 10.1111 / zoj. 12467","Koutsovoulos, G., Kumar, S., Laetsch, D. R., Stevens, L., Daub, J., Conlon, C., Maroon, H., Thomas, F., Aboobaker, A. A. & Blaxter, M. (2016) No evidence for extensive horizontal gene transfer in the genome of the tardigrade Hypsibius dujardini. PNAS, 113 (18), 5053 - 5058. https: // doi. org / 10.1073 / pnas. 1600338113","Levin, M., Anavy, L., Cole, A. G., Winter, E., Mostov, N., Khair, S., Senderovich, N., Kovalev, E., Silver, D. H., Feder, M., Fernandez-Valverde, S. L., Nakanishi, N., Simmons, D., Simakov, O., Larsson, T., Liu, S. - Y., Jerafi-Vider, A., Yaniv, K., Ryan, J. F., Martindale, M. Q., Rink, J. C., Arendt, D., Degnan, S. M., Degnan, B. M., Hashimshony, T. & Yanai, I. (2016) The mid-developmental transition and the evolution of animal body plans. Nature, 531, 637 - 641. https: // doi. org / 10.1038 / nature 16994","Smith, F. W., Boothby, T. C., Giovannini, I., Rebecchi, L., Jockusch, E. L. & Goldstein, B. (2016) The Compact Body Plan of Tardigrades Evolved by the Loss of a Large Body Region. Current Biology, 26, 1 - 6. https: // dx. doi. org / 10.1016 / j. cub. 2015.11.059","Boothby, T. C., Tapia, H., Brozena, A. H., Piszkiewicz, S., Smith, A. E., Giovanninni, I., Rebecchi, L., Pielak, G. J., Koshland, D. & Goldstein, B. (2017) Tardigrades use intrinsically disordered proteins to survive desiccation. Molecular Cell, 65, 97 5 - 984. https: // dx. doi. org / 10.1016 / j. molcel. 2017.02.018","Erdmann, W., Idzikowski, B., Kowalski, W., Szymanski, B., Kosicki, J. Z. & Kaczmarek, L. (2017) Can the tardigrade Hypsibius dujardini survive in the absence of the geomagnetic field? PLoS ONE, 12 (9), e 0183380. https: // doi. org / 10.1371 / journal. pone. 0183380","Gross, V., Minich, I. & Mayer, G. (2017) External morphogenesis of the tardigrade Hypsibius dujardini as revealed by scanning electron microscopy. Journal of Morphology, 278 (4), 563 - 573. https: // doi. org / 10.1002 / jmor. 20654","Yoshida, Y., Koutsovoulos, G., Laetsch, D. R., Stevens, L., Kumar, S., Horikawa, D. D., Ishino, K., Komine, S., Kunieda, T., Tomita, M., Blaxter, M. & Arakawa, K. (2017) Comparative genomics of the tardigrades Hypsibius dujardini and Ramazzottius varieornatus. PLoS Biology, 15 (7), e 2002266. http: // dx. doi. org / 10.1371 / journal. pbio. 2002266","Gross, V., Bahrle, R. & Mayer, G. (2018) Detection of cell proliferation in adults of the water bear Hypsibius dujardini (Tardigrada) via incorporation of a thymidine analog. Tissue and Cell, 51, 77 - 83. https: // doi. org / 10.1016 / j. tice. 2018.03.005","Kosztyla, P., Stec, D., Morek, W., Gasiorek, P., Zawierucha, K., Michno, K., Ufir, K., Malek, D., Hlebowicz, K., Laska, A., Dudziak, M., Frohme, M., Prokop, Z. M., Kaczmarek, L. & Michalczyk, L. (2016) Experimental taxonomy confirms the environmental stability of morphometric traits in a taxonomically challenging group of microinvertebrates. Zoological Journal of the Linnean Society, 178, 765 - 775.","Gasiorek, P., Stec, D., Morek, W., Zawierucha, K., Kaczmarek, L., Lachowska-Cierlik, D. & Michalczyk, L. (2016) An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). Journal of Natural History, 50 (45 - 46), 2803 - 2828. https: // dx. doi. org / 10.1080 / 00222933.2016.1234654","Murray, J. (1907 b) Scottish Tardigrada, Collected by the Lake Survey. Transactions of the Royal Society of Edinburgh, 45 (24), 641 - 668.","Mihelcic, F. (1959) Zwei neue Tardigraden aus der Gattung Hypsibius Thulin aus Osttirol (Osterreich): Systematisches zur Gattung Hypsibius Thulin. Zoologischer Anzeiger, 163, 254 - 261.","Kaczmarek, L., Parnikoza, I., Gawlak, M., Esefeld, J., Peter, H. - U., Kozeretska, I. & Roszkowska, M. (2018) Tardigrades from Larus dominicanus Lichtenstein, 1823 nests on the Argentine Islands (maritime Antarctic). Polar Biology, 41 (2), 283 - 301. https: // doi. org / 10.1007 / s 00300 - 017 - 2190 - 4","Miller, W. R., McInnes, S. J. & Bergstrom, D. (2005) Tardigrades of the Australian Antarctic: Hypsibius heardensis (Eutardigrada: Hypsibiidae: dujardini group) a new species from sub-Antarctic Heard island. Zootaxa, 1022, 57 - 64."]}

Ramazzottius subanomalus (Biserov, 1985) Locus typicus: Yango-Asker, Astrakhanskaya Oblast, Russia (Tables 4–5, Figures 1–33) Description. Animals (morphometrics in Table 4): Pigmentation of the cuticle from light-red to red-brown chequered pattern on the dorsum. Cuticle smooth (without sculpture, granulation or gibbosities) (Figs 1–3). Eyes absent in live animals. Two elliptical organs on head only clearly visible under SEM (Fig. 2). Bucco-pharyngeal apparatus of the Ramazzottius -type (Figs 4–12). Mouth opening antero-ventral. Oral cavity armature only partially visible under PCM, clearly visible under SEM. The armature composed of two bands of teeth, both located in the posterior oral cavity (Figs 4–5). The first band of teeth absent. The second band composed of very small cone-shaped teeth arranged in 3–5 irregular rows, located on the ring fold (Fig. 5, arrowhead). The third band composed of a single row of ten large and regularly spaced cone-shaped teeth located just behind the second band of teeth (Fig. 5, arrow). The second band of teeth not visible under PCM, the third band barely detectable under PCM in only some specimens. Apophyses for the insertion of stylet muscles (AISM) in the shape of blunt hooks and asymmetrical in size and shape with respect to the frontal plane (Figs 8–10). Stylet furcae with rounded ends (Fig. 7). Buccal tube with a posterior bend and thickened walls posteriorly from the stylet support insertion point. Pharyngeal bulb (bulbus) almost oval, with apophyses and two clearly separated macroplacoids. Pharyngeal apophyses triangular, smaller than macroplacoids. First macroplacoid slightly elongated, second roundish, but the size and shape of placoids exhibit considerable variation; particularly obvious under SEM (Figs 11 a,b,c–12a,b,c). Macroplacoids appear without constrictions under PCM, but slight constrictions in both macroplacoids are visible in the majority of buccal apparatuses observed under SEM (Figs 6, 11 a,b,c–12a,b,c). Macroplacoid length configuration 2Ramazzottius - type. Primary branches of external and posterior claws long and thin. Internal and anterior claws much smaller and of a different shape than external claws (Fig. 13–15). Base of external and posterior claws distinctly enlarged, internal and anterior claws with small and smooth pseudolunules. Accessory points on primary branches of all claws, present. Bars and other cuticular thickenings on legs, absent. Eggs (morphometrics in Table 5): Laid freely, white and spherical, covered with numerous small, thorn-, spine- or filament-shaped processes (Figs 16–29). Always triangular in shape, processes exhibit extreme diversity in size (both height and base width), morphology (e.g. single examples exhibiting transverse septa), as well as in their distribution on the egg surface (Figs 16–29). The greatest variability was observed between eggs, however exceptional variability can also sometimes be observed within an individual egg. There is also a considerable variability in process numbers on the egg surface—from fully covered to almost bald eggs with sparse and poorly developed processes. Egg processes and surface between processes smooth (Figs 16–29). DNA: Obtained sequences were identical across the three analysed individuals (i.e. only a single haplotype was found). The obtained COI sequence (GenBank: MF001999) is 822 bp long and it encompasses a longer fragment than the 358 bp long COI sequence provided in Stec et al. 2016a (i.e. KU900021): TATATGGAACATTATATTTTATTTTCGGCATTTGAGCCGCCACTGTGGGCACCTCCTTAAGAATAATTATTCGATC AGAATTAAGAGAACCCGGATCATTGTTCGCGGAAGAACAACTATACAATGTAACAGTAACTAGACACGCTTTCATT ATGATTTTTTTCTTTGTTATACCCATCCTGATTGGAGGTTTTGGAAATTGATTAGTGCCTCTTATGGTTGGCGCGC CGGATATAGCTTTCCCCCGAATAAATAACTTAAGATTTTGACTACTACCCCCGTCATTTTTATTAATTTCTACAAG CACTATGAGAGAGCAGGGCGCAGGCACCGGATGAACAGTATACCCACCCCTCTCAAACTATTTCGCACATAGGGGA CCTGCCGTAGATTTAACTATTTTTTCTTTACATATTGCAGGTGTTTCCTCTATTTTAGGGGCCATTAATTTTATTT CCACAATTATAAATATACGAACCCCGTCAGTCAGATTAGAGAACATATCTCTCTTCGTTTGATCAGTCCTAATTAC TGCAGTATTATTACTTTTAGCGCTCCCAGTGCTCGCAGGAGCGATTACAATACTACTTCTAGATCGAAATTTTAAT ACCTCATTTTTTGATCCGGCAGGAGGTGGAGATCCGATTCTTTACCAACACCTGTTTTGATTTTTCGGACATCCAG AAGTTTACATTCTTATTTTGCCTGGTTTCGGTTTAGTGTCACAAATTATTGTCCACTACAGAGGGAAACACCTTAC GTTTGGACACTTAGGAATAATTTATGCTATAAGAACTATCGGTTTATTGGGGTTCATCGTTT The obtained 28S rRNA sequence (GenBank: MF001998) is 787 bp long: TACTAAGCGGAGGAAAAGAAACCAACGGGGATTCCCATAGTAACTGCGAGTGAAAGGGGAAGAGCCCAGCGCCGAA TCCTACTGCTGGCAACGGTGGTAGGAACTGTGGCGTGAAGACAGTCTATTCCAGTGCGGCTAGCTTGCGTAAGTTC TCCTGAGTGAGGCTCCATCCCATGGAGGGTGCAAGGCCCGTATCGTAAGCAGCTGGTGCTGGTATCAGCTGTCGGA GAGTCGCCTTGTTTGCGAGTACAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTAAATATGACCACGAGTCCGA TAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGCGTGAAACCGCTTAGA GGCAAGCAGATGGGGCCTCGAAGGCAAAGCAGTGAATTCAGCTGGTAGTCCGTAGTGCCGGCCTGCATTACAGATC GCAAGACTGTGGCAGGTTGTGAGGCTGCGGCTGCTAGTGCACTTTCACTGTTTGTACGCCACCGCCGTTGAGCGAG CGTCCGTCTAGCTGGCGTGTGAAGCCTTGTTCCCTTTACGGGGTTACAGGTGTCTTACTGCCGGTCACGACGCGTT CGCACCTCAACCGGTCATGTCAGCGTGTGCCAGCGTATTGCGTTGGGCTCGTTCACCCTGGTGTGCGTCGGAGATG ACAAGCTCGCTTGGCTCACTGGCGTATTGCCTGGGAATGGGCGGGTTTGCAACGTAGGCACATTGTCGATTCGGTG GCGAGTAGACGGCTGCCCATCTAACCC The obtained 18S rRNA sequence (GenBank: MF001997) is 1034 bp long: AGATCGTACAGTTTACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCATTCAGCTCGCTCTCTCGGGAGCG AGCGCAGTTATTAGAATAAAACCAATCCGGCCTTCGGGTCGGTAAAATTGGTGACTCTGAATAACCGAAGCGGAGC GCATGGTCTCGTACCGGCGCCAGATCTTTCAAGTGTCTGACTTATCAGCTCGTAGGTAGGTTATGTGCCTACCTAG GCTCTTACGGGTAACGGGGTGTCAGGGCCCGACACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAG GCAGCAGGCGCGCAAATTACCCACTCCCGGCACGGGGAGGTAGTGACGAAAAATAACGATGCGAGAGCTTTTAGCT TTTCGTAATCGGAATGGGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCG CGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCGGTTAAAAAGCTCGTAGTTGGATCTGGGTTGTTCGA GCGAGCGGTGCGTCTTCACGGCGTAACTGTTTGTTCGGCACCACAGCCCGGTTATGTCTTGCATGCCCTTCACTGG GTGTGCTTGGCGACCGGAACGTTTACTTTGAAAAAATTAGAGTGCTCAAAGCAGGCGTATGGCCTTGCATAATGGT GCATGGAATAATAGAATAGGACCTCGGTTCTATTTTGTTGGTTTTCGGAGCTCGAGGTAATGATTAATAGGAACAG ACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGATCGTCGCAAGACGCACTACTGCGAAAGCATTTG CCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCCCTAGTTCTAACCAT AAACGATGCCAACCAGCGATCCGTCGGTGTTTGTTTTATGACTCGACGGGCAGCTTCCGGGAAACCAAAGTGTTTA GGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGAATGAC See also Stec et al. (2016a) for the sequences of the two known ITS-2 haplotypes (KU900019–20). CHARACTER R. anomalus R. subanomalus R. subanomalus (holotype) (holotype) (a Polish specimen) Intraspecific variability in morphology and morphometry. In the same population of R. subanomalus as used for this study, Stec et al. (2016a) analysed intra-specific variability in the standard morphometric traits of both animals and eggs in relation to the genetic variation uncovered. However, Stec et al. (2016a) concentrated on analysing the determinants of eggshell variability, and thus their study lacked a comparison of the recorded variability with that described by Biserov (1985) in the original description of R. subanomalus. Compared to the type series (measurements by Biserov 1985 provided in Table 6 and new photomicrographs in Figs 30–35), our Polish population of R. subanomalus exhibited a wider range for several morphometric traits, e.g. macroplacoid I length (2.3–4.5 µm in the type population vs. 3.8–6.0 µm in the Polish population), egg process height (3.0–6.6 µm in the type population vs. 1.5–12.5 µm in the Polish population), egg process base diameter (2.0–4.5 µm in the type population vs. 0.5–9.9 µm in the Polish population). Thus, the most striking variability in R. subanomalus was observed not in the animals, but in the number, size and shape of the egg processes (Figs 16–29; see also Stec et al. 2016a). Biserov (1985) described R. subanomalus eggs as covered with cone-shaped processes of similar size, but our observations considerably widen the range of chorion morphology in this species. We suspect that if, for example, eggs shown in Figs 16, 20, 26 and 29 were found in different samples, it is very likely that they would be classified as four different species. Even though egg morphology is considered to provide key taxonomic traits for the differentiation of many eutardigrade taxa, including the genus Ramazzottius, the evidence presented in this paper plus that provided by Biserov (1996) for Ramazzottius montivagus (Dastych, 1983) and in Biserov (1997/8) for Ramazzottius caucasicus Biserov, 1998 and Ramazzottius ljudmilae Biserov, 1998, suggest egg morphology has a limited value for the differentiation of at least some Ramazzottius species. Since the taxonomy of Ramazzottius was based solely on alpha taxonomy (i.e. morphology and morphometrics), there is a problem even if the stability of egg traits is assumed. Our study, therefore, underlines the importance of providing an integrated analysis of species, combining classic taxonomy with the molecular approach, to delineate the species in this genus (see also Stec et al. 2016a). R. subanomalus vs. R. anomalus. The spine-shaped egg processes and qualitative as well as quantitative characters of the adults, indicate Ramazzottius subanomalus is most similar to Ramazzottius anomalus (Ramazzotti, 1962) (Figs 36–38). The two species are very similar with the only recorded qualitative difference between them being the presence (R. anomalus; Fig. 37, indented arrowhead) or absence (R. subanomalus; Figs 16–29 and 34) of a fine granulation on the eggshell surface. It also appears that the egg processes of R. anomalus have a more evident septa between their basal and distal parts (Figs 37–38). In addition, Biserov (1985) also noted that the egg processes are on average 6.7 µm taller in R. anomalus than R. subanomalus. However, our observations (see Figs 16–29 and Table 5) now question whether the number, size and shape of egg processes are a reliable taxonomically trait in differentiating the two species: i.e. process height in the Polish population of R. subanomalus ranged from 1.5 to 12.5 µm, and thus largely overlap the values reported by Ramazzotti (1962) for R. anomalus (i.e. 5.0–12.0 µm). In the absence of eggs, differentiating between individuals of R. anomalus and R. subanomalus relies exclusively on three morphometric differences: R. anomalus has a shorter buccal tube and placoids (both macroplacoids in absolute values, but only the first macroplacoid in pt values). The remaining morphometric characters are very similar in the two species (see Table 6 for a full comparison). However, as R. anomalus was described over half a century ago and tardigrade taxonomy has moved forward, the original description lacks many key measurements (Table 6), so there could be more morphometric differences between R. anomalus and R. subanomalus which we are currently unaware of. In other words, a modern integrative re-description of R. anomalus is very desirable in order to confidently differentiate the species from other congeners with similar adult and egg morphology. Also, as this is only the second report for R. subanomalus, data from other populations of this species are required for the better estimation of the extent of R. subanomalus intraspecific variability. Ramazzottius DNA sequences. The COI sequence for the Polish population of R. subanomalus proved to be distinct from all the Ramazzottius COI sequences that were available from GenBank and suitable for analysis, with p-distances ranging from 19.0 to 20.0% (EU251379 and EU251381, respectively). This figure is well above the 3% threshold proposed for species delineation (Cesari et al., 2009, but see also Michalczyk et al. 2012a). Similarly, our 28S rRNA sequence, with the p-distance of 3.1%, was distinct from the single available and suitable Ramazzottius sequence (FJ435768). Regarding the 18S rRNA, the p-distances ranged from 0.4% to 1.1% (FJ435727–8 and HQ604950, AY582122, respectively). The scarcity of available molecular data for Ramazzottius spp. underlines the need for more integrated taxonomy and ecological studies to provide DNA sequences from a variety of populations for any given tardigrade species. Without such large-scale systematic studies, threshold values or barcode gaps for species delineation in tardigrades cannot be confidently estimated or used for species delineation. Ramazzottius in Poland. Hitherto there have been four species of Ramazzottius reported from Poland: R. anomalus (in Dastych 1988), R. montivagus (in Dastych 1980), R. oberhaeuseri (in Kranz-Leśniewska 1933, Marcus 1936, Węglarska 1959a, b, Hęciak 1976, Węglarska & Korecka 1983, Dastych 1970, 1972, 1979, 1980, 1988, Kaczmarek & Michalczyk 2003ab, Zawierucha 2011, Zawierucha et al. 2012), and R. subanomalus (in Stec et al. 2016a). However, for the following reasons, we think that the Polish record of R. anomalus is invalid. First, the R. anomalus report by Dastych (1988) was for Jakubowo, which is only ca. 45 km from Poznań (where the population of R. subanomalus reported in this paper was found), whereas the type locality for R. anomalus was Cerro El Roble in Chile, over 12,500 km away. Second, the measurements provided for the Polish R. anomalus (see Dastych 1988) are similar to those of R. subanomalus. Third, the eggs of the Polish R. anomalus were described as having a smooth chorion between processes (see Dastych 1988), and are granulated in R. anomalus (see Fig. 39). Finally, at the time of publishing his monograph, Dastych (1988) was probably unaware of the Biserov (1985) publication in a Russian journal (not cited in Dastych 1988). Thus, it seems reasonable to conclude that the species Dastych (1988) recorded from Jakubowo in 1978 was actually R. subanomalus rather than R. anomalus. We therefore think that R. anomalus should be deleted from the list of Polish tardigrade species, and be substituted with R. subanomalus. However, this being an exchange rather than an addition to the record, the overall total number (103) of species recorded for Poland is unaffected., Published as part of Stec, Daniel, Zawierucha, Krzysztof & Michalczyk, Łukasz, 2017, An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland, pp. 403-420 in Zootaxa 4300 (3) on pages 407-414, DOI: 10.11646/zootaxa.4300.3.4, http://zenodo.org/record/839492, {"references":["Biserov, V. I. (1985) Hypsibius subanomalus sp. n. (Eutardigrada, Hypsibiidae) from the Astrakhan District. Zoologicheskii Zhurnal, 64, 131 - 135.","Biserov, V. I. (1996) Tardigrada of the Novaya Zemlya Archipelago, collected by the Marine Arctic Complex Expedition in 1994. Arthropoda Selecta, 5, 151 - 157.","Dastych, H. (1983) Two new Eutardigrada species from West Spitsbergen and the Tatra Mts. Bulletin de la Societe des amis des sciences et des lettres de Poznan, 23, 195 - 200.","Biserov, V. I. (1997 - 98) Tardigrades of the Caucasus with the taxonomic analysis of the genus Ramazzottius (Parachela: Hybsibiidea). Zoologischer Anzeiger, 236, 139 - 159.","Ramazzotti, G. (1962) Tardigradi del Cile, con descrizione di quattro nuove specie e di una varieta. Atti della Societa Italiana di Scienze Naturali e del Museo Civico di Storia Naturale di Milano, 101, 275 - 287.","Cesari, M., Bertolani, R., Rebecchi, L. & Guidetti, R. (2009) DNA barcoding in Tardigrada: the first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Molecular Ecology Resources, 9, 699 - 706. https: // doi. org / 10.1111 / j. 1755 - 0998.2009.02538. x","Michalczyk, L., Welnicz, W., Frohme, M. & Kaczmarek, L. (2012 a) Redescriptions of three Milnesium Doyere, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa, 3154, 1 - 20.","Dastych, H. (1988) The Tardigrada of Poland. Monografie Fauny Polsk. Vol. 16. Panstwowe Wydawnictwo Naukowe, Krakow-Warszawa, 255 pp.","Dastych, H. (1980) Niesporczaki (Tardigrada) Tatrzanskiego Parku Narodowego. Monografie Fauny Polski. Vol. 9. Panstwowe Wydawnictwo Naukowe, Krakow, 232 pp.","Kranz-Lesniewska, H. (1933) Niesporczaki na ziemiach polskich. Sprawozdania Poznanskiego Towarzystwa Przyjaciol Nauk, 3, 88 - 89. [Poznan]","Marcus, E. (1936) Tardigrada. Das Tierreich, 66, 1 - 340.","Weglarska, B. (1959 a) Die Tardigraden (Tardigrada) Polens. I. Tardigraden der Woiwodschaft Krakow. Acta Zoologica Cracoviensia, 4, 699 - 745.","Weglarska, B. (1959 b) Tardigraden Polens II. Vestnik Ceskoslovenske spolecnosti zoologicke, 23, 354 - 357.","Heciak, S. (1976) Niesporczaki (Tardigrada) Gor Swietokryskich. Badania Fizjograficzne nad Polska Zachodnia, Seria B, Biologia, 29, 111 - 128.","Weglarska, B. & Korecka, T. (1983) Tardigrada from Dobczyce area (Poland). Zeszyty naukowe Uniwersytetu Jagiellonskiego, 29, 83 - 92.","Dastych, H. (1970) Materialy do znajomosci niesporczakow (Tardigrada) Tatrzanskiego Parku Narodowego. Fragmenta Faunistica, 16, 77 - 87. [Warszawa]","Dastych, H. (1972) Niesporczaki (Tardigrada) Wolinskiego Parku Narodowego. Badania Fizjograficzne nad Polska Zachodnia, Seria B, Biologia, 25, 37 - 45.","Dastych, H. (1979) Niesporczaki (Tardigrada) Ojcowskiego Parku Narodowego. Badania Fizjograficzne nad Polska Zachodnia, Seria B, Biologia, 32, 97 - 104.","Zawierucha, K. (2011) Water bears (Tardigrada) of Okup Maly (Grabia Valley, Central Poland). Badania Fizjograficzne, Seria C, Zoologia, 47 - 52.","Zawierucha, K., Kolicka, M. & Cytan, J. (2012) Contribution to the knowledge on the distribution of Echiniscus granulatus (Doyere, 1840) (Heterotardigrada) in Poland. Badania Fizjograficzne, Seria C, Zoologia, 39 - 43."]}

Macrobiotus polypiformis sp. nov. urn:lsid:zoobank.org:act: 3858645 A- 2909 -4 DB 9-82 CD-CF 2B4D7051C2 Figs 1–29; Tables 3–4 Etymology The specific epithet ‘ polypiformis ’ refers to the similarity of the egg processes to the polyp form found in the phylum Cnidaria. Material examined Specimens mounted on microscope slides in Hoyer’s medium, fixed on SEM stubs or processed for DNA sequencing. Holotype ECUADOR: slide 1215/ 19, 3 Jan. 2015, Milena Roszkowska and Łukasz Kaczmarek leg. (MECN). Paratypes ECUADOR: 135 animals (including 10 simplex), one exuvia and 44 eggs (including two with developed embryos), same data as holotype (MECN, slide 1215 /19 (with holotype), 4 paratypes (slides: 1215 /*, where the asterisk can be substituted by any of the following numbers: 23, 25) and two eggs (slides: 1215 /*: 8, 9); DATE, 92 paratypes (slides: 1215 /*: 1, 2, 3, 10, 11, 12, 13, 14, 15, 16, 19, 20, 22, 24) and 24 eggs (slides: 1215 /*: 1, 4, 5, 7, 26, 27); ZMUC, 5 paratypes (slides 1215 /*: 17, 21) and 3 eggs (slide 1215 /6)). Type locality ECUADOR: Manabí Province, 1°04′06″ S, 89°52′18″ W; 370 m asl, moss sample from a concrete wall, next to E15 road, ca 3.5 km W from San Lorenzo, tropical rainforest. Description Animals (measurements and statistics in Table 3) Body white in juveniles and adults, transparent after fixation in Hoyer’s medium (Figs 1–2). Eyes present (in 93% of measured specimens). Dorsal and ventral cuticle smooth under LM. Additionally, small oval and round pores (0.9–1.2 μm in diameter), sometimes difficult to observe under LM, are scattered randomly on the entire cuticle (Figs 3–4). A ring of pores, difficult to observe under LM, is present around the mouth opening, below the peribuccal sensory lobes. One patch of fine and dense granulation above claws on legs I–IV present (Figs 16–19). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Figs 5–6), with the ventral lamina and ten small peribuccal lamellae (Figs 6, 9) followed by six buccal sensory lobes. Oral cavity armature composed of three bands of teeth, of which only the third band is visible under LM (Fig. 7, empty arrowhead). SEM is required to reveal the first and the second bands of teeth (see Figs 8–9). The first band of teeth comprises extremely small cones arranged in 3–4 rows situated at the anterior portion of the oral cavity, at the base of the peribuccal lamellae (Figs 8–9, filled arrowheads). The second band of teeth is composed of 4–5 rows of small cones (but larger than those on the first band), positioned towards the rear of the oral cavity, between the ring fold and the third band of teeth (Figs 8–9, arrows). The teeth of the third band are positioned at the rear of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 7–9, empty arrowheads). Under LM, the teeth of the third band appear as a single, thin, transversal ridge both ventrally and dorsally (Fig. 7, empty arrowhead). Although SEM reveals that both ventral and dorsal teeth do indeed form continuous ridges, there are evident median (M) and lateral (L) peaks corresponding to the median and lateral teeth found in species with better developed oral cavity armatures (Figs 8–9). Median teeth are smaller than the lateral teeth (Fig. 8). In addition, there are a number of smaller accessory teeth (a) placed laterally to the lateral teeth. These accessory teeth are better developed ventrally than dorsally (Fig. 8). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular microplacoid (Figs 5–6). The macroplacoid length sequence 1>2. The first macroplacoid with a central constriction (Figs 5–6, the filled arrowhead). Claws small and slender of the hufelandi type (Figs 10–14). Primary branches with distinct accessory points. Lunules on legs I–III smooth (Figs 10, 13), those on legs IV dentate (Figs 12, 14). Bars under claws absent but paired muscle attachments below claws I–III present (hardly visible under LM and only slightly more visible under SEM). Eggs (measurements and statistics in Table 4) Laid freely, white to light yellow, spherical and with a hufelandi type chorion ornamentation (Figs 20–28). The surface between processes is covered with a dense regular reticulum (mesh diameter 0.5– 0.8 μm) (Figs 22, 25–28). Processes in the shape of inverted goblets with slightly concave, conical, micro-granulated trunks and well-defined terminal discs (Figs 22–23, 25–26, 28). When observed under SEM, some process trunks have 3–5 faint, annular ring undulations (Figs 26, 28), whereas in LM these undulations are not visible. Terminal discs are cog-shaped, with each of the 8–10 ‘cog-teeth’ extended to form a long, thin, hair-like and flexible filament that probably serves to enhance the adhesive function of egg processes. Under SEM, small rounded granules or aggregations of granules, 0.06–0.15 μm in diameter, are visible on the filaments (Fig. 29). Central area of the terminal disc with sparse, randomly distributed, small granules (Figs 25, 28). Moreover, the area between the granules on the filaments, the surface of the terminal disk and the trunk of the processes appear, under SEM, to be micro-granulated (Figs 28–29). DNA sequences Initially, four molecular markers obtained from four of the eight individuals were sequenced. The sequences from 18S rRNA, 28S rRNA, ITS-2 exhibited a lack of polymorphism, whereas for COI two distinct haplotypes were obtained. Knowing that ITS-2 and COI have relatively high mutation rates, these fragments were sequenced for the remaining four specimens. The eight individuals were found to have identical ITS-2 sequences while COI revealed two haplotypes (frequency 1:1) differing by 20 substitutions. One consensus sequence for each nuclear marker and one consensus sequence for each COI haplotype were deposited in GenBank: 18S rRNA sequence, 1726 bp long (GenBank accession number: KX810008), 28S rRNA sequence, 725 bp long (KX810009), COI sequence for haplotype 1, 658 bp long (KX810011), COI haplotype 2, 658 bp long (KX810012), and ITS-2 sequence, 425 bp long (KX810010). Remark Among the 136 individuals of the new species, one specimen had abnormal claws, i.e., internal and external claw II and III on one leg had additional secondary branches (Figs 15, 19). Additionally, on the claws of the IV pair of legs, unique, upwardly turned spurs were present near the lower half of the claw (Fig. 19). Differential diagnosis Morphological Macrobiotus polypiformis sp. nov., by the presence of long, flexible filaments on the egg processes and faint annular undulations on their trunks, is most similar to Ma. paulinae Stec et al., 2015, but differs from it by possessing larger pores on the cuticle (0.9–1.2 μm in Ma. polypiformis sp. nov. vs 0.3–0.5 μm in Ma. pauliane), smooth cuticle (seven dorso-lateral patches of sparse granulation arranged symmetrically on both sides of the body in Ma. paulinae), one patch of granulation on legs I–IV (two distinct patches of granulation, fine and dense granulation above claws and a more robust and sparse granulation in the middle of each leg in Ma. paulinae), a different number of rows of teeth in the first band of teeth in the oral cavity (3–4 rows in Ma. polypiformis sp. nov. vs a single row in Ma. paulinae), larger reticulum mesh diameter covering the egg surface (0.5–0.8 μm in Ma. polypiformis sp. nov. vs 0.05–0.2 μm in Ma. paulinae), trunks of the egg processes with faint annular undulations (distinct and clearly visible in Ma. paulinae), different morphology of the terminal disc margins (8–10 long, hair-like, flexible filaments in Ma. polypiformis sp. nov. vs small, irregular teeth, instead of filaments, in Ma. paulinae, with only some processes having one to a few flexible filaments), lower number of processes on the egg circumference (19–23 in Ma. polypiformis sp. nov. vs 24–32 in Ma. paulinae). Genotypic It was confirmed, using Basic Local Alignment Search Tool (BLAST; Altschul et al. 1990), that no sequences deposited in GenBank were identical with sequences obtained from the type population of Ma. polypiformis sp. nov. The p-distances calculated for ITS-2 between the new species and Ma. polonicus Pilato, Kaczmarek, Michalczyk & Lisi, 2003, Ma. spaiens Binda & Pilato, 1984 and Ma. paulinae are 39.4%, 25.6% and 31.1%, respectively. In the case of COI, genetic distances between the two haplotypes of Ma. polypiformis sp. nov. is 3.1%, which is above the threshold for species delineation proposed by Cesari et al. (2009). However, sequences from haplotype 1 and 2 are clearly distant from sequences of each species used in the analysis. For haplotype 1, p-distance range from 20.6% to 25.8%; haplotype 2 from 21.0% to 25.9%. In each case the most similar to the new species is Ma. paulinae (KT951668) and the most distinct is Ma. macrocalix Bertolani & Rebecchi, 1993 (HQ876571, FJ176208 -12). Given there is no polymorphism in the ITS-2 sequences coming from the type population and the morphologically most similar species Ma. paulinae differs from the new species by a genetic distance of nearly 21%, it can be claimed that Ma. polypiformis sp. nov. is a valid new species exhibiting two COI haplotypes. P-distances for more conservative DNA fragments (28S rRNA and 18S rRNA) are, as was expected, lower than for more variable markers (COI and ITS-2). The range for 28S rRNA is 7.3%–12.9% with the most similar species Ma. paulinae (KT935501) and for 18S rRNA 3.0%–6.2% where the closest related species are Ma. paulinae (KT935502) and Ma. sapiens (DQ839601)., Published as part of Roszkowska, Milena, Ostrowska, Marta, Stec, Daniel, Janko, Karel & Kaczmarek, Łukasz, 2017, Macrobiotus polypiformis sp. nov., a new tardigrade (Macrobiotidae; hufelandi group) from the Ecuadorian Pacific coast, with remarks on the claw abnormalities in eutardigrades, pp. 1-19 in European Journal of Taxonomy 327 on pages 6-12, DOI: 10.5852/ejt.2017.327, http://zenodo.org/record/3829396, {"references":["Stec D., Smolak R., Kaczmarek L. & Michalczyk L. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052 (5): 501 - 526. https: // doi. org / 10.11646 / zootaxa. 4052.5.1","Altschul S. F., Gish W., Miller W., Myers E. W. & Lipman D. J. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403 - 410. https: // doi. org / 10.1016 / S 0022 - 2836 (05) 80360 - 2","Cesari M., Bertolani R., Rebecchi L. & Guidetti R. 2009. DNA barcoding in Tardigrada: the first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Molecular Ecology Resources 9 (3): 699 - 706. https: // doi. org / 10.1111 / j. 1755 - 0998.2009.02538. x","Bertolani R. & Rebecchi L. 1993. A revision of the Macrobiotus hufelandi group (Tardigrada, Macrobiotidae), with some observations on the taxonomic characters of eutardigrades. Zoologica Scripta 22: 127 - 152. https: // doi. org / 10.1111 / j. 1463 - 6409.1993. tb 00347. x"]}

Macrobiotus polypiformis sp. nov. urn:lsid:zoobank.org:act: 3858645 A- 2909 -4 DB 9-82 CD-CF 2B4D7051C2 Figs 1–29; Tables 3–4 Etymology The specific epithet ‘ polypiformis ’ refers to the similarity of the egg processes to the polyp form found in the phylum Cnidaria. Material examined Specimens mounted on microscope slides in Hoyer’s medium, fixed on SEM stubs or processed for DNA sequencing. Holotype ECUADOR: slide 1215/ 19, 3 Jan. 2015, Milena Roszkowska and Łukasz Kaczmarek leg. (MECN). Paratypes ECUADOR: 135 animals (including 10 simplex), one exuvia and 44 eggs (including two with developed embryos), same data as holotype (MECN, slide 1215 /19 (with holotype), 4 paratypes (slides: 1215 /*, where the asterisk can be substituted by any of the following numbers: 23, 25) and two eggs (slides: 1215 /*: 8, 9); DATE, 92 paratypes (slides: 1215 /*: 1, 2, 3, 10, 11, 12, 13, 14, 15, 16, 19, 20, 22, 24) and 24 eggs (slides: 1215 /*: 1, 4, 5, 7, 26, 27); ZMUC, 5 paratypes (slides 1215 /*: 17, 21) and 3 eggs (slide 1215 /6)). Type locality ECUADOR: Manabí Province, 1°04′06″ S, 89°52′18″ W; 370 m asl, moss sample from a concrete wall, next to E15 road, ca 3.5 km W from San Lorenzo, tropical rainforest. Description Animals (measurements and statistics in Table 3) Body white in juveniles and adults, transparent after fixation in Hoyer’s medium (Figs 1–2). Eyes present (in 93% of measured specimens). Dorsal and ventral cuticle smooth under LM. Additionally, small oval and round pores (0.9–1.2 μm in diameter), sometimes difficult to observe under LM, are scattered randomly on the entire cuticle (Figs 3–4). A ring of pores, difficult to observe under LM, is present around the mouth opening, below the peribuccal sensory lobes. One patch of fine and dense granulation above claws on legs I–IV present (Figs 16–19). Mouth antero-ventral. Bucco-pharyngeal apparatus of the Macrobiotus type (Figs 5–6), with the ventral lamina and ten small peribuccal lamellae (Figs 6, 9) followed by six buccal sensory lobes. Oral cavity armature composed of three bands of teeth, of which only the third band is visible under LM (Fig. 7, empty arrowhead). SEM is required to reveal the first and the second bands of teeth (see Figs 8–9). The first band of teeth comprises extremely small cones arranged in 3–4 rows situated at the anterior portion of the oral cavity, at the base of the peribuccal lamellae (Figs 8–9, filled arrowheads). The second band of teeth is composed of 4–5 rows of small cones (but larger than those on the first band), positioned towards the rear of the oral cavity, between the ring fold and the third band of teeth (Figs 8–9, arrows). The teeth of the third band are positioned at the rear of the oral cavity, between the second band of teeth and the buccal tube opening (Figs 7–9, empty arrowheads). Under LM, the teeth of the third band appear as a single, thin, transversal ridge both ventrally and dorsally (Fig. 7, empty arrowhead). Although SEM reveals that both ventral and dorsal teeth do indeed form continuous ridges, there are evident median (M) and lateral (L) peaks corresponding to the median and lateral teeth found in species with better developed oral cavity armatures (Figs 8–9). Median teeth are smaller than the lateral teeth (Fig. 8). In addition, there are a number of smaller accessory teeth (a) placed laterally to the lateral teeth. These accessory teeth are better developed ventrally than dorsally (Fig. 8). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular microplacoid (Figs 5–6). The macroplacoid length sequence 1>2. The first macroplacoid with a central constriction (Figs 5–6, the filled arrowhead). Claws small and slender of the hufelandi type (Figs 10–14). Primary branches with distinct accessory points. Lunules on legs I–III smooth (Figs 10, 13), those on legs IV dentate (Figs 12, 14). Bars under claws absent but paired muscle attachments below claws I–III present (hardly visible under LM and only slightly more visible under SEM). Eggs (measurements and statistics in Table 4) Laid freely, white to light yellow, spherical and with a hufelandi type chorion ornamentation (Figs 20–28). The surface between processes is covered with a dense regular reticulum (mesh diameter 0.5– 0.8 μm) (Figs 22, 25–28). Processes in the shape of inverted goblets with slightly concave, conical, micro-granulated trunks and well-defined terminal discs (Figs 22–23, 25–26, 28). When observed under SEM, some process trunks have 3–5 faint, annular ring undulations (Figs 26, 28), whereas in LM these undulations are not visible. Terminal discs are cog-shaped, with each of the 8–10 ‘cog-teeth’ extended to form a long, thin, hair-like and flexible filament that probably serves to enhance the adhesive function of egg processes. Under SEM, small rounded granules or aggregations of granules, 0.06–0.15 μm in diameter, are visible on the filaments (Fig. 29). Central area of the terminal disc with sparse, randomly distributed, small granules (Figs 25, 28). Moreover, the area between the granules on the filaments, the surface of the terminal disk and the trunk of the processes appear, under SEM, to be micro-granulated (Figs 28–29). DNA sequences Initially, four molecular markers obtained from four of the eight individuals were sequenced. The sequences from 18S rRNA, 28S rRNA, ITS-2 exhibited a lack of polymorphism, whereas for COI two distinct haplotypes were obtained. Knowing that ITS-2 and COI have relatively high mutation rates, these fragments were sequenced for the remaining four specimens. The eight individuals were found to have identical ITS-2 sequences while COI revealed two haplotypes (frequency 1:1) differing by 20 substitutions. One consensus sequence for each nuclear marker and one consensus sequence for each COI haplotype were deposited in GenBank: 18S rRNA sequence, 1726 bp long (GenBank accession number: KX810008), 28S rRNA sequence, 725 bp long (KX810009), COI sequence for haplotype 1, 658 bp long (KX810011), COI haplotype 2, 658 bp long (KX810012), and ITS-2 sequence, 425 bp long (KX810010). Remark Among the 136 individuals of the new species, one specimen had abnormal claws, i.e., internal and external claw II and III on one leg had additional secondary branches (Figs 15, 19). Additionally, on the claws of the IV pair of legs, unique, upwardly turned spurs were present near the lower half of the claw (Fig. 19). Differential diagnosis Morphological Macrobiotus polypiformis sp. nov., by the presence of long, flexible filaments on the egg processes and faint annular undulations on their trunks, is most similar to Ma. paulinae Stec et al., 2015, but differs from it by possessing larger pores on the cuticle (0.9–1.2 μm in Ma. polypiformis sp. nov. vs 0.3–0.5 μm in Ma. pauliane), smooth cuticle (seven dorso-lateral patches of sparse granulation arranged symmetrically on both sides of the body in Ma. paulinae), one patch of granulation on legs I–IV (two distinct patches of granulation, fine and dense granulation above claws and a more robust and sparse granulation in the middle of each leg in Ma. paulinae), a different number of rows of teeth in the first band of teeth in the oral cavity (3–4 rows in Ma. polypiformis sp. nov. vs a single row in Ma. paulinae), larger reticulum mesh diameter covering the egg surface (0.5–0.8 μm in Ma. polypiformis sp. nov. vs 0.05–0.2 μm in Ma. paulinae), trunks of the egg processes with faint annular undulations (distinct and clearly visible in Ma. paulinae), different morphology of the terminal disc margins (8–10 long, hair-like, flexible filaments in Ma. polypiformis sp. nov. vs small, irregular teeth, instead of filaments, in Ma. paulinae, with only some processes having one to a few flexible filaments), lower number of processes on the egg circumference (19–23 in Ma. polypiformis sp. nov. vs 24–32 in Ma. paulinae). Genotypic It was confirmed, using Basic Local Alignment Search Tool (BLAST; Altschul et al. 1990), that no sequences deposited in GenBank were identical with sequences obtained from the type population of Ma. polypiformis sp. nov. The p-distances calculated for ITS-2 between the new species and Ma. polonicus Pilato, Kaczmarek, Michalczyk & Lisi, 2003, Ma. spaiens Binda & Pilato, 1984 and Ma. paulinae are 39.4%, 25.6% and 31.1%, respectively. In the case of COI, genetic distances between the two haplotypes of Ma. polypiformis sp. nov. is 3.1%, which is above the threshold for species delineation proposed by Cesari et al. (2009). However, sequences from haplotype 1 and 2 are clearly distant from sequences of each species used in the analysis. For haplotype 1, p-distance range from 20.6% to 25.8%; haplotype 2 from 21.0% to 25.9%. In each case the most similar to the new species is Ma. paulinae (KT951668) and the most distinct is Ma. macrocalix Bertolani & Rebecchi, 1993 (HQ876571, FJ176208 -12). Given there is no polymorphism in the ITS-2 sequences coming from the type population and the morphologically most similar species Ma. paulinae differs from the new species by a genetic distance of nearly 21%, it can be claimed that Ma. polypiformis sp. nov. is a valid new species exhibiting two COI haplotypes. P-distances for more conservative DNA fragments (28S rRNA and 18S rRNA) are, as was expected, lower than for more variable markers (COI and ITS-2). The range for 28S rRNA is 7.3%–12.9% with the most similar species Ma. paulinae (KT935501) and for 18S rRNA 3.0%–6.2% where the closest related species are Ma. paulinae (KT935502) and Ma. sapiens (DQ839601).

Mesobiotus philippinicus sp. nov. (Tables 4 –6, Figs 1–51) Description of the new species. Animals (measurements and statistics in Table 4). Body white/transparent (Figs 1–2), eyes present (also in mounted individuals). Under PCM, cuticle appears completely smooth with no granulation visible (except in some specimens a very fine granulation barely detectable on legs IV). Under SEM, however, extremely fine granulation (microgranules, ca. 0.05 µm in diameter) is visible on the entire dorso-lateral cuticle (Figs 3–5). The microgranulation is scattered evenly on most of the cuticle, but is denser to the caudo-dorsal region. Moreover, patches of dense, raised granule aggregates are present on external cuticle of all legs, above claws (Figs 6–9). These raised granule aggregates are ca. 0.2 µm in diameter, and consist of two to over thirty microgranules, but more often between five and ten microgranules (Figs 7, 9). Patches on legs I–III are smaller (Figs 6–7) than those on legs IV (Figs 8–9). Cuticular pores absent. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 10), with ten peribuccal lamellae. Oral cavity armature of the harmsworthi- type, composed of three bands of teeth visible in both PCM and SEM (Figs 10–16). The first band appears as small granules/cones placed just behind (sometimes also at the base) of the lamellae under PCM /SEM, respectively, and are arranged in 5–7 irregular rows (PCM: Figs 10–14; SEM: 15–16, filled arrowheads). Teeth in the second band (Figs 15–16, empty arrowheads) are intermediate in size between those of the first and third bands of teeth, and are in the shape of small ridges parallel to the longitudinal axis of the buccal tube (Figs 10–14). The second band is continuous with the teeth arranged in one row and are positioned in the posterior portion of the oral cavity just behind the ring fold (Figs 19–20, rhomboid) and just before the third band of teeth (Figs 15–16, marked “L” and “M”). Situated posteriorly in the oral cavity just behind the second band of teeth and just before the buccal tube opening are the third band of teeth comprising three dorsal, distinctly separated, long and thin ridges (Fig 15 “L” and “M”) and three to six ventral teeth: two lateral ridges (Fig 16 "L") and 2–4 round or oval median teeth (Fig 16 “M 1–4 ”). Under PCM, the latero-ventral teeth are wing-shaped, thicker in their median portions (Figs 10–14), and under SEM are flat and serrated, with their height almost twice that of the teeth in the second band (Figs 15–16). Buccal tube rigid and slender with the ventral lamina (Fig 10). The pharyngeal bulb is equipped with pharyngeal apophyses, three macroplacoids and a microplacoid, all spaced equidistant from each other (Fig. 10 and the upper insert). The first and third macroplacoids are rod-shaped whereas the second macroplacoid is granular. The first macroplacoid is thinner anteriorly whereas the third macroplacoid has a sub-terminal constriction. The macroplacoid sequence is 2 Claws of the Mesobiotus type, with a septum and well-developed accessory points (Figs 17–20). Lunules smooth in claws I–III (Figs 17–18) and lightly to moderately crenulated in claws IV (Figs 19–20). Lunules, connected to the claw with a peduncle, present in all claws (Fig. 17–20). Double W-shaped transverse bars under claws I–III (Fig. 17, filled arrowhead); a horseshoe-shaped structure connects anterior and posterior lunules IV (Fig. 19). Egg (measurements and statistics in Table 5). White, laid free, spherical in shape and equipped with conical to dome-shaped processes (Figs 21 –32, 37– 39). The processes are evenly spaced and exhibit considerable variability in size and shape between eggs: from low domes to high cones (Figs 21 –24, 29–32, 37–39, 46– 48). Process surface covered with wrinkles forming a rose-like whorl, clearly identifiable under SEM (Figs 40–48) but under PCM identifiable only as serration on an intersected process wall (Figs 30, 32). Very rarely processes have smooth walls (Fig. 31). The labyrinthine layer is visible under PCM as a reticulum in process walls, with mesh size varying considerably between eggs (Figs 33–35). Some processes are terminated with one to several short but thin and flexible portions, visible in both PCM (Figs 30–32, indented arrowheads) and in SEM (Figs 49–51), covered irregularly with small granules that are visible only in SEM (Figs 49–51). Small pores (0.3 µm) are present on the bases of some processes and scattered across the inter-process surface. The pores are clearly visible in SEM (Figs 40–48) but only occasionally detectable under PCM (Figs 33–34, filled arrowheads). Egg surface clearly wrinkled, with wrinkles radiating out from the process bases, but not forming a connective network (Figs 33 –36, 40– 48). DNA sequences. A single haplotype was found for each sequenced marker across the eight analysed individuals, thus only one sequence per locus was deposited in the GenBank. The 18 S rRNA sequence (GenBank: KX 129793), 1690 bp long: TCTAAGTACTTGCTTTAACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTAGATCGTATATCCTACA CGGATAACTGAGGTAATTCTTCAGCTAATACGTGCTACAAGCTCGTTCCCTTGTGGAGCGAGCGCAGTTATTAGAACAAA ACCAATCCGGCCTTCGGGTCGGTTAAAATGGTGACTCTGAATAACCGAAGCGGAGCGTATGGTCTCGTACCGACGCCAGA TCTTTCAAGTGACTGCTCTATCAGCTTGTTGTTAGGTTATGCTCCTAACAAGGCTTCAACGGGTAACGGGGTATCAGGGT CCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCAGCA CGGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCATATTGCTTCTCGTAATCGGAATGGGTACACTTTAAATCCTTTA ACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGC GGTTAAAAAGCTCGTAGTTGATCGTAGACGTAGGATGAGTGGTGCGCTTTCCGGCGCTACTGCTTGTTCCGACGTCAAAA GCCGGTCATGTCTTGCATATCCTTCACTGGGTGTGCTTGGCGGCCGGAGCGTTTACTTTGAAAAAATTAGAGTGCTCAAA GCAGGCGTACGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGTTGGTTATCGGAGCTCG AGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGATCGTCGCAAGACGCA CTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCC CTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGCCGATGTTCTTTTGATGACTCGGCGGGCAGCTTCCGGGAAACC ACAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTG GAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTGACAGATTGAGAGCTCT TTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGAACGA GACTCTAGCCTGCTAAATAGCCAACCGATCCGCAGCGTCGGTTGCTACAAAAGCTTCTTAGAGGGACAAGTGGCGTTTAG TCACATGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCTACACTGAAGGGATCAG CGTGCTTAATCGCCTTGCCCGGAAGGGCTGGGGAATCCGATTAAACCCCTTCGTGATTGGGATTGAGCTTTGTAATTATC GCTCATGAACGAGGAATTCCCAGTAGGCACGAGTCATAAGCTCGTGTCGATTAAGTCCCTGCCCTTTGTACACACCGCCC GTCGCTACTACCGATTGAACCCTTTAGTGAGGTCTTCAGACCGGCCGTGGCGGCAGACTTTGTCTGCAGCTCACAGGTTG GGAAGACGAC The 28 S rRNA sequence (GenBank: KX 129794), 755 bp long: CTGCGAGTGAAACGGGACCAGCCCATCGCCGAATCCTTTCTGGCAACAGTGAAGGAACTGTGGCGTGTAGAAGATGTCTG CCGGTGTGGTTAGTTTGCGTAAGTTCTCCTGAGTGAGACTCCATCCCATGGAGGGTGCAAGGCCCGTACCGCAAGCAGCT GATGCCGGTTAGCGTCTTTCGGAGAGTCGCCTTATTTGTGAGTATAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTA AATATGGCCGCGCGTCCGATAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGC GTGAAACGGCTCAGAGGCAAGCAGATGGGGCCTCGAAGGCAGAGCAGCGAATTCAGCCGGTAGTTTGTGCGGATGGCGGT TGTCGGGATCGTAAGACTCGGTGGCTGTCAGTGCTGTGTGTACAACTGCTGGTGCACTTTCGTTGCACGATACACAACCG CCGTTGAGCGAGCATCCGTTGAGCTGGCAGCGTGGAGCCTTATTCCCCTTAAAAAGGCATAGGTGCTTACAGCTGGCTTT AACGCGTTTGCGCCTCAACCGGTCAAGTCTATGTATGCCATGCTTCGGCAGTGGGACCGGCTTGCTCCGATTTGGCGTTA GGAATGACGACTTTGTCGGCTTCTTGGCGTTAGGTGGACTCGATGTCGGTTATCCACGTAGGCATATTGTTGATTCGGTT GTGAGTAGATGGCAGCCTATCTAACCCGTCTTGAA The ITS- 2 sequence (GenBank: KX 129795), 481 bp long: AGAACGCAGCAAGATGTGAGACGTAACTGGAATTGCAGGACTTGTGACAGTTTATTCTTCGAATGCAAATCGCGGCGTTG GGTTAACCGACGCCACGCCTGGTTGAGGGTCAGTTGAATTAAACAAATCATAGTCGCGCAATGATTATGGATTGTCTGAA CAGTGCGTCAAGCACTGGCAGATGAAGTACAGACCCCAGACGTTGAGTGTCATGCGTACCGCTGCTGGTGCGATTGACGT TATATGGGACTTGTGCCGCAGTTGCACAGTAAACAGTCTCATGCACGTCCGATCGGCAAGTCGGCCTCGCTGCACAACCG CTGTTAGCTATAGCGGTAAGCGATATAGCGTCTGTGTATAAAACGACGTTTGACAACAAGCGATCGATCGGTCAATTGCT CGACTAATCGTCGCACAATCGTCGGATACTTTTTCTTTTGACCTCAGCTCAGACGAGATTACCCGCTGAACTTAAGCATA T The COI sequence (GenBank: KX 129796), 763 bp long: TTTTTTTTTGGATTATGAGCAGCTACGGTAGGTACATCACTTAGAATAATCATTCGATTAGAGCTAAGACAACCTGGAAG ATTATTTAATGACGAACAATTCTATAATGTAGTTGTAACTAGACACGCATTTATTATAATTTTTTTTTTTGTTATACCTA TTCTGATCGGTGGATTTGGTAACTGACTAGTTCCACTTATACTAAATGCACCTGACATAGCATTTCCCCGAATAAATAAC CTAAGATTTTGATTACTTCCTCCATCTTTAATTTTAATTTTATCTAGTTCAATCGTAGAACAGGGTGCAGGCACCGGATG AACTGTTTATCCGCCCCTATCAAGATTTTTTGCGCATAGAGGACCTAGAGTCGACATAACCATTTTTTCCCTTCATGTAG CTGGAGCTTCCTCAATTCTTGGGGCTATCAACTTTATTACAACTATTTTAAACATACGAATACATAATATGACAATAGAA CTACTACCCCTATTTGTATGATCAGTTCTTCTTACTGCTATTTTATTGCTCTTATCCCTCCCTGTACTTGCAGGTGCAAT CACTATATTACTTTTAGATCGAAATTTTAACACCTCCTTTTTCGACCCAAGAGGAGGAGGAGACCCTATTCTATACCAAC ACTTATTTTGATTCTTCGGTCATCCCGAAGTCTATATTTTAATTCTTCCTGGGTTTGGAATTATTTCACAACTAATTATC CATTTCAGTGGAAAACATTTAACTTTCGGGCATATCGGAATGA Type locality. Locale: 14 ° 38 ' 54.4 "N, 121 °04' 14.8 "E, 62 m a.s.l.: UP Science Park, near the Institute of Mathematics, University of the Philippines, Diliman, Quezon City, Philippines. Habitat: shady urban park. Substrate: moss on a tree trunk. Coll. Marc Mapalo, Maynard Gian Valdez, Rafael Fernando and Gamaliel Cabria. Etymology. The new species is named after the Philippines, where it was discovered and documented as the very first eutardigrade reported in the country. Type depositories. The holotype (slide PH.001.19), 15 paratypes and 18 eggs (slides PH.001.4–7, 10–11, 15– 16, 20– 22) are preserved at the Protein Structure and Immunology Laboratory of the National Institute of Molecular Biology and Biotechnology, University of the Philippines-Diliman, Quezon City, Philippines; 16 paratypes, 14 eggs and 15 chorions (slides PH.001.1–3, 8–9, 12–14, 17–18, 23– 24) are preserved at the Department of Entomology, Institute of Zoology, Jagiellonian University, Kraków, Poland.

Macrobiotus cf. anderssoni (Figs 1���3) Localities and number of specimens. XXVII (5, 2 exuviae and 10 eggs) Remarks. The eggs found in the present study (Figs 19���21) correspond perfectly to the original description and the figures published by Richters (1908: p. 17, Fig. 7). The eggs have the same number of processes (15���16) round the circumference, as shown in the original drawings. Moreover, the irregular and jagged apical parts of the processes also correspond to the original drawing. Unfortunately, adult specimens differ significantly by having three instead of two macroplacoids in the pharynx. However, the total length of the first two macroplacoids in the specimens examined correspond well to the length of the first macroplacoid measured by Richters in Mac. anderssoni (15.9���17.0 ��m in found specimens and 15.0 ��m in Mac. anderssoni) (but we also need to remember that Richters did not report the length of his specimens and it is not possible to compare the length of the macroplacoids in relation to body length). Taking into consideration that the first two macroplacoids can be situated very close one to another it is possible that Richters interpreted two macroplacoids as a single macroplacoid with a deep incision (which is present in the examined specimens). It should be also stressed that Richters did not find any embryonate egg and he could not confirm that the adults and eggs from his sample belonged to the same individuals. Therefore it is possible that his original description was of two separate species. Obviously, further analysis of type material or material from type locality is required to solve this problem. As our specimens do not agree with the original description, but were found close to the type locality of Mac. anderssoni (Tierra del Fuego in Argentina), we decided to identify them as Mac. cf. anderssoni. The correct identification will be possible after the re-description of Mac. anderssoni on type material or on the specimens collected from the type locality. Macrobiotus anderssoni has also been reported from Greece and New Zealand (Horning et al. 1978; Maucci & Durante Pasa 1982). However, New Zealand specimens and eggs were re-examined by Pilato et al. (2006) and attributed to the Mac. hufelandi group. Greek individuals, based on the eggs with processes ended with a small terminal disc (Maucci & Durante Pasa 1982), should be also attributed to the hufelandi group. Thus, both the New Zealand and Greek reports, being so far from the type locality and in different ecozones, are incorrect. Macrobiotus anderssoni should be probably considered as restricted to Southern Argentina. Summarizing: the taxonomic position and distribution of Mac. anderssoni are very unclear and need further, more detailed taxonomic evaluation., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on pages 248-249, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Richters, F. (1908) Moosbewohner. Wissenschaftliche Ergebnisse der Schwedischen Sudpolar-Expedition (1901 - 1903) Stockholm, 6, 1 - 16.","Horning, D., Schuster, R. & Grigarick, A. (1978) Tardigrada of New Zealand. New Zealand Journal of Zoology, 5, 185 - 280.","Maucci, W. & Durante Pasa, M. V. (1982) Tardigradi della Grecia (secondo contributo), con particolare riferimento alla fauna dell'Isola di Creta. Bollettino del Museo Civico di Storia Naturale di Verona, 9, 479 - 488. http: // dx. doi. org / 10.1007 / s 00300 - 009 - 0684 - 4","Pilato, G., Binda, M. G. & Lisi, O. (2006) Eutardigrada from New Zealand, with descriptions of two new species. New Zealand Journal of Zoology, 33, 49 - 63. http: // dx. doi. org / 10.1080 / 03014223.2006.9518430"]}

Mesobiotus szeptyckii (Kaczmarek & Michalczyk, 2009 a) Localities and number of specimens. I (1 and 5 eggs), II (132, 28 exuviae and 51 eggs), III (34 and 50 eggs), XI (13 and 15 eggs), XII (5 and 1 egg), XIV (4 eggs), XV (5 and 4 eggs), XVIII (1 and 1 exuvium), XX (14 and 2 eggs), XXVI (6 and 1 egg) Remarks. This species, reported only from Argentina (Kaczmarek & Michalczyk 2009 a; Kaczmarek et al. 2015), belongs to Mes. harmsworthi group. Macrobiotus szeptyckii is extremely similar to Mes. tehuelchensis Rossi et al. 2009 described in the same year and from the same region, so these two species could be synonymous., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on page 250, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Kaczmarek, L. & Michalczyk, L. (2009 a) Two new species of Macrobiotidae, Macrobiotus szeptyckii (harmsworthi group) and Macrobiotus kazmierskii (hufelandi group) from Argentina. Acta Zoologica Cracoviensia, 52 B, 87 - 99. http: // dx. doi. org / 10.3409 / azc. 52 b _ 1 - 2.87 - 99","Rossi, G., Claps, M. & Ardohain, D. (2009) Tardigrades from northwestern Patagonia (Neuquen Province, Argentina) with the description of three new species. Zootaxa, 2095, 21 - 36."]}

Diphascon chilenense Plate, 1888 Localities and number of specimens. III (5 and 2 exuviae), VI (1), XIV (7) Remarks. In South America, species recorded from Argentina, Chile and Colombia (Kaczmarek et al. 2015)., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on page 248, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Plate, L. (1888) Beitrage zur Naturgeschichte der Tardigraden. Zoologische Jahrbucher Abteilung fur Anatomie und Ontogenie der Tiere, 3, 487 - 550. http: // dx. doi. org / 10.5962 / bhl. part. 1265"]}

Minibiotus pseudostellarus sp. nov. (Table 3, Figs 12–21) http://www.tardigrada.net/register/0023.htm Localities and number of specimens. VI (1), XIV (1), XXI (7 and 1 exuvium), XXV (5 and 1 exuvium) Material examined. Holotype (slide: 2306 / 3), 13 paratypes (slides: 1437 / 1, 1462 / 7, 1472 / 2 and 2306 / 2), two exuviae (slides: 1437 / 1 and 2306 / 3). Description (measurements and statistics in Table 3). Animals: Body length 241–320 µm (Fig. 12), white/ transparent after fixation. Eyes present in all specimens before and after fixation in Hoyer’s medium. Cuticle smooth with pores distributed randomly and not forming any specific design (Fig. 14). Generally two types of pores are present over the entire cuticle: round-shaped (0.3–0.9 µm in diameter) and in the shape of ‘pseudo-stars’ (i.e. not fully developed ‘stars’ but with 3–4 irregular ‘arms’ and poorly visible incisions) (0.6–2.5 µm distance from the farthest points of arms) (Fig. 14). Moreover, large star-shaped pores (with 5–6 ‘arms’) are present on legs (a single pore on leg I–III and two pores above legs IV (Figs 18–21). Pores around mouth absent. Bucco-pharyngeal apparatus of the Minibiotus type, with the ventral lamina and ten peribuccal papulae. Oral cavity armature absent or not visible under PCM. Pharyngeal bulb oval, with triangular apophyses (very near to first macroplacoid and ca. same size), three macroplacoids and small microplacoid. Macroplacoid length sequence 1 ≤ 2 Claws short and robust with obvious accessory points (Figs 15–17). Fine granulation only present on legs IV (Figs 16, 17). Cuticular bars under claws I–III present. Other cuticular thickenings on legs absent. Lunules under claws with smooth margins (Fig. 16). Eggs: Not found. Etymology. The new species is named after the characteristic pores on the cuticle—simulating (pseudo) stars (stellarum). Type locality. 41 ° 12 ’S, 71 ° 51 ’W, ca. 1,200 m asl: Río Negro, Nahuel Huapi National Park, Bariloche, at the foot of the Tronador volcano, Garganta del Diablo waterfall, moss from rock, 17.01. 2012, coll. Dawid Diduszko. Type depositories. Holotype, 12 paratypes and two exuviae are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Umultowska 89, 61–614 Poznań (Poland) and one paratype (slide 1472 / 2) is deposited at the Department of Entomology Institute of Zoology Jagiellonian University, Gronostajowa 9, 30–387, Kraków, Poland. Differential diagnosis. By the presence of star-like pores in the cuticle (on the legs), the new species is most similar to Min. constellatus Michalczyk & Kaczmarek 2003 b, Min. eichhorni Michalczyk & Kaczmarek 2004, Min. sidereus Pilato et al. 2003 and Min. vinciguerrae Binda & Pilato 1992, but it differs from all of them by the presence of ‘pseudo-stars’ instead of fully developed stars on dorsal and ventral cuticle. Additionally, new species differs specifically from: Minibiotus constellatus, only recorded from Peru (Michalczyk & Kaczmarek 2003 b), by absence of pores around the mouth, different arrangement of pores on the dorsal side of the body (randomly arranged pores in Min. pseudostellarus sp. nov. vs. two rows of pores along the main axis of the body in Min. constellatus), the presence of eyes, absence of granulation on legs I–III (granulation present on all legs in Min. constellatus), different macroplacoid sequence (1 ≤ 2 Min. pseudostellarus sp. nov. vs. 3 Min. constellatus), longer third macroplacoid (2.4 – 3.6 µm in Min. pseudostellarus sp. nov. vs. 1.4 – 1.9 µm in Min. constellatus), slightly longer macroplacoid row with higher pt (8.7 – 11.0 µm [35.5–38.9] in Min. pseudostellarus sp. nov. vs. 6.7 – 8.6 µm [25.0–35.4] in Min. constellatus). Minibiotus eichhorni, only recorded from Peru (Michalczyk & Kaczmarek 2004), by different arrangement of pores on the dorsal side of the body (randomly arranged pores in Min. pseudostellarus sp. nov. vs. pores arranged in six transverse bands in Min. eichhorni), absence of granulation on legs I–III (granulation present on all legs in Min. eichhorni), shorter external primary and secondary branches of claws III (5.6 – 7.1 µm and 4.4 – 5.5 µm respectively in Min. pseudostellarus sp. nov. vs. 7.6 – 11.4 µm and 5.7 – 8.6 µm in Min. eichhorni), higher pt of the buccal tube external width ([10.2–11.6] in Min. pseudostellarus sp. nov. vs. [6.9–9.7] in Min. eichhorni), a slightly higher pt of the second macroplacoid length ([9.3–11.3] in Min. pseudostellarus sp. nov. vs. [6.9–9.2] in Min. eichhorni), smaller pt of the external primary branches of claws II ([21.7–25.5] in Min. pseudostellarus sp. nov. vs. [26.9–33.3] in Min. eichhorni), smaller pt of the external primary branches of claws III ([22.7–26.8] in Min. pseudostellarus sp. nov. vs. [29.4–33.3] in Min. eichhorni), and smaller pt of anterior primary and secondary branches of claws IV ([26.6–31.7] and [19.1–22.4] in Min. pseudostellarus sp. nov. vs. [34.6–41.7] and [23.1–27.8] in Min. eichhorni, respectively). Minibiotus sidereus, only recorded from Ecuador (Pilato et al. 2003), by stylet supports inserted in a more posterior position ([65.6–68.8 in Min. pseudostellarus sp. nov. vs. [58.6–58.9] in Min. sidereus), a slightly higher pt of the second macroplacoid length ([9.3–11.3] in Min. pseudostellarus sp. nov. vs. [7.9–9.1] in Min. sidereus), longer macroplacoid row with higher pt (8.7–11.0 µm [35.5–38.9] in Min. pseudostellarus sp. nov. vs. 5.7–7.9 µm [26.6–29.9] in Min. sidereus) and longer placoid row with higher pt (10.4–13.0 µm [42.2–46.2] in Min. pseudostellarus sp. nov. vs. 6.4–9.6 µm [29.9–36.4] in Min. sidereus). Minibiotus vinciguerrae, only recorded from Antarctica (Binda & Pilato 1992), by the lack of oral cavity armature, absence of granulation on legs I–III, short and robust claws (long and slender in Min. vinciguerrae), different macroplacoid sequence (1 ≤ 2 Min. pseudostellarus sp. nov. vs. 2 Min. vinciguerrae), smaller body size (230–326 µm in Min. pseudostellarus sp. nov. vs. 380–520 µm in Min. vinciguerrae), shorter buccal tube (23.5–29.3 µm in Min. pseudostellarus sp. nov. vs. 35.1 µm in Min. vinciguerrae (in specimen 520 µm in length)), lower width of the buccal tube (2.5–3.3 µm in Min. pseudostellarus sp. nov. vs. 3.6 µm in Min. vinciguerrae (in specimen 520 µm in length)), smaller first and second macroplacoid (2.2–3.2 µm [8.9–10.9] and 2.3–3.3 µm respectively in Min. pseudostellarus sp. nov. vs. 4.4 µm [12.4] and 3.6 µm respectively in Min. vinciguerrae (in specimen 520 µm in length)), smaller microplacoid (1.1–1.5 µm in Min. pseudostellarus sp. nov. vs. 1.9 µm in Min. vinciguerrae (in specimen 520 in length)), shorter macroplacoid and placoid rows (8.7–11.0 and 10.4–13.0 µm respectively in Min. pseudostellarus sp. nov. vs. 13.1 and 15.39 µm in Min. vinciguerrae (in specimen 520 µm in length)) and smaller length and pt values of the external primary branches of claws II, III, IV (5.7–7.3 µm [21.7–25.5], 5.6–7.1 µm [22.7–26.8] and 6.7–8.9 µm [26.6–31.7] respectively in Min. pseudostellarus sp. nov. vs. (12.34 µm [35.1], 12.63 µm [35.9] and 14.6 µm [41.6] respectively in Min. vinciguerrae (in specimen 520 µm in length)).

Macrobiotus andinus Maucci, 1988 Localities and number of specimens. III (1 egg), VIII (1 egg), XXV (17, 2 exuviae and 11 eggs) Remarks. Our specimens correspond perfectly to the original description. This species has only been reported from Argentina and Chile (Maucci 1988; Binda & Pilato 1999)., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on page 249, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Maucci, W. (1988) Tardigrada from Patagonia (Southern South America) with description of three new species. Revista Chilena de Entomologia, 16, 5 - 13.","Binda, M. G. & Pilato, G. (1999) Macrobiotus erminiae, new species of eutardigrade from southern Patagonia and Tierra del Fuego. Entomologische Mitteilungen aus dem Zoologischen Museum Hamburg, 13, 151 - 158."]}

Mesobiotus philippinicus sp. nov. (Tables 4 ���6, Figs 1���51) Description of the new species. Animals (measurements and statistics in Table 4). Body white/transparent (Figs 1���2), eyes present (also in mounted individuals). Under PCM, cuticle appears completely smooth with no granulation visible (except in some specimens a very fine granulation barely detectable on legs IV). Under SEM, however, extremely fine granulation (microgranules, ca. 0.05 ��m in diameter) is visible on the entire dorso-lateral cuticle (Figs 3���5). The microgranulation is scattered evenly on most of the cuticle, but is denser to the caudo-dorsal region. Moreover, patches of dense, raised granule aggregates are present on external cuticle of all legs, above claws (Figs 6���9). These raised granule aggregates are ca. 0.2 ��m in diameter, and consist of two to over thirty microgranules, but more often between five and ten microgranules (Figs 7, 9). Patches on legs I���III are smaller (Figs 6���7) than those on legs IV (Figs 8���9). Cuticular pores absent. Bucco-pharyngeal apparatus of the Macrobiotus type (Fig. 10), with ten peribuccal lamellae. Oral cavity armature of the harmsworthi- type, composed of three bands of teeth visible in both PCM and SEM (Figs 10���16). The first band appears as small granules/cones placed just behind (sometimes also at the base) of the lamellae under PCM /SEM, respectively, and are arranged in 5���7 irregular rows (PCM: Figs 10���14; SEM: 15���16, filled arrowheads). Teeth in the second band (Figs 15���16, empty arrowheads) are intermediate in size between those of the first and third bands of teeth, and are in the shape of small ridges parallel to the longitudinal axis of the buccal tube (Figs 10���14). The second band is continuous with the teeth arranged in one row and are positioned in the posterior portion of the oral cavity just behind the ring fold (Figs 19���20, rhomboid) and just before the third band of teeth (Figs 15���16, marked ���L��� and ���M���). Situated posteriorly in the oral cavity just behind the second band of teeth and just before the buccal tube opening are the third band of teeth comprising three dorsal, distinctly separated, long and thin ridges (Fig 15 ���L��� and ���M���) and three to six ventral teeth: two lateral ridges (Fig 16 "L") and 2���4 round or oval median teeth (Fig 16 ���M 1���4 ���). Under PCM, the latero-ventral teeth are wing-shaped, thicker in their median portions (Figs 10���14), and under SEM are flat and serrated, with their height almost twice that of the teeth in the second band (Figs 15���16). Buccal tube rigid and slender with the ventral lamina (Fig 10). The pharyngeal bulb is equipped with pharyngeal apophyses, three macroplacoids and a microplacoid, all spaced equidistant from each other (Fig. 10 and the upper insert). The first and third macroplacoids are rod-shaped whereas the second macroplacoid is granular. The first macroplacoid is thinner anteriorly whereas the third macroplacoid has a sub-terminal constriction. The macroplacoid sequence is 2 Mesobiotus type, with a septum and well-developed accessory points (Figs 17���20). Lunules smooth in claws I���III (Figs 17���18) and lightly to moderately crenulated in claws IV (Figs 19���20). Lunules, connected to the claw with a peduncle, present in all claws (Fig. 17���20). Double W-shaped transverse bars under claws I���III (Fig. 17, filled arrowhead); a horseshoe-shaped structure connects anterior and posterior lunules IV (Fig. 19). Egg (measurements and statistics in Table 5). White, laid free, spherical in shape and equipped with conical to dome-shaped processes (Figs 21 ���32, 37��� 39). The processes are evenly spaced and exhibit considerable variability in size and shape between eggs: from low domes to high cones (Figs 21 ���24, 29���32, 37���39, 46��� 48). Process surface covered with wrinkles forming a rose-like whorl, clearly identifiable under SEM (Figs 40���48) but under PCM identifiable only as serration on an intersected process wall (Figs 30, 32). Very rarely processes have smooth walls (Fig. 31). The labyrinthine layer is visible under PCM as a reticulum in process walls, with mesh size varying considerably between eggs (Figs 33���35). Some processes are terminated with one to several short but thin and flexible portions, visible in both PCM (Figs 30���32, indented arrowheads) and in SEM (Figs 49���51), covered irregularly with small granules that are visible only in SEM (Figs 49���51). Small pores (0.3 ��m) are present on the bases of some processes and scattered across the inter-process surface. The pores are clearly visible in SEM (Figs 40���48) but only occasionally detectable under PCM (Figs 33���34, filled arrowheads). Egg surface clearly wrinkled, with wrinkles radiating out from the process bases, but not forming a connective network (Figs 33 ���36, 40��� 48). DNA sequences. A single haplotype was found for each sequenced marker across the eight analysed individuals, thus only one sequence per locus was deposited in the GenBank. The 18 S rRNA sequence (GenBank: KX 129793), 1690 bp long: TCTAAGTACTTGCTTTAACAAGGCGAAACCGCGAATGGCTCATTAAATCAGTTATGGTTCACTAGATCGTATATCCTACA CGGATAACTGAGGTAATTCTTCAGCTAATACGTGCTACAAGCTCGTTCCCTTGTGGAGCGAGCGCAGTTATTAGAACAAA ACCAATCCGGCCTTCGGGTCGGTTAAAATGGTGACTCTGAATAACCGAAGCGGAGCGTATGGTCTCGTACCGACGCCAGA TCTTTCAAGTGACTGCTCTATCAGCTTGTTGTTAGGTTATGCTCCTAACAAGGCTTCAACGGGTAACGGGGTATCAGGGT CCGATACCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCCAGCA CGGGGAGGTAGTGACGAAAAATAACGATGCGAGGGCATATTGCTTCTCGTAATCGGAATGGGTACACTTTAAATCCTTTA ACGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGC GGTTAAAAAGCTCGTAGTTGATCGTAGACGTAGGATGAGTGGTGCGCTTTCCGGCGCTACTGCTTGTTCCGACGTCAAAA GCCGGTCATGTCTTGCATATCCTTCACTGGGTGTGCTTGGCGGCCGGAGCGTTTACTTTGAAAAAATTAGAGTGCTCAAA GCAGGCGTACGGCCTTGCATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTATTTTGTTGGTTATCGGAGCTCG AGGTAATGATTAAGAGGAACAGACGGGGGCATTCGTATTGCGGCGTTAGAGGTGAAATTCTTGGATCGTCGCAAGACGCA CTACTGCGAAAGCATTTGCCAAGAATGTTTTCATTAATCAAGAACGAAAGTTAGAGGTTCGAAGGCGATCAGATACCGCC CTAGTTCTAACCATAAACGATGCCAACCAGCGATCCGCCGATGTTCTTTTGATGACTCGGCGGGCAGCTTCCGGGAAACC ACAAGTGCTTAGGTTCCGGGGGAAGTATGGTTGCAAAGCTGAAACTTAAAGGAATTGACGGAAGGGCACCACCAGGAGTG GAGCCTGCGGCTTAATTTGACTCAACACGGGAAAACTTACCCGGCCCGGACACTGTAAGGATTGACAGATTGAGAGCTCT TTCTTGATTCGGTGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGAACGA GACTCTAGCCTGCTAAATAGCCAACCGATCCGCAGCGTCGGTTGCTACAAAAGCTTCTTAGAGGGACAAGTGGCGTTTAG TCACATGAGATTGAGCAATAACAGGTCTGTGATGCCCTTAGATGTCCGGGGCCGCACGCGCGCTACACTGAAGGGATCAG CGTGCTTAATCGCCTTGCCCGGAAGGGCTGGGGAATCCGATTAAACCCCTTCGTGATTGGGATTGAGCTTTGTAATTATC GCTCATGAACGAGGAATTCCCAGTAGGCACGAGTCATAAGCTCGTGTCGATTAAGTCCCTGCCCTTTGTACACACCGCCC GTCGCTACTACCGATTGAACCCTTTAGTGAGGTCTTCAGACCGGCCGTGGCGGCAGACTTTGTCTGCAGCTCACAGGTTG GGAAGACGAC The 28 S rRNA sequence (GenBank: KX 129794), 755 bp long: CTGCGAGTGAAACGGGACCAGCCCATCGCCGAATCCTTTCTGGCAACAGTGAAGGAACTGTGGCGTGTAGAAGATGTCTG CCGGTGTGGTTAGTTTGCGTAAGTTCTCCTGAGTGAGACTCCATCCCATGGAGGGTGCAAGGCCCGTACCGCAAGCAGCT GATGCCGGTTAGCGTCTTTCGGAGAGTCGCCTTATTTGTGAGTATAAGGTGAAGTCGGTGGTAAACTCCATCGAAGGCTA AATATGGCCGCGCGTCCGATAGCGAACAAGTACCGTGAGGGAAAATTGAAAAGCACTTTGAAGAGAGAGCGAAACAGTGC GTGAAACGGCTCAGAGGCAAGCAGATGGGGCCTCGAAGGCAGAGCAGCGAATTCAGCCGGTAGTTTGTGCGGATGGCGGT TGTCGGGATCGTAAGACTCGGTGGCTGTCAGTGCTGTGTGTACAACTGCTGGTGCACTTTCGTTGCACGATACACAACCG CCGTTGAGCGAGCATCCGTTGAGCTGGCAGCGTGGAGCCTTATTCCCCTTAAAAAGGCATAGGTGCTTACAGCTGGCTTT AACGCGTTTGCGCCTCAACCGGTCAAGTCTATGTATGCCATGCTTCGGCAGTGGGACCGGCTTGCTCCGATTTGGCGTTA GGAATGACGACTTTGTCGGCTTCTTGGCGTTAGGTGGACTCGATGTCGGTTATCCACGTAGGCATATTGTTGATTCGGTT GTGAGTAGATGGCAGCCTATCTAACCCGTCTTGAA The ITS- 2 sequence (GenBank: KX 129795), 481 bp long: AGAACGCAGCAAGATGTGAGACGTAACTGGAATTGCAGGACTTGTGACAGTTTATTCTTCGAATGCAAATCGCGGCGTTG GGTTAACCGACGCCACGCCTGGTTGAGGGTCAGTTGAATTAAACAAATCATAGTCGCGCAATGATTATGGATTGTCTGAA CAGTGCGTCAAGCACTGGCAGATGAAGTACAGACCCCAGACGTTGAGTGTCATGCGTACCGCTGCTGGTGCGATTGACGT TATATGGGACTTGTGCCGCAGTTGCACAGTAAACAGTCTCATGCACGTCCGATCGGCAAGTCGGCCTCGCTGCACAACCG CTGTTAGCTATAGCGGTAAGCGATATAGCGTCTGTGTATAAAACGACGTTTGACAACAAGCGATCGATCGGTCAATTGCT CGACTAATCGTCGCACAATCGTCGGATACTTTTTCTTTTGACCTCAGCTCAGACGAGATTACCCGCTGAACTTAAGCATA T The COI sequence (GenBank: KX 129796), 763 bp long: TTTTTTTTTGGATTATGAGCAGCTACGGTAGGTACATCACTTAGAATAATCATTCGATTAGAGCTAAGACAACCTGGAAG ATTATTTAATGACGAACAATTCTATAATGTAGTTGTAACTAGACACGCATTTATTATAATTTTTTTTTTTGTTATACCTA TTCTGATCGGTGGATTTGGTAACTGACTAGTTCCACTTATACTAAATGCACCTGACATAGCATTTCCCCGAATAAATAAC CTAAGATTTTGATTACTTCCTCCATCTTTAATTTTAATTTTATCTAGTTCAATCGTAGAACAGGGTGCAGGCACCGGATG AACTGTTTATCCGCCCCTATCAAGATTTTTTGCGCATAGAGGACCTAGAGTCGACATAACCATTTTTTCCCTTCATGTAG CTGGAGCTTCCTCAATTCTTGGGGCTATCAACTTTATTACAACTATTTTAAACATACGAATACATAATATGACAATAGAA CTACTACCCCTATTTGTATGATCAGTTCTTCTTACTGCTATTTTATTGCTCTTATCCCTCCCTGTACTTGCAGGTGCAAT CACTATATTACTTTTAGATCGAAATTTTAACACCTCCTTTTTCGACCCAAGAGGAGGAGGAGACCCTATTCTATACCAAC ACTTATTTTGATTCTTCGGTCATCCCGAAGTCTATATTTTAATTCTTCCTGGGTTTGGAATTATTTCACAACTAATTATC CATTTCAGTGGAAAACATTTAACTTTCGGGCATATCGGAATGA Type locality. Locale: 14 �� 38 ' 54.4 "N, 121 ��04' 14.8 "E, 62 m a.s.l.: UP Science Park, near the Institute of Mathematics, University of the Philippines, Diliman, Quezon City, Philippines. Habitat: shady urban park. Substrate: moss on a tree trunk. Coll. Marc Mapalo, Maynard Gian Valdez, Rafael Fernando and Gamaliel Cabria. Etymology. The new species is named after the Philippines, where it was discovered and documented as the very first eutardigrade reported in the country. Type depositories. The holotype (slide PH.001.19), 15 paratypes and 18 eggs (slides PH.001.4���7, 10���11, 15��� 16, 20��� 22) are preserved at the Protein Structure and Immunology Laboratory of the National Institute of Molecular Biology and Biotechnology, University of the Philippines-Diliman, Quezon City, Philippines; 16 paratypes, 14 eggs and 15 chorions (slides PH.001.1���3, 8���9, 12���14, 17���18, 23��� 24) are preserved at the Department of Entomology, Institute of Zoology, Jagiellonian University, Krak��w, Poland., Published as part of Mapalo, Marc A., Stec, Daniel, Mirano-Bascos, Denise & Michalczyk, ��ukasz, 2016, Mesobiotus philippinicus sp. nov., the first limnoterrestrial tardigrade from the Philippines, pp. 411-426 in Zootaxa 4126 (3) on pages 414-422, DOI: 10.11646/zootaxa.4126.3.6, http://zenodo.org/record/258342

Mesobiotus pseudoblocki sp. nov. (Table 1 and 2, Figs 4���11) http://www.tardigrada.net/register/0022.htm Localities and number of specimens. IV (8 adults, 1 exuvium, 1 simplex and 3 eggs (one with embryo) Material examined. Holotype (slide 1476 / 6), seven paratypes (slides: 1476 / 2, 1476 / 3, 1476 / 4 and 1476 / 6), one exuvium (slide 1476 / 3), one simplex (slide 1476 / 6) and three eggs (slides 1476 / 1 and 1476 / 8). Description (measurements and statistics in Tables 1 and 2). Animals: Body length 270���470 ��m (Fig. 4), white in living specimens and transparent after fixation (Fig. 4). Eyes present in all specimens before and after fixation in Hoyer���s medium. Cuticle smooth, i.e. without gibbosities, papillae, spines or sculpturing; granulation on all legs absent. Bucco-pharyngeal apparatus of the Macrobiotus type, with the ventral lamina and ten peribuccal lamellae (Fig. 5). Mouth antero-ventral. Oral cavity armature of the harmsworthi type, with three bands of teeth (all visible under PCM) (Fig. 6). The first band of teeth is present as dots/granules situated at the anterior portion of the oral cavity, on the base of the peribuccal lamellae. The second band of teeth is composed of small ridges parallel to the main axis of the buccal tube, positioned at the rear of the oral cavity, behind the ring fold. The third band of teeth comprises three dorsal and three ventral teeth in the shape of crests, positioned just before the buccal tube opening. Pharyngeal bulb spherical, with triangular apophyses, three macroplacoids and a triangular microplacoid. Macroplacoid length sequence 2 hufelandi type (Figs 7���8). Primary branches with distinct accessory points. Lunules under claws on all legs smooth. Thin cuticular bars under claws I���III present. Other cuticular structures on legs absent. Eggs: Laid freely, white, spherical and ornamented (Figs 9���11). Processes in the shape of sharpened cones, elongated in the apical part, sometimes with bifurcated flexible tips and with single or few short filaments (Fig. 11). In the upper part of processes bubble-like structures are generally present (most typically about 2���5 bubbles), lower down the thick process wall has internal trabeculae that forms a reticulated structure. Around the base of the processes are an obvious crown of dots, which form very small, finger-like structures (Fig. 10). Surface between processes smooth, without areolation, pores or wrinkles (Fig. 10). Etymology. The name of the new species refers to its similarity to Mes. blocki. Type locality. 41 �� 12 ���S, 71 �� 50 ���W, ca. 1,000 m asl: R��o Negro, Nahuel Huapi National Park, Ventisquero Negro, a car parking near a small bar, Nothofagus forest, moss from tree, 27.01. 2006, coll. Łukasz Kaczmarek. Type depositories. Holotype, five paratypes, one exuvium, one simplex and three eggs are deposited at the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Umultowska 89, 61���614 Poznań (Poland) and two paratypes (slide 1476 / 4) are deposited at the collection of Binda and Pilato, Museum of the Department of Animal Biology ���Marcello La Greca���, University of Catania, Italy. Differential diagnosis. The eggs of the new species having processes in form of sharpened cones with bubbles and apical bifurcation are most similar to Mes. blocki (Dastych 1984). Differences between the species include in Mesobiotus pseudoblocki sp. nov. smooth lunules on IV pair of legs, the presence of reticular design in the lower parts of egg processes (sparsely distributed dots/ pores in Mes. blocki), the finger-like structures on the bases of egg processes poorly developed but well visible, which never form ���pseudo-areolation��� (very obvious and well developed in Mes. blocki, when connected forming characteristic ���pseudo-areolation���), smaller eggs with/ without processes (62.4���69.4/ 83.4���88.3 ��m in Mes. pseudoblocki sp. nov. vs. 70.0���90.0/ 90.0���130.0 ��m in Mes. blocki) and narrower bases of egg processes (5.8���7.6 ��m Mes. pseudoblocki sp. nov. vs. 8.0���14.0 ��m in Mes. blocki)., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on pages 250-252, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Dastych, H. (1984) The Tardigrada from Antarctica with description of several new species. Acta Zoologica Cracoviensia, 27, 377 - 436."]}

Diphascon mitrense Pilato, Binda & Qualtieri, 1998 Localities and number of specimens. V (2), XII (1) Remarks. Our specimens correspond perfectly to the original description. This is a second report for this species which has only been recorded from Argentina (Pilato et al. 1998)., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on page 248, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Pilato, G., Binda, M. G. & Qualtieri, F. (1998) Diphascon (Diphascon) mitrense, new species of eutardigrade from Tierra del Fuego. Bollettino delle sedute della Accademia Gioenia di Scienze Naturali in Catania, 31, 101 - 105."]}

Hypsibius convergens (Urbanowicz, 1925) Localities and number of specimens. V (2 and 1 exuvium), VI (1) Remarks. Hypsibius convergens sensu lato is a species complex (Kaczmarek & Michalczyk 2009 b) with an apparent global distribution (McInnes 1994), but in urgent need of re-description. Our specimens correspond well to the morphological characters proposed for this species by Miller et al. (2005)., Published as part of Roszkowska, Milena, Stec, Daniel, Ciobanu, Daniel Adrian & Kaczmarek, ��ukasz, 2016, Tardigrades from Nahuel Huapi National Park (Argentina, South America) with descriptions of two new Macrobiotidae species, pp. 243-260 in Zootaxa 4105 (3) on page 248, DOI: 10.11646/zootaxa.4105.3.2, http://zenodo.org/record/266164, {"references":["Urbanowicz, C. (1925) Sur la variabilite de Macrobiotus oberhaeuseri. Bulletin biologique de la France et de la Belgique, 59, 124 - 142.","Kaczmarek, L. & Michalczyk, L. (2009 b) Redescription of Hypsibius microps Thulin, 1928 and H. pallidus Thulin, 1911 (Eutardigrada: Hypsibiidae) based on the type material from the Thulin collection. Zootaxa, 2275, 60 - 68.","McInnes, S. J. (1994) Zoogeographic distribution of terrestrial / freshwater tardigrades from current literature. Journal of Natural History, 28, 257 - 352. http: // dx. doi. org / 10.1080 / 00222939400770131","Miller, W. R., McInnes, S. J. & Bergstrom, D. M. (2005) Tardigrades of the Australian Antarctic: Hypsibius heardensis (Eutardigrada: Hypsibiidae: dujardini group) a new species from sub-Antarctic Heard Island. Zootaxa, 1022, 57 - 64."]}