Search

Tyrosyl-DNA phosphodiesterase 1 (Tdp1) catalyzes the hydrolysis of phosphodiester bonds between the DNA 3'-phosphate and tyrosine residues and plays a major role in the repair of stalled topoisomerase I-DNA covalent complexes. Given this role, Tdp1 is of interest as a potential target for anticancer therapy. Inhibiting Tdp1 in combination with clinically used Top1 inhibitors may potentiate the effects of the latter and help to overcome some of the chemoresistance issues currently observed. In addition, Tdp1 can function during DNA repair to remove a variety of other 3' adducts from DNA such as phosphoglycolates and abasic or apurinic/apyrimidinic (AP) sites. Here we describe a new mix-and-read homogeneous fluorogenic assay for the measurement of the AP-site cleavage activity of Tdp1 that is compatible with high-throughput screening. The application of such an assay will open up further avenues for the discovery of novel Tdp1 inhibitors., (Copyright © 2013 Elsevier Inc. All rights reserved.)

Alkyltransferase-like (ATL) proteins in Schizosaccharomyces pombe (Atl1) and Thermus thermophilus (TTHA1564) protect against the adverse effects of DNA alkylation damage by flagging O(6)-alkylguanine lesions for nucleotide excision repair (NER). We show that both ATL proteins bind with high affinity to oligodeoxyribonucleotides containing O(6)-alkylguanines differing in size, polarity, and charge of the alkyl group. However, Atl1 shows a greater ability than TTHA1564 to distinguish between O(6)-alkylguanine and guanine and in an unprecedented mechanism uses Arg69 to probe the electrostatic potential surface of O(6)-alkylguanine, as determined using molecular mechanics calculations. An unexpected consequence of this feature is the recognition of 2,6-diaminopurine and 2-aminopurine, as confirmed in crystal structures of respective Atl1-DNA complexes. O(6)-Alkylguanine and guanine discrimination is diminished for Atl1 R69A and R69F mutants, and S. pombe R69A and R69F mutants are more sensitive toward alkylating agent toxicity, revealing the key role of Arg69 in identifying O(6)-alkylguanines critical for NER recognition.

Nucleotide excision repair (NER) has long been known to remove DNA lesions induced by chemical carcinogens, and the molecular mechanism has been partially elucidated. Here we demonstrate that in Schizosaccharomyces pombe a DNA recognition protein, alkyltransferase-like 1 (Atl1), can play a pivotal role in selecting a specific NER pathway, depending on the nature of the DNA modification. The relative ease of dissociation of Atl1 from DNA containing small O(6)-alkylguanines allows accurate completion of global genome repair (GGR), whereas strong Atl1 binding to bulky O(6)-alkylguanines blocks GGR, stalls the transcription machinery, and diverts the damage to transcription-coupled repair. Our findings redraw the initial stages of the NER process in those organisms that express an alkyltransferase-like gene and raise the question of whether or not O(6)-alkylguanine lesions that are poor substrates for the alkyltransferase proteins in higher eukaryotes might, by analogy, signal such lesions for repair by NER., (Copyright © 2012 Elsevier Inc. All rights reserved.)

Alkyltransferase-like proteins (ATLs) share functional motifs with the cancer chemotherapy target O(6)-alkylguanine-DNA alkyltransferase (AGT) and paradoxically protect cells from the biological effects of DNA alkylation damage, despite lacking the reactive cysteine and alkyltransferase activity of AGT. Here we determine Schizosaccharomyces pombe ATL structures without and with damaged DNA containing the endogenous lesion O(6)-methylguanine or cigarette-smoke-derived O(6)-4-(3-pyridyl)-4-oxobutylguanine. These results reveal non-enzymatic DNA nucleotide flipping plus increased DNA distortion and binding pocket size compared to AGT. Our analysis of lesion-binding site conservation identifies new ATLs in sea anemone and ancestral archaea, indicating that ATL interactions are ancestral to present-day repair pathways in all domains of life. Genetic connections to mammalian XPG (also known as ERCC5) and ERCC1 in S. pombe homologues Rad13 and Swi10 and biochemical interactions with Escherichia coli UvrA and UvrC combined with structural results reveal that ATLs sculpt alkylated DNA to create a genetic and structural intersection of base damage processing with nucleotide excision repair.

Highlights: [•] Sequential cellular events occur rapidly in rat colons following AOM. [•] The sequence of events is AOM-dose and O 6meG adduct-load dependent. [•] Apoptosis is an early response and follows a close relationship to O 6meG. [•] Higher O 6meG and completion of MGMT activity is required for inducing apoptosis. [•] Apoptosis may be triggered by O 6meG and act as a complementary mechanism to MGMT. [Copyright &y& Elsevier]

Abstract: Topoisomerases regulate DNA topology by the transient cleavage and religation of DNA during transcription and replication. Topoisomerase II (Topo II) poisons such as etoposide can induce abortive DNA strand breaks in which Topo II remains covalently bound to a 5′ DNA strand terminus via a phosphotyrosyl linker. Tyrosyl DNA phosphodiesterase 2 (Tdp2) is a recently discovered human 5′-tyrosyl DNA phosphodiesterase that repairs this topoisomerase-mediated DNA damage, thereby playing a central role in maintaining normal DNA topology in cells. Cellular depletion of Tdp2 has been shown to result in increased susceptibility and sensitivity to Topo II-induced DNA double-strand breaks, thereby revealing Tdp2 as a potentially attractive anticancer target. No drug-like inhibitors of Tdp2 have been identified to date, and assays suitable for high-throughput screening (HTS) have not been widely reported. Here we have identified a new and effective chromogenic substrate for Tdp2 and developed a homogeneous and robust HTS assay. A second novel Tdp2 assay was also developed to cross-validate hit matter identified from an HTS. In addition, a new and specific Tdp2 antibody is described. Together, these new tools will aid in the identification of novel Tdp2 inhibitors and the investigation of the role of Tdp2 in cancer. [Copyright &y& Elsevier]

Abstract: Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n =51) and cancer free controls (n =88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTɛAGCGGGTACCGAGCTCGAAT; ɛA =ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21±1.67fmol/μg DNA/h vs 3.47±1.35fmol/μg DNA/h, p =0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway. [Copyright &y& Elsevier]

Many chemoradiation therapies cause DNA damage through oxidative stress. An important cellular mechanism that protects cells against oxidative stress involves DNA repair. One of the primary DNA repair mechanisms for oxidative DNA damage is base excision repair (BER). BER involves the tightly coordinated function of four enzymes (glycosylase, apurinic/apyrimidinic endonuclease, polymerase and ligase), in which 8-oxoguanine DNA glycosylase 1 initiates the cycle. An imbalance in the production of any one of these enzymes may result in the generation of more DNA damage and increased cell killing. In this study, we targeted mitochondrial DNA to enhance cancer chemotherapy by over-expressing a human 8-oxoguanine DNA glycosylase 1 (hOGG1) gene in the mitochondria of human hepatoma cells. Increased hOGG1 transgene expression was achieved at RNA, protein and enzyme activity levels. In parallel, we observed enhanced mitochondrial DNA damage, increased mitochondrial respiration rate, increased membrane potential and elevated free radical production. A greater proportion of the hOGG1-over-expressing hepatoma cells experienced apoptosis. Following exposure to a commonly used chemotherapeutic agent, cisplatin, cancer cells over-expressing hOGG1 displayed much shortened long-term survival when compared with control cells. Our results suggest that over-expression of hOGG1 in mitochondria may promote mitochondrial DNA damage by creating an imbalance in the BER pathway and sensitize cancer cells to cisplatin. These findings support further evaluation of hOGG1 over-expression strategies for cancer therapy. [ABSTRACT FROM PUBLISHER]

The recently discovered enzyme tyrosyl-DNAphosphodiesterase 2(TDP2) has been implicated in the topoisomerase-mediated repair ofDNA damage. In the clinical setting, it has been hypothesized thatTDP2 may mediate drug resistance to topoisomerase II (topo II) inhibitionby etoposide. Therefore, selective pharmacological inhibition of TDP2is proposed as a novel approach to overcome intrinsic or acquiredresistance to topo II-targeted drug therapy. Following a high-throughputscreening (HTS) campaign, toxoflavins and deazaflavins were identifiedas the first reported sub-micromolar and selective inhibitors of thisenzyme. Toxoflavin derivatives appeared to exhibit a clear structure–activityrelationship (SAR) for TDP2 enzymatic inhibition. However, we observeda key redox liability of this series, and this, alongside early in vitrodrug metabolism and pharmacokinetics (DMPK) issues,precluded further exploration. The deazaflavins were developed froma singleton HTS hit. This series showed distinct SAR and did not displayredox activity; however low cell permeability proved to be a challenge. [ABSTRACT FROM AUTHOR]

Highlights: [•] Geographical variation in susceptibility to alkylating agents in lung investigated. [•] MGMT repair increased towards the lung periphery. [•] Smoking may reduce MGMT repair in central but not peripheral lung tissue. [•] Alkylating agent exposure (N7-meG levels) not related to lung position. [•] No evidence peripheral lung more susceptible to genotoxic alkylating agents. [Copyright &y& Elsevier]

Gene transfer into hematopoietic stem cells (HSC) has promise as a treatment for many inherited and acquired disorders. Drug resistance genes can be transferred into HSC either for providing protection against chemotherapy-induced myelosuppression or for selecting HSCs that are concomitantly transduced with another gene for correction of an inherited disorder. The DNA repair protein O6- methylguanine-DNA-methyltransferase (MGMT) protects cells from alkylating chemotherapeutic agents such as Temozolomide or BCNU (1,2-bis(2-chloroethyl)-1-nitrosourea). We have shown to in vivo studies in transplantation experiments. previously that retroviral expression in bone marrow of a mutant MGMT (MGMTP140K), which is resistant to inactivators of the wild-type protein, combined with an inactivator/alkylating agent therapy, provides a powerful selective tool and protection of the transduced bone marrow in vivo.It has been reported previously that abundant expression of MGMT without drug selection might be disadvantageous to hematopoietic cells. To allow regulated functionality of MGMT, a 4-hydroxytamoxifen (4-OH-T) inducible MGMT(P140K) was constructed by fusing a mutated version of the mouse estrogen receptor (ERT) to the C-terminus of MGMT(P140K). The ERT is transcriptionally inactive and unable to bind estrogen yet retains normal affinity for the synthetic ligand 4-OH-T, which effects the transport of the fusion protein from cytoplasm to nucleus. The MGMT(P140K)-ERT fusion and a marker gene were integrated into the pSF91 retroviral backbone (from C. Baum). The human erythroleukaemic cell line K562 was transduced and the expression of the fusion protein was confirmed by western blot analysis. Cell free extracts of the transduced K562 cell lines were analysed in a methyl-group transfer assay. The extracts of the parental K562 cells showed no quantifiable MGMT activity whereas high specific activity was detectable in the MGMT(P140K)-ERT transduced cell line. Kinetic experiments showed that the MGMT(P140K)-ERT fusion protein has a slightly slower rate of methyl-group transfer than the non-fusion MGMT(P140K). The negative effect of MGMT(P140K) overexpression in the absence of drug selection was reduced by the ERT-fusion as shown by growth analysis of the cell populations respectively. It is currently under evaluation whether the ERT/4- OH-T system allows a cytoplasm to nuclear translocation of the MGMT(P140K) protein after induction with 4-OH-T in K562 cells. In parallel we are investigating if MGMT(P140K)-ERT confers drug resistance (Temozolomide, BCNU) to K562 cells after 4-OH-T treatment in a proliferation assay. In addition, the average number of retroviral integration occurrences and the average quantity of MGMT(P140K) protein in the K562 cell lines will be determined.Vectors will be taken forward into in vitro studies in murine primary hematopoietic cells, prior to in vivo studies in transplantation experiments.Molecular Therapy (2006) 13, S258–S258; doi: 10.1016/j.ymthe.2006.08.746 [ABSTRACT FROM AUTHOR]