Search

To compare the clinicopathological characteristics and survival outcomes of children and adult diagnosed with medullary thyroid carcinoma (MTC). MTC patients were extracted from the Surveillance, Epidemiology and End Results (SEER) database from 1998 to 2016, followed by stratification into pediatric (P P = 0.015); (OS: HR 5.63, 95% CI 2.08–15.25, P = 0.001)]. Further stratified analysis indicated that pediatric group might have significant better CSS and OS for patients with more advanced stage. Patients in the pediatric group were more likely to have earlier stage. Moreover, the prognosis of pediatric MTC patients was significantly better than that in adult patients.

Objective:To explore whether and how group cognitive-behavioural therapy (GCBT) plus medication differs from medication alone for the treatment of generalised anxiety disorder (GAD).Methods:Hundred and seventy patients were randomly assigned to the GCBT plus duloxetine (n=89) or duloxetine group (n=81). The primary outcomes were Hamilton Anxiety Scale (HAMA) response and remission rates. The explorative secondary measures included score reductions from baseline in the HAMA total, psychic, and somatic anxiety subscales (HAMA-PA, HAMA-SA), the Hamilton Depression Scale, the Severity Subscale of Clinical Global Impression Scale, Global Assessment of Functioning, and the 12-item Short-Form Health Survey. Assessments were conducted at baseline, 4-week, 8-week, and 3-month follow-up.Results:At 4 weeks, HAMA response (GCBT group 57.0% vs. control group 24.4%,p=0.000, Cohen’sd=0.90) and remission rates (GCBT group 21.5% vs. control group 6.2%,p=0.004;d=0.51), and most secondary outcomes (allpd=0.36−0.77) showed that the combined therapy was superior. At 8 weeks, all the primary and secondary significant differences found at 4 weeks were maintained with smaller effect sizes (pd=0.32−0.48). At 3-month follow-up, the combined therapy was only significantly superior in the HAMA total (pd=0.43) and HAMA-PA score reductions (pd=0.77). Logistic regression showed superiority of the combined therapy for HAMA response rates [odds ratio (OR)=2.12, 95% confidence interval (CI) 1.02−4.42,p=0.04] and remission rates (OR=2.80, 95% CI 1.27−6.16,p=0.01).Conclusions:Compared with duloxetine alone, GCBT plus duloxetine showed significant treatment response for GAD over a shorter period of time, particularly for psychic anxiety symptoms, which may suggest that GCBT was effective in changing cognitive style.

Enzymes are very important for biological processes in a living being, performing similar or multiple tasks in and out of cells, tissues and other organisms at a particular location. The abnormal activity of particular enzyme usually caused serious diseases such as Alzheimer’s disease, Parkinson’s disease, cancers, diabetes, cardiovascular diseases, arthritis etc. Hence, nondestructive and real-time visualization for certain enzyme is very important for understanding the biological issues, as well as the drug administration and drug metabolism. Fluorescent cellular probe-based enzyme detection in vitro and in vivo has become broad interest for human disease diagnostics and therapeutics. This review highlights the recent findings and designs of highly sensitive and selective fluorescent cellular probes targeting enzymes for quantitative analysis and bioimaging.

This study aimed to explore the association of tumor sidedness with the prognosis of patients with colon signet ring cell carcinoma (SRCC). Eligible patients were retrieved from the Surveillance, Epidemiology, and End Results database between 2004 and 2015. Cancer-specific survival (CSS) and overall survival (OS) were compared between patients with left-sided colon SRCC and those with right-sided lesions. A total of 2660 patients were included, among them, 1983 (74.5%) had right-sided colon SRCC. Compared to patients with left-sided colon SRCC, those who had the right-sided colon SRCC showed higher proportion of white race, female, aged ≥ 65 years, receiving total colectomy and ≥ 4 regional lymph node dissection; while had lower proportion of advanced AJCC stage. Besides, right-sided patients exhibited superior 5-year CSS (32.74% vs. 25.89%, P = 0.001) and OS (27.38% vs. 23.02%, P = 0.024) rates compared with left-sided ones. Multivariate analysis revealed that tumor sidedness was an independent prognostic factor. To be specific, patients with right-sided colon SRCC showed better CSS (HR: 0.873; 95% CI 0.777–0.981; P = 0.023) and OS (HR: 0.838; 95% CI 0.753–0.965; P = 0.002). Moreover, subgroup analysis demonstrated superior CSS and OS for right-sided patients in most subgroups. Tumor sidedness was an independent prognostic indicator for colon SRCC. Besides, patients with right-sided colon SRCC have superior prognosis than those with left-sided lesions.

This study aimed to assess the benefit of postoperative adjuvant chemotherapy in stage II–III colorectal signet ring cell carcinoma (SRCC). Qualified postoperative patients were extracted from Surveillance, Epidemiology, and End Results (SEER) database from 2004 until 2015. We collected 1675 patients in the research, and 936 patients were subjected to adjuvant chemotherapy group. The proportions of married status, male, rectal cancer, grade III/IV, AJCC stage III and radiotherapy were higher; While, the rates of white race, ≥ 65 years old and located in cecum–transverse colon were lower in patients of chemotherapy group compared to no chemotherapy group (all P P P = 0.93). However, after adjusting for confounding factors by multivariable Cox regression analysis, receipt of postoperative chemotherapy was still associated with better CSS and OS (CSS: hazard ratio [HR] = 0.719, 95% CI 0.612–0.844, P P

Objectives The survival benefit of postmastectomy radiotherapy (PMRT) has not been fully proven in inflammatory breast cancer (IBC). Thus, in the present research, we aimed at elucidating the effects of PMRT on the survival of IBC patients. Methods Eligible patients were collected from the Surveillance, Epidemiology, and End Results (SEER) dataset between 2010 and 2013. The Kaplan-Meier method along with the log-rank test was utilized for the comparison of both the overall survival (OS) andthe cancer-specific survival (CSS) in patients undergoing PMRT or not. Additionally, multivariate survival analysis of CSS and OS were performed using the Cox proportional hazard model. Results In total, 293 eligible cases were identified, with the median follow-up time of 27 months (range: 5–59 months). After propensity score matching (PSM), 188 patients (94 for each) were classified intothe No-PMRT and the PMRT group. Consequently, significantly higher OS rates were detected in the PMRT group compared with the No-PMRT group prior to PSM (P = 0.034), and significantly higher CSS (P = 0.013) and OS (P = 0.0063) rates were observed following PSM. Furthermore, multivariate analysis revealed thatPMRT [CSS (HR: 0.519, 95% CI [0.287–0.939], P = 0.030); OS (HR: 0.480, 95% CI [0.269–0.859], P = 0.013)], as well as Her2+/HR+ subtype, was independent favorable prognostic factors.Besides, black ethnicity, AJCC stage IV and triple-negative subtype were independent unfavorable prognostic factors. Further subgroup analysis revealed that most of the study population could benefit from PMRT, no matter OS or CSS. Conclusions Our findings support that PMRT could improve the survival of IBC patients.

In the study, a tunable dual-band terahertz hybrid metamaterial absorber was designed and explored. The proposed hybrid metamaterial absorber was composed of an Au ring, an Au cross structure and vanadium dioxide (VO2) films incorporated at the four ends of the cross structure. Theoretical simulation results showed that the hybrid metamaterial exhibited dual-frequency resonances. The low-frequency resonance was ascribed to the ring, whereas the high-frequency resonance was ascribed to the cross structure. The resonant frequencies of the hybrid metamaterial absorber could be tuned by changing the effective length of electrically resonant cross structure through triggering the insulator–metal phase transition of the VO2 at the four ends of the cross structure.

Effective monitoring and assessment of geohazard risks to long-haul oil and gas pipelines is essential to reduce pipeline accidents and mitigate the resulting human casualties and economic losses. Oil and gas pipelines are often “accompanied” by telecommunications fiber-optic infrastructure deployed along them for communications purpose; the possibility of repurposing unused (so-called dark) fiber as distributed sensor arrays offers exciting opportunities for the development of pipeline risk monitoring systems. Here, we present a multiparameter approach to monitor pipeline geohazards using distributed fiber-optic sensing—including distributed strain, temperature, and acoustic sensing—deployed on telecommunications dark fiber network. Through a series of field experiments on a pipeline telecommunications cable crossing hilly terrain, we demonstrated the feasibility of using multiple cores of a single telecom cable to obtain multiparametric information on the strain, temperature, and vibration. The recorded strain signatures, temperature variations, and vibration signals can be indicative of various disastrous events during geohazards development, such as ground movement, soil erosion, oil and gas leakage, and rockfall. Additionally, we established a preliminary model that allows the synergistic use of the acquired multiparametric data. Overall, our results suggest that preexisting networks of fiber-optic telecommunications infrastructure accompanying pipelines could be leveraged as sensing resources to monitor geohazard risks to pipelines. Deeper fusion of multidimensional data and multiparametric information will enable intelligent monitoring, identification, and assessment of a wide range of pipeline threats.

Supplemental Digital Content is available in the text, Background: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. Methods: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. Results: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each

// Ling Cao 1, * , Yong-Jing Yang 1, * , Jian-Dong Diao 2 , Xu-He Zhang 1 , Yan-Ling Liu 1 , Bo-Yu Wang 1 , Zhi-Wen Li 3 and Shi-Xin Liu 1 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun 130012, People’s Republic of China 2 Department of Oncology, China-Japan Friendship Hospital Affiliated Jilin University, Changchun 130012, People’s Republic of China 3 Department of Anesthesiology, The First Hospital of Jilin University, Changchun, Jilin, 130021, People’s Republic of China * These authors contributed equally to this work Correspondence to: Shi-Xin Liu, email: liushixin1964@sina.com Zhi-Wen Li, email: prince00111@hotmail.com Keywords: zoledronic acid, bone metastasis, dose interval, skeletal-related events, meta-analysis Received: April 21, 2017 Accepted: July 18, 2017 Published: August 03, 2017 ABSTRACT Zoledronic acid is used to treat patients with bone metastasis, but the optimal dosing interval remains controversial. We therefore performed a systematic review and meta-analysis to compare the efficacy and safety of a 12-week interval of zoledronic acid with the standard 4-week interval. Three randomized controlled trials comprising 2650 patients were analyzed. Using a random-effects model, pooled risk ratios (RRs) and 95% confidence intervals (CIs) were calculated. No differences in the occurrence of skeletal-related events (SREs: RR = 0.98; 95% CI = 0.86–1.12; P = 0.80) or grade 3/4 adverse events (RR = 0.91; 95% CI = 0.69–1.20; P = 0.52) were observed between the 12-week and 4-week groups. The 12-week group tended to have lower incidences of osteonecrosis of the jaw [13 (0.98%) vs. 23 (1.73%)] and kidney dysfunction [21 (1.68%) vs. 31 (2.45%)] than the 4-week group, though the difference did not reach statistical significance (RR = 0.58, 95% CI: 0.30–1.12; P = 0.11); (RR = 0.67, 95% CI: 0.39–1.15, P = 0.15). These data show that zoledronic acid administered at 12-week intervals instead of 4-week intervals does not increase the risk of SREs, and may reduce the incidence of osteonecrosis of the jaw and kidney dysfunction. This suggests the 12-week interval with zoledronic acid may be an acceptable treatment option.

In the pipeline construction, the girth welds tend to be the weakness because of defects and microstructural heterogeneities. The importance of suitable assessment of various defects in the weld is not only to prevent the cracks from unstable growth to cause catastrophic accident but also can effectively reduce the weld repair to reduce construction cost. Although many welding defects assessment methods and codes have been applied in this field, there are many differences among them. In this paper, the application of weld defect assessment methods was extensively studied. The key points of ECA applications, such as the pipeline axial stress and toughness, have been introduced. Furthermore, some suggestions were given on the application of girth weld ECA assessment.

// Ling Cao 1 , Yong-Jing Yang 1 , Zhi-Wen Li 2 , Hong-Fen Wu 1 , Zhu-Chun Yang 1 , Shi-Xin Liu 1 , Ping Wang 3 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun 130012, People’s Republic of China 2 Department of Anesthesiology, The First Hospital Affiliated to Jilin University, Changchun 130012, People’s Republic of China 3 Department of Radiotherapy, Cancer Institute and Hospital of Tianjin Medical University, Tianjin 300060, People’s Republic of China Correspondence to: Shi-Xin Liu, email: liushixin1964@sina.com Ping Wang, email: wangping.99999@yahoo.com.cn Keywords: prostatic neoplasms, hypofractionation, radiotherapy, meta-analysis Received: August 08, 2016 Accepted: November 24, 2016 Published: December 01, 2016 ABSTRACT To compare the efficacy and safety of moderate hypofractionated radiotherapy (H-RT) with those of conventional radiotherapy (C-RT) in patients with localized prostate cancer, we conducted extensive literature searches of The Web of Science, Embase, Pubmed and Cochrane Library databases. We identified nine studies with 5969 patients for a meta-analysis. We calculated pooled risk ratios (RRs) and the 95% confidence intervals (CIs) for multiple parameters and performed statistical analysis using RevMan 5.3 software. Our analysis showed that the H-RT group obtained greater improvements in the 5-year biochemical or clinical failure-free survival (RR = 1.04, 95% CI:1.01–1.08; P = 0.01) and 5-year disease-free survival(RR = 1.04, 95% CI: 1.01–1.07, P = 0.02) than the C-RT group. However, the 5-year overall survival rates were comparable in the two groups (RR = 1.02, 95% CI: 0.99–1.04; P = 0.18). Comparison of multiple secondary parameters, including grade 2-4 acute/late gastrointestinal toxicity, grade 2–4 acute/late genitourinary toxicity, biochemical failure, local failure, distant failure and prostate cancer-specific mortality between the H-RT and the C-RT groups showed no statistical differences. This meta-analysis thus indicates that in patients with localized prostate cancer, moderate H-RT exerts a great beneficial effect on the primary parameters than C-RT without enhancing adverse events.

ObjectiveThe study was designed to construct and validate a nomogram for predicting overall survival (OS) of male breast cancer (MBC) patients with infiltrating duct carcinoma (IDC).MethodsThe cohort was selected from the Surveillance, Epidemiology, and End Results (SEER) database between January 1, 2004 and December 31, 2013. Univariate and multivariate Cox proportional hazard (PH) regression models were performed. A nomogram was developed based on the significant prognostic indicators of OS. The discriminatory and predictive capacities of nomogram were assessed by Harrell’s concordance index (C-index), calibration plots, area under the curve (AUC) and the decision curve analysis (DCA).ResultsThe median and maximal survival time of 1862 eligible patients were 49 and 131 months, respectively. Multivariate analysis showed that age (P P = 0.002), T stage (P P = 0.021), M stage (P P = 0.046), human epidermal growth factor receptor-2 (HER2) (P = 0.009), and chemotherapy (P = 0.003) were independent prognostic indicators of IDC of MBC. The eight variables were then combined to construct a 3-and 5-year nomogram. The C-indexes of the nomogram were0.740 (95% confidence interval [CI] [0.709–0.771]) and 0.718 (95% CI [0.672–0.764]) for the internal validation and external validation, respectively. A better discriminatory capacity was observed in the nomogram compared with the SEER summary stage (P P ConclusionsThe nomogram was able to more accurately predict 3-and 5-year OS of MBC patients with IDC histology than were existing models.

// Yong-Jing Yang 1, * , Ling Cao 1, * , Zhi-Wen Li 2 , Ling Zhao 1 , Hong-Fen Wu 1 , Dan Yue 1 , Jin-Lei Yang 1 , Zhi-Rui Zhou 3 , Shi-Xin Liu 1 1 Department of Radiation Oncology, Cancer Hospital of Jilin Province, Changchun, 130012, People’s Republic of China 2 Department of Anesthesiology, The First Hospital Affiliated to Jilin University, Changchun, 130012, People’s Republic of China 3 Department of Radiation Oncology, Fudan University Shanghai Cancer Center, Shanghai, 200032, People’s Republic of China * These authors contribute equally to this work Correspondence to: Shi-Xin Liu, email: liushixin1964@126.com Zhi-Rui Zhou, email: zzr3711@163.com Keywords: rectal neoplasms, neoadjuvant chemoradiotherapy, oxaliplatin, meta-analysis Received: March 06, 2016 Accepted: June 03, 2016 Published: June 14, 2016 ABSTRACT To measure the safety and efficacy of oxaliplatin (OX) application in neoadjuvant chemoradiotherapy (CRT) for locally advanced rectal cancer (LARC), EMBASE, PubMed, Cochrane Library, and Web of Science were used for a literature search. Cochrane’s risk of bias tool of randomized controlled trials (RCTs) was used for quality evaluation. The statistical analyses were performed using RevMan 5.3. In addition, 95% confidence intervals (CIs) and pooled risk ratios (RRs) were calculated. Seven RCTs were included in our meta-analysis. After adding OX to fluoropyrimidine (FU), a marginal significant improvement in disease-free survival was noted compared with FU alone (RR = 0.89, 95% CI: 0.78–1.00; P = 0.05). Neoadjuvant CRT with OX significantly decreased the distant metastasis rate (RR = 0.79, 95% CI: 0.67–0.94, P = 0.007). However, no improvement in the local recurrence rate (RR = 0.86, 95% CI: 0.68–1.08; P = 0.19) was noted. In addition, neoadjuvant CRT with OX also significantly increased the pathologic complete response (RR = 1.24, 95% CI: 1.02–1.51; P = 0.03). Grade 3–4 acute toxicity and grade 3–4 diarrhea was considerably higher for OX/FU compared with FU alone. In conclusion, the use of OX on the basis of FU/capecitabine in preoperative CRT is feasible. LARC patients are likely to benefit from CRT regimens with OX.

BackgroundThis study was designed to investigate the clinicopathological characteristics, treatment and survival of patients with pulmonary large cell neuroendocrine carcinoma (LCNEC).MethodsThe Surveillance, Epidemiology and End Results database was utilized to identify patients diagnosed with pulmonary LCNEC between 2004 and 2013. Kaplan–Meier analysis was conducted to determine the overall survival (OS) and cancer-specific survival (CSS) rate. Univariate survival analysis along with log-rank test, and Cox proportional hazards model were employed to detect independent prognostic factors.ResultsPulmonary LCNEC accounted for 0.58% (2972/510607) of the total number of lung and bronchus carcinoma. And a total of 1,530 eligible cases were identified, with the median follow-up time of 11 months. To be specific, the 3-, 5-year OS and CSS rates were 22.8%, 16.8% and 26.5%, 20.8% respectively. Generally, pulmonary LCNEC was commonly detected in the elderly (72.2%), males (55.9%), the upper lobe (62.0%) and advanced AJCC stage (65.5%). Multivariate analysis revealed that elderly [(≥60 and P= 0.007; (≥80 years) HR:1.530, 95% CI [1.238–1.891],P< 0.001] and advanced AJCC stage [(stage III) HR:2.606, 95% CI [2.083–3.260],P< 0.001; (stage IV) HR:4.881, 95% CI [3.923–6.072],P< 0.001] were independent unfavorable prognostic factors, and that female (HR:0.845, 95% CI [0.754–0.947],P= 0.004)), surgery [(Segmentectomy/wedge resection) HR:0.526, 95% CI [0.413–0.669],P< 0.001; (Lobectomy/Bilobectomy) HR:0.357, 95% CI [0.290–0.440],P< 0.001;(Pneumonectomy) HR:0.491, 95% CI [0.355–0.679],P< 0.001] , chemotherapy (HR:0.442, 95% CI [0.389–0.503],P< 0.001) and radiation (HR:0.837, 95% CI [0.738–0.949],P= 0.005) were independent favorable prognostic factors.ConclusionTo sum up, age at diagnosis, sex, AJCC 8th edition stage, surgery, chemotherapy and radiation were significantly associated with OS of patients with pulmonary LCNEC.

The current study presents a rare case of an accessory spleen that manifested as a solid intrasplenic pseudotumor. The affected patient was previously healthy. Upon examination with computed tomography (CT), an ovoid, soft-tissue mass of ~4.1 cm in diameter was found on the upper pole of the spleen. Biochemical indices, such as blood routine and coagulation tests, and tumor marker analysis, revealed no abnormalities. Another CT scan was performed, but this failed to indicate whether the mass was benign or malignant. Therefore, the lesion was resected along with the spleen by laparoscopic surgery. The resected sample was subject to pathological examinations for final validation, and was finally diagnosed as an accessory spleen. The patient was followed up for six months with no signs of recurrence.

BACKGROUND The aim of this study was to evaluate the effects of topical ropivacaine anesthesia on hemodynamic responses during intubation and extubation of hypertensive patients. MATERIAL AND METHODS One hundred fifty patients with hypertension ASA II-III were scheduled for noncardiac operations. Patients were divided into 3 groups: a control group receiving 5 ml saline, and 2 groups receiving topical anesthesia with 100 mg lidocaine or 37.5 mg ropivacaine. Hemodynamic responses, including blood pressure and heart rate (HR), were recorded at baseline (T0), before intubation (T1), during tracheal intubation (T2), 2 min after intubation (T3), upon eye opening on verbal commands (T4), during tracheal extubation (T5), and 2 min after extubation (T6). Patients were injected with urapidil 5 mg during intubation and extubation if their systolic blood pressure (SBP) was ≥160 mmHg or diastolic blood pressure (DBP) was ³90 mmHg, and esmolol 10 mg when HR was ≥90 bpm. RESULTS During extubation, the total dosages of urapidil and esmolol were significantly higher in the saline than in the lidocaine or ropivacaine groups, and were significantly lower in the ropivacaine than in the lidocaine group. At T2, SBP, SBP, MAP, and HR were lower in the lidocaine and ropivacaine groups than in the saline group, but the differences were not significant. From T4 to T6, SBP, DBP, MAP, and HR were significantly lower in the ropivacaine group than in the other 2 groups (P

In order to evaluate the effect of different doses of penehyclidine hydrochloride (penehyclidine) on heart rate (HR) and HR variability (HRV) in hysteroscopy, 180 patients (American Society of Anesthesiologists grade I-II) were randomized equally to three groups: 0.5 mg penehyclidine and intravenous anesthesia (group I), 1.0 mg penehyclidine and intravenous anesthesia (group II) and saddle anesthesia combined with intravenous anesthesia (control group). HR and HRV, including total power (TP), low-frequency power (LF), high-frequency power (HF) and the LF to HF ratio (LF/HF), were recorded prior and subsequent to the induction of anesthesia (T0 and T1, respectively), following the start of surgery (T2) and following completion of surgery (T3). HR was lower at T2 than at T0 in the control patients, but no differences were observed in groups I and II. The HR at T2 was increased in group II compared with that in group I. TP in group II was significantly higher compared with that in group I at T2. At T1 and at T2, the LF and HF values were lower in group I than those in the controls. Patients in group II also had higher LF and HF at T2 than patients in group I. The HF was higher at T2 than that at T0 in the controls; however, the HF and LF did not change significantly within groups I and II. No significant differences were observed in the LF/HF ratio among the three groups. At a dose of 0.5 mg, penehyclidine stabilized HRV and did not alter the autonomic nervous modulation of HR. A penehyclidine dose of 1.0 mg may be superior to a dose of 0.5 mg in maintaining HR, but is less effective at balancing sympathetic and parasympathetic activity.

Feed rate is a very important factor of layered manufacturing as it effects build time, support structure, dimensional accuracy, surface finish and cost of the object. The changing of feeding flow affects layer manufacturing greatly. We use servomotor to control the feeding powder rate of feeding powder machine and important parameter accurately. To determine the control of feeding change, we need to understand the mode of feeding powder machine and the delay time. Furthermore, we also need to understand the and transient state mode of the beginning and ending points and synchronization of feeding powder machine to achieve the effective control of feeding powder.