Search

We demonstrate for the first time a fast aptamer generation method based on the screen-printed electrodynamic microfluidic channel device, where a specific aptamer selectively binds to a target protein on channel walls, following recovery and separation. A malaria protein as a model target, Plasmodium vivax lactate dehydrogenase (PvLDH) was covalently bonded to the conductive polymer layer formed on the carbon channel walls to react with the DNA library in a fluid. Then, the AC electric field was symmetrically applied on the channel walls for inducing the specific binding of the target protein to DNA library molecules. In this case, the partitioning efficiency between PvLDH and DNA library in the channel was attained to be 1.67 × 107 with the background of 5.56 × 10-6, which was confirmed using the quantitative polymerase chain reaction (qPCR). The selectively captured DNAs were isolated from the protein and separated in situ to give five aptamers with different sequences by one round cycle. The dissociation constants (Kd) of the selected aptamers were determined employing both electrochemical impedance spectroscopy (EIS) and the fluorescence method. The sensing performance of each aptamer was evaluated for the PvLDH detection after individual immobilization on the screen-printed array electrodes. The most sensitive aptamer revealed a detection limit of 7.8 ± 0.4 fM. The sensor reliability was evaluated by comparing it with other malaria sensors.

Well-ordered bioreceptors on atomically flat Au surfaces can be a high-performance biosensor. Cardiac troponin I proteins (cTnIs) have been regarded as a specific biomarker for acute myocardial infarction (AMI). Here, we report the accurate detection of cTnIs using an aptamer-immobilized Au nanoplate platform. The single-crystalline and atomically flat Au nanoplate was characterized by atomic force microscopy. For the precise detection of cTnI, we immobilized an aptamer that can strongly bind to cTnI onto an atomically flat Au nanoplate. Using the aptamer-immobilized Au nanoplate, cTnIs were successfully detected at a concentration of 100 aM (2.4 fg/mL) in buffer solution. Furthermore, cTnIs in serum could be identified at a concentration of 100 fM (2.4 pg/mL). The total assay time was ~7 h. Importantly, the aptamer-immobilized Au nanoplate enabled us to diagnose AMI patients accurately, suggesting the potential of the present method in the diagnosis of AMI.

In this study, we proposed a new G-quadruplex (GQ)-based fluorescent aptasensor using one-shot detection of NS1 for dengue fever diagnosis. To design the aptasensor, Dengue virus-derived NS1-binding aptamer (DBA) that forms a GQ structure was developed. The DBA underwent structural destruction induced by nonstructural protein 1 (NS1), then we aimed to utilize it for optical sensing. Fluorescent detection of the NS1-dependent structural change was performed by applying a fluorescent dye; 6-carboxyfluorescein (FAM) was attached to the 5' end of DBA (5' FAM-DBA). The 5' FAM-DBA could quantitatively detect the fluorescence quenching caused by guanines upon NS1 binding, which was feasible for dengue fever diagnosis. We analyzed to understand the structural and fluorescent characteristics that are involved in the interaction between NS1 and DBA. The results suggested that the central G-tracts were rearranged to adjacent toward the FAM, and that the structure of 5' FAM-DBA bound to NS1 was expected to form base-pairing. Finally, the aptasensor with 5’ FAM-DBA was established after optimization, which contributed to the effective and rapid detection. The aptasensor achieved low detection limits of 2.51 nM in buffer and 8.13 nM in serum. Additionally, it was verified the high specificity using other proteins including yellow fever proteins, and it has the potential to overcome the cross-reactivity with other flaviviruses. Also, the stability of the DF aptasensor was confirmed to give practical usability. Here, we developed a novel GQ-based fluorescent aptasensor for rapid and simple dengue fever diagnosis, which could provide the possibility for use in practical applications.

Electrochemical biosensors using five anticancer drug and lipid molecules attached on the conducting polymer layer to obtain the orientation of drug molecules toward cancer cells, were evaluated as sensing materials and their performances were compared. Conjugation of the drug molecules with a lipid, phosphatidylcholine (PC) has enhanced the sensitivity towards leukemia cells and differentiates cancer cells from normal cells. The composition of each layer of sensor probe was confirmed by electrochemical and surface characterization experiments. Both impedance spectroscopy and voltammetry show the enhanced interaction of leukemia cells using the drug/lipid modified sensor probe. As the number of leukemia cells increased, the charge transfer resistance (R ct ) in impedance spectra increased and the amine oxidation peak current of drug molecules in voltammograms decreased at around 0.7–1.0 V. Of test drug molecules, raltitrexed (Rtx) showed the best performance for the cancer cells detection. Cancer and normal cell lines from different origins were examined to evaluate the degree of expression of folate receptors (FR) on cells surface, where cervical HeLa cell line was found to be shown the highest expression of the receptor. Impedance and chronoamperometric experiments for leukemia cell line (Jurkat E6-1) showed linear dynamic ranges of 1.0×10 3 –2.5×10 5 cells/mL and 1.0×10 3 –8.0×10 3 cells/mL with detection limits of 68±5 cells/mL and 21±3 cells/mL, respectively.

Interleukin-17 receptor A (IL-17RA) has been recognized as a valuable biomarker for diverse diseases, including autoimmune diseases. In this work, an electrochemical biosensor with great sensitivity and selectivity toward IL-17RA was fabricated using an IL-17RA aptamer (Kd=14.00nM) for the first time. The aptasensor was manufactured using electrodeposition of gold nanoparticles, and then quantitative detection of IL-17RA was performed based on impedimetry. The developed sensor exhibited a superior analytical performance for IL-17RA with a wide dynamic range of 10-10,000pg/mL in buffer and a detection limit of 2.13pg/mL, which is lower than that of commercially available ELISA kits. In addition, we validated the high specificity of the designed aptasensor to only IL-17RA, which showed good sensitivity even in human serum solution. Furthermore, the detection of the differentiated HL-60 cells expressing IL-17RA was successfully performed. Clinical applicability of the sensor was also demonstrated utilizing neutrophils separated from asthma patients. It is expected that the fabricated aptasensor will become an excellent diagnostic platform for IL-17RA-mediated diseases.

In this study, we synthesized dual aptamer-modified silica nanoparticles that simultaneously target two types of breast cancer cells: the mucin 1 (MUC1)(+) and human epidermal growth factor receptor 2 (HER2)(+) cell lines. Dual aptamer system enables a broad diagnosis for breast cancer in comparison with the single aptamer system. The dye-doped silica nanoparticles offer great stability with respect to photobleaching and enable the accurate quantification of breast cancer cells. The morphological and spectroscopic characteristics of the designed Dual-SiNPs were demonstrated via diverse methods such as DLS, zeta potential measurements, UV-vis spectroscopy, and fluorescence spectroscopy. Negatively charged Dual-SiNPs with a homogeneous size distribution showed robust and strong fluorescence. In addition, Dual-SiNPs did not affect cell viability, implying that this probe might be readily available for use in an in vivo system. Through ratio optimization of the MUC1 and HER2 aptamers, the binding capacities of the Dual-SiNPs to both cell lines were maximized. Based on Dual-SiNPs, a highly sensitive quantification of breast cancer cells was performed, resulting in a detection limit of 1 cell/100 μL, which is significantly lower compared with those reported in other studies. Moreover, the developed detection platform displayed high selectivity for only the MUC1(+) and HER2(+) cell lines. It is expected that this valuable diagnostic probe will be a noteworthy platform for the diagnosis and prognosis of breast cancer.

Although various studies related to nanoparticles-based photothermal therapy have been actively performed, an epoch-making photothermolysis therapy exhibiting both high selectivity and efficiency has yet not been discovered. For the first time, we have developed novel valuable therapeutic complexes, namely, dual aptamer-modified gold nanostars, for the targeting of prostate cancers, including PSMA(+) and PSMA(−) cells. The synthesized probes were characterized through several techniques, including UV-VIS spectral analysis, DLS analysis, zeta potential measurements, and TEM imaging, and were subsequently subjected to cytotoxicity tests, cell uptake confirmation, and in vitro photothermal therapy. The homogeneously well-fabricated nanostars presented high selectivity to prostate cancer cells and extremely high efficiency for therapy using an 808 nm laser under an irradiance of 0.3 W cm−2, which is lower than the permitted value for skin exposure (0.329 W cm−2). It is anticipated that this novel photothermal agent will become the general platform for targeted therapy.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

Single-molecule trajectory analysis has suggested DNA repair proteins may carry out a one-dimensional (1D) search on naked DNA encompassing >10,000 nucleotides. Organized cellular DNA (chromatin) presents substantial barriers to such lengthy searches. Using dynamic single-molecule fluorescence resonance energy transfer, we determined that the mismatch repair (MMR) initiation protein MutS forms a transient clamp that scans duplex DNA for mismatched nucleotides by 1D diffusion for 1 s (~700 base pairs) while in continuous rotational contact with the DNA. Mismatch identification provokes ATP binding (3 s) that induces distinctly different MutS sliding clamps with unusual stability on DNA (~600 s), which may be released by adjacent single-stranded DNA (ssDNA). These observations suggest that ATP transforms short-lived MutS lesion scanning clamps into highly stable MMR signaling clamps that are capable of competing with chromatin and recruiting MMR machinery, yet are recycled by ssDNA excision tracts.

The ability of MutS to recognize mismatched DNA is required to initiate a mismatch repair (MMR) system. ATP binding and hydrolysis are essential in this process, but their role in MMR is still not fully understood. In this study, steady-state ATPase activities of MutS from Escherichia coli were investigated using the spectrophotometric method with a double end-blocked heteroduplex containing gapped bases. The ATPase activities of MutS increased as the number of gapped bases increased in a double end-blocked heteroduplex with 2-8 gapped bases in the chain, indicating that MutS dissociates from DNA when it reaches a scission during movement along the DNA. Since movement of MutS along the chain does not require extensive ATP hydrolysis and the ATPase activity is only enhanced when MutS dissociates from a heteroduplex, these results support the sliding clamp model in which ATP binding by MutS induces the formation of a hydrolysis-independent sliding clamp.

A fluorescent method was developed for the detection of unpaired and mismatched DNAs using a MutS-fluorophore conjugate. The fluorophore, 2-(4'-(iodoacetoamido)anilino) naphthalene-6-sulfonic acid (IAANS), was site-specifically attached to the 469 position of Thermus aquaticus (Taq.) MutS mutant (C42A/T469C). The fluorophore labeled residue located at the dimer interface of the protein undergoes a drastic conformational change upon binding with mismatched DNA. The close proximity of the two identical fluorescent molecules presumably causes the self-quenching of the fluorophore, since fluorescence emission of the biosensor decreases with increasing concentrations of mismatched DNA. The order of binding affinity for each unpaired and mismatched DNA obtained by this method was DeltaT (Kd=52 nM)>GT (62 nM)>DeltaC (130 nM)>CT (160 nM)>DeltaG (170 nM)>DeltaA (250 nM)>CC (720 nM)>AT (950 nM). This order is comparable to the previous results of the gel mobility shift assay. Thus, this method can be a simple, useful tool for elucidating the mechanism of DNA mismatch repair as well as a novel probe for detecting of genetic mutation.

To develop a general method for the detection of histidine-tagged proteins, the interactions of the histidine epitope tag of MutH and MutL proteins with the epitope specific monoclonal anti-His6 antibody were monitored by a label-free direct method using impedance spectroscopy. The immunosensor was fabricated by covalent coupling of the antibody on a conducting polymer coated electrode surface. The impedance of the antibody modified electrode was decreased after binding to the histidine-tagged proteins. The specificity of the sensor was demonstrated by showing that no impedance change was occurred when the sensor was exposed to both of non-tagged MutH and MutL proteins. The specific interaction was further characterized using quartz crystal microbalance studies. Based on impedance measurements, the linear ranges were obtained from 50.0 to 125.0 and 50.0 to 250.0 micorg/ml, for His-tag MutH and His-tag MutL proteins, respectively. The detection limits were determined to be 37.8 and 59.1 microg/ml, for His-tag MutH and His-tag MutL proteins, respectively.

It is well known that the engrailed-2 (EN2) protein, a biomarker for prostate cancer, strongly binds to a specific DNA sequence (5'-TAATTA-3') to regulate transcription. Based on this intrinsic property, DNA probes with additional flanked sequences were designed and optimized. Various measurements, such as electrophoresis mobility shift assay, surface plasmon resonance, and quantitative fluorescence assay were performed to investigate the feasibility of the DNA probes. Then, the affinities of the DNA probes to the target protein were quantitatively determined using FAM-modified DNA probes and magnetic beads, resulting in dissociation constants ranging from 61.03 to 98.84nM. To develop an early diagnosis platform for prostate cancer, an ultrasensitive electrochemical biosensor based on the electrodeposition of gold nanoparticles was designed. The EN2 protein was quantitatively detected using the electrochemical biosensor, and the calculated detection limit was found to be 5.62fM. Finally, the specificity and applicability of the biosensor were verified using several proteins and an artificial urine medium. The impedance signals increased in the cases of EN2, suggesting that the system exhibited high selectivity to only EN2.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/μl for PDDA and 74 parasites/μl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

A rapid, homogeneous, and in-situ labelable format designed to detect single nucleotide polymorphism (SNP) is presented. Fluorescent silver nanoclusters produced following hydride-mediated reduction of Ag(+) bound to a partial double-stranded oligodeoxynucleotide were employed as probes for SNPs. The sensing mechanism is based on the fluorescence enhancement of silver nanoclusters through an irreversible cluster transfer upon hybridization. The key element of our design is modulating the "turn on" mechanism by introducing a competitor that can be displaced in response to a target DNA. In a controlled model system, the fluorescence intensity of silver nanoclusters is approximately 3-fold enhanced upon hybridization with a perfectly matched target DNA, and single-base mismatch detection is achieved within 5min, regardless of the position of mismatches. Human aldehyde dehydrogenase 2 (ALDH2), which is responsible for the oxidation of aldehydes to carboxylic acids, is then utilized as a target for SNP. Upon addition of a perfectly matched sequence, dramatically enhanced fluorescence intensity is observed (ca. 48-fold), and prompt SNP genotyping is accomplished.

An acedan derivative containing Zn(II)–DPA has been developed as a two-photon probe for nucleoside phosphates, which shows enhanced fluorescence toward ATP and ADP at physiological pH 7.4 among other competing anions including AMP; the probe is permeable to cell membranes and thus can be directly used for two-photon imaging of ATP and ADP in live cells.

We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

DNA binding by MutL homologs (MLH/PMS) during mismatch repair (MMR) has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA) binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET) and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D) = 29 nM) while it dramatically decreases above 100 mM (K(D)>2 µM). Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

An amperometric chloramphenicol (CAP) immunosensor was fabricated by covalently immobilizing anti-chloramphenicol acetyl transferase (anti-CAT) antibody on cadmium sulfide nanoparticles (CdS) modified-dendrimer that was bonded to the conducting polymer (poly 5, 2′: 5′, 2″-terthiophene-3′-carboxyl acid (poly-TTCA)) layer. The AuNPs, dendrimers, and CdS nanoparticles were deposited onto the polymer layer in order to enhance the sensitivity of the sensor probes. The particle sizes were determined using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The immobilization of dendrimers, CdS, and anti-CAT were confirmed using energy disruptive spectroscopy (EDS), X-ray photoelectron spectroscopy (XPS), and quartz crystal microbalance (QCM) techniques. The detection of CAP was based on the competitive immuno-interaction between the free- and labeled-CAP for active sites of the anti-CAT. Hydrazine was used as the label for CAP, and it electrochemically catalyzed the reduction of H2O2 at −0.35 V vs. Ag/AgCl. Under optimized conditions, the proposed immunosensor exhibited a linear range of CAP detection between 50 pg/mL and 950 pg/mL, and the detection limit was 45 pg/mL. The immunosensor was examined in real meat samples for the analysis of CAP.

The effect of wild-type and mutant MutL on the steady-state ATPase activity of MutS from Escherichia coli has been investigated in the absence and presence of 22, 50, and 75 base pair hetero- and homoduplex DNAs with open and blocked ends. The steady-state ATPase activity of MutS has been measured at 37 degrees C using a spectrophotometric method. The presence of MutL did not affect appreciably on the ATPase activity of MutS in the absence of DNA or in the presence of blocked end homoduplex DNAs. However, the addition of MutL affected oppositely on the ATPase activity of MutS in the presence of G-T mismatched DNAs depending on their end status. We have also found that only the ATPase active forms of MutL increased the ATPase activity of MutS in the presence of G-T mismatched DNAs with blocked ends. The results suggest that MutL ATPase activity is required to catalyze dissociation of the MutS sliding clamps.

Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.

A simple, direct method for the detection of DNA-protein interaction was developed with electrochemical methods. Single-stranded DNA (ss-DNA) probes were prepared through the chemical bonding of an oligonucleotide to a polymer film bearing carboxylic acid groups, and double-stranded DNA (ds-DNA) probes were prepared through hybridization of the complementary sequence DNA on the ss-DNA probe. Impedance spectroscopy and differential pulse voltammetry (DPV) distinguished the interaction between the DNA probes with mouse Purbeta (mPurbeta), an ss-DNA binding protein, and with Escherichia coli MutH, a ds-DNA binding protein. Impedance spectra obtained before and after the interaction of DNA probes with these proteins clearly showed the sequence-specific ss-DNA preference of mPurbeta and the sequence-specific ds-DNA preference of MutH. The concentration dependence of proteins on the response of the DNA probes was also investigated, and the detection limits of MutH and mPurbeta were 25 and 3 microg/ml, respectively. To confirm the impedance results, the variation of the current oxidation peak of adenine of the DNA probe was monitored with DPV. The formation constants of the complexes formed between the probe DNA and the proteins were estimated based on the DPV results.

MutL stimulates the DNA duplex unwinding activity of UvrD in methyl-directed DNA mismatch repair (MMR) via their physical interactions. However, the molecular functions of MutL associated with the DNA binding and UvrD helicase have been partially understood. We present the kinetic characteristics of the single-stranded DNA (ssDNA) binding activity of MutL in the absence or the presence of UvrD helicases using the single-molecule techniques. The lengthening of the ssDNA due to the ssDNA binding of MutL allows us to observe association and dissociation of MutL from the ssDNA in real-time. In this study, we demonstrate that the nonspecific ssDNA binding of MutL can be involved in subsequent loading of UvrD helicases onto the ssDNA in a manner independent of ATP hydrolysis of MutL.

The crystal structure of the DNA heptamer d(GCGCGCG) has been solved at 1.65 A resolution by the molecular replacement method and refined to an R-value of 0.184 for 3598 reflections. The heptamer forms a Z-DNA d(CGCGCG)2 with 5'-overhang G residues instead of an A-DNA d(GCGCGC)2 with 3'-overhang G residues. The overhang G residues from parallel strands of two adjacent duplexes form a trans reverse Hoogsteen G x G basepair that stacks on the six Z-DNA basepairs to produce a pseudocontinuous helix. The reverse Hoogsteen G x G basepair is unusual in that the displacement of one G base relative to the other allows them to participate in a bifurcated (G1)N2 . . . N7(G8) and an enhanced (G8)C8-H . . . O6(G1) hydrogen bond, in addition to the two usual hydrogen bonds. The 5'-overhang G residues are anti and C2'-endo while the 3'-terminal G residues are syn and C2'-endo. The conformations of both G residues are different from the syn/C3'-endo for the guanosine in a standard Z-DNA. The two cobalt hexammine ions bind to the phosphate groups in both GpC and CpG steps in Z(I) and Z(II) conformations. The water structure motif is similar to the other Z-DNA structures.

The crystal structure of the alternating 5'-purine start decamer d(GCGCGCGCGC) was found to be in the left-handed Z-DNA conformation. Inasmuch as the A.T base pair is known to resist Z-DNA formation, we substituted A.T base pairs in the dyad-related positions of the decamer duplex. The alternating self-complementary decamer d(GCACGCGTGC) crystallizes in a different hexagonal space group, P6(1)22, with very different unit cell dimensions a = b = 38.97 and c = 77.34 A compared with the all-G.C alternating decamer. The A.T-containing decamer has one strand in the asymmetric unit, and because it is isomorphous to some other A-DNA decamers it was considered also to be right-handed. The structure was refined, starting with the atomic coordinates of the A-DNA decamer d(GCGGGCCCGC), by use of 2491 unique reflections out to 1.9-A resolution. The refinement converged to an R value of 18.6% for a total of 202 nucleotide atoms and 32 water molecules. This research further demonstrates that A.T base pairs not only resist the formation of Z-DNA but can also assist the formation of A-DNA by switching the helix handedness when the oligomer starts with a 5'-purine; also, the length of the inner Z-DNA stretch (d(CG)n) is reduced from an octamer to a tetramer. It may be noted that these oligonucleotide properties are in crystals and not necessarily in solutions.

It has been studied that DNA repair proteins search a target via a 1-dimensional diffusion along naked DNA. Due to the absence of the target on DNA this single-molecule tracking approach lacked of understanding the catalytic function of the repair proteins and moreover the mechanism of the downstream transactions for the repair of an error on the DNA. We present the catalytic processes of MutS, mismatch repair initiation protein, on a mismatched DNA that bears an unpaired nucleotide. Our single-molecule analysis reveals that MutS undergoes two distinct conformational changes during DNA mismatch repair (MMR). MutS forms a transient clamp that scans duplex DNA for the unpaired nucleotide and a different sliding clamp that is induced by ATP binding to the mismatch-bound MutS with unusual stability on DNA. These observations suggest a mechanism of how MMR machinery can be recruited for the strand incision, which is highly controversial.