Search

We demonstrate for the first time a fast aptamer generation method based on the screen-printed electrodynamic microfluidic channel device, where a specific aptamer selectively binds to a target protein on channel walls, following recovery and separation. A malaria protein as a model target, Plasmodium vivax lactate dehydrogenase (PvLDH) was covalently bonded to the conductive polymer layer formed on the carbon channel walls to react with the DNA library in a fluid. Then, the AC electric field was symmetrically applied on the channel walls for inducing the specific binding of the target protein to DNA library molecules. In this case, the partitioning efficiency between PvLDH and DNA library in the channel was attained to be 1.67 × 107 with the background of 5.56 × 10-6, which was confirmed using the quantitative polymerase chain reaction (qPCR). The selectively captured DNAs were isolated from the protein and separated in situ to give five aptamers with different sequences by one round cycle. The dissociation constants (Kd) of the selected aptamers were determined employing both electrochemical impedance spectroscopy (EIS) and the fluorescence method. The sensing performance of each aptamer was evaluated for the PvLDH detection after individual immobilization on the screen-printed array electrodes. The most sensitive aptamer revealed a detection limit of 7.8 ± 0.4 fM. The sensor reliability was evaluated by comparing it with other malaria sensors.

The soluble interleukin-2 receptor α (sIL-2Rα) is a broad indicator of clinical disease activity in various inflammatory diseases. Here we have developed, for the first time, a rapid, washing-free colorimetric aptasensor based on a sIL-2Rα aptamer (Kd =1.33 nm). The aptasensor was fabricated with Au nanoparticles (AuNPs) adsorbing sIL-2Rα aptamers. On addition of sIL-2Rα, the aptamers become desorbed from the AuNPs, and this in turn weakens the absorption corresponding to AuNP-catalyzed oxidation of ortho-phenylenediamine (oPD) with H2 O2 . The aptasensor was characterized by TEM imaging, ζ potential measurements, dynamic light scattering (DLS) analysis, and UV/Vis spectrometry, followed by further optimization. The fabricated sensor exhibited great analytical performance, with a linear range of 1 to 100 nm and a detection limit of 1 nm both in buffer and in spiked human serum within 25 min. Other proteins, such as bovine serum albumin (BSA), IL-17Rα, IL-5Rα, IL-13Rα2 , and CD166, showed negligible effects on the aptasensor. Thanks to the great advantages of the aptamers and AuNPs, this aptasensor provides a rapid, simple, and inexpensive process that might offer insights into various diagnostic applications of sIL-2Rα.

The development of a multiplexed sensing platform is necessary for highly selective, sensitive, and rapid screening of specific antibiotics. In this study, we designed a novel multiplex aptasensor for antibiotics by fluorescence resonance energy transfer (FRET) strategy using DNase I-assisted cyclic enzymatic signal amplification (CESA) method combined with aptamer/graphene oxide complex. The aptamers specific for sulfadimethoxine, kanamycin, and ampicillin were conjugated with Cyanine 3 (Cy3), 6-Carboxyfluorescein (FAM), and Cyanine 5 (Cy5), respectively, and graphene oxide (GO) was adopted to quench the fluorescence of the three different fluorophores with the efficiencies of 94.36%, 93.94%, and 96.97% for Cy3, FAM, and Cy5, respectively. CESA method was used for sensitive detection, resulting in a 2.1-fold increased signal compared to those of unamplified method. The aptasensor rapidly detected antibiotics in solution with limit of detection of 1.997, 2.664, and 2.337 ng/mL for sulfadimethoxine, kanamycin, and ampicillin, respectively. In addition, antibiotics dissolved in milk were efficiently detected with similar sensitivities. Multiplexed detection test proved that the fluorescently modified aptamers could work separately from each other. The results indicate that the aptasensor offers high specificity for each antibiotic and enables simultaneous and multicolor sensing for rapid screening of multiple antibiotics at the same time.

Well-ordered bioreceptors on atomically flat Au surfaces can be a high-performance biosensor. Cardiac troponin I proteins (cTnIs) have been regarded as a specific biomarker for acute myocardial infarction (AMI). Here, we report the accurate detection of cTnIs using an aptamer-immobilized Au nanoplate platform. The single-crystalline and atomically flat Au nanoplate was characterized by atomic force microscopy. For the precise detection of cTnI, we immobilized an aptamer that can strongly bind to cTnI onto an atomically flat Au nanoplate. Using the aptamer-immobilized Au nanoplate, cTnIs were successfully detected at a concentration of 100 aM (2.4 fg/mL) in buffer solution. Furthermore, cTnIs in serum could be identified at a concentration of 100 fM (2.4 pg/mL). The total assay time was ~7 h. Importantly, the aptamer-immobilized Au nanoplate enabled us to diagnose AMI patients accurately, suggesting the potential of the present method in the diagnosis of AMI.

In this study, we proposed a new G-quadruplex (GQ)-based fluorescent aptasensor using one-shot detection of NS1 for dengue fever diagnosis. To design the aptasensor, Dengue virus-derived NS1-binding aptamer (DBA) that forms a GQ structure was developed. The DBA underwent structural destruction induced by nonstructural protein 1 (NS1), then we aimed to utilize it for optical sensing. Fluorescent detection of the NS1-dependent structural change was performed by applying a fluorescent dye; 6-carboxyfluorescein (FAM) was attached to the 5' end of DBA (5' FAM-DBA). The 5' FAM-DBA could quantitatively detect the fluorescence quenching caused by guanines upon NS1 binding, which was feasible for dengue fever diagnosis. We analyzed to understand the structural and fluorescent characteristics that are involved in the interaction between NS1 and DBA. The results suggested that the central G-tracts were rearranged to adjacent toward the FAM, and that the structure of 5' FAM-DBA bound to NS1 was expected to form base-pairing. Finally, the aptasensor with 5’ FAM-DBA was established after optimization, which contributed to the effective and rapid detection. The aptasensor achieved low detection limits of 2.51 nM in buffer and 8.13 nM in serum. Additionally, it was verified the high specificity using other proteins including yellow fever proteins, and it has the potential to overcome the cross-reactivity with other flaviviruses. Also, the stability of the DF aptasensor was confirmed to give practical usability. Here, we developed a novel GQ-based fluorescent aptasensor for rapid and simple dengue fever diagnosis, which could provide the possibility for use in practical applications.

Patients with pancreatic and colorectal cancers have elevated levels of activated leukocyte cell adhesion molecule (ALCAM) in their blood compared to healthy individuals. To this end, sensitive detection of soluble fraction of ALCAM (sALCAM), also called CD166, was performed using enzyme-linked antibody aptamer (ELAA) assay. For the assay, aptamer specific for sALCAM was used as a capturing probe and polyclonal antibody modified with an enzyme was used as a detecting probe for colorimetric visualization. The ELAA assay was able to detect sALCAM as low as 0.31 ng/mL. In addition, the assay enabled the differentiation of sALCAM from other proteins in buffer as well as in human serum. The ELAA assay provides cost-effective, highly sensitive, and reproducible detection of sALCAM.

In this study, we developed a sandwich aptamer-based screen-printed carbon electrode (SPCE) using chronoamperometry for the detection of cardiac troponin I (cTnI), one of the promising biomarkers for acute myocardial infarction (AMI). Disposable three-electrode SPCEs were manufactured using a screen printer, and various modifications such as electrodeposition of gold nanoparticles and electropolymerization of conductive polymers were performed. From the bare electrode to the aptamer-immobilized SPCE, all processes were monitored and analyzed via various techniques such as cyclic voltammetry, electrochemical impedance spectroscopy, and X-ray photoelectron spectroscopy. The quantification of cTnI was conducted based on amperometric signals from the catalytic reaction between hydrazine and H 2 O 2 . The fabricated aptasensor in a buffer, as well as in a serum-added solution, exhibited great analytical performance with a dynamic range of 1–100 pM (0.024–2.4 ng/mL) and a detection limit of 1.0 pM (24 pg/mL), which is lower than the existing cutoff values (40–700 pg/mL). Furthermore, the developed sensor showed high sensitivity to cTnI over other proteins. It is anticipated that this potable SPCE aptasensor for cTnI will become an innovative diagnostic tool for AMI.

Interleukin-17 receptor A (IL-17RA) has been recognized as a valuable biomarker for diverse diseases, including autoimmune diseases. In this work, an electrochemical biosensor with great sensitivity and selectivity toward IL-17RA was fabricated using an IL-17RA aptamer (Kd=14.00nM) for the first time. The aptasensor was manufactured using electrodeposition of gold nanoparticles, and then quantitative detection of IL-17RA was performed based on impedimetry. The developed sensor exhibited a superior analytical performance for IL-17RA with a wide dynamic range of 10-10,000pg/mL in buffer and a detection limit of 2.13pg/mL, which is lower than that of commercially available ELISA kits. In addition, we validated the high specificity of the designed aptasensor to only IL-17RA, which showed good sensitivity even in human serum solution. Furthermore, the detection of the differentiated HL-60 cells expressing IL-17RA was successfully performed. Clinical applicability of the sensor was also demonstrated utilizing neutrophils separated from asthma patients. It is expected that the fabricated aptasensor will become an excellent diagnostic platform for IL-17RA-mediated diseases.

The simple, economical, and accurate diagnosis of tuberculosis (TB) is essential for high TB-burden countries with limited resources. Here, we propose a novel approach based on TB7.7-responsive aptamer beacon with graphene oxide (GO) for the diagnosis of active TB by the direct detection of circulating TB7.7 in serum. A TB7.7-specific aptamer (Kd = 5.3 nM) was developed to design the aptamer beacon responsive to TB7.7 by forming a hairpin structure labeled with 5′-FAM and 3′-BHQ1, which produces a fluorescence signal only in the presence of TB7.7. Additionally, GO was introduced to improve the sensitivity of the aptasensor by enhancing the signal-to-background ratio. After the optimization process, the established aptasensor performed the highly sensitive and specific detection of TB7.7 in buffer and serum with a low detection limit of 0.8779 nM and 0.7089 nM, respectively. The clinical application of serum samples from active TB patients demonstrated that the diagnostic performance of the aptasensor offered 41.67 % sensitivity and 92.86 % specificity with 78.87 % accuracy based on receiver operator curve (ROC) analysis. Taken together, this study demonstrated that circulating TB7.7 is an effective biomarker for active TB diagnosis. The proposed aptasensor accurately diagnosed active TB using a simple and cost-effective process (

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

In this study, we synthesized dual aptamer-modified silica nanoparticles that simultaneously target two types of breast cancer cells: the mucin 1 (MUC1)(+) and human epidermal growth factor receptor 2 (HER2)(+) cell lines. Dual aptamer system enables a broad diagnosis for breast cancer in comparison with the single aptamer system. The dye-doped silica nanoparticles offer great stability with respect to photobleaching and enable the accurate quantification of breast cancer cells. The morphological and spectroscopic characteristics of the designed Dual-SiNPs were demonstrated via diverse methods such as DLS, zeta potential measurements, UV-vis spectroscopy, and fluorescence spectroscopy. Negatively charged Dual-SiNPs with a homogeneous size distribution showed robust and strong fluorescence. In addition, Dual-SiNPs did not affect cell viability, implying that this probe might be readily available for use in an in vivo system. Through ratio optimization of the MUC1 and HER2 aptamers, the binding capacities of the Dual-SiNPs to both cell lines were maximized. Based on Dual-SiNPs, a highly sensitive quantification of breast cancer cells was performed, resulting in a detection limit of 1 cell/100 μL, which is significantly lower compared with those reported in other studies. Moreover, the developed detection platform displayed high selectivity for only the MUC1(+) and HER2(+) cell lines. It is expected that this valuable diagnostic probe will be a noteworthy platform for the diagnosis and prognosis of breast cancer.

Although various studies related to nanoparticles-based photothermal therapy have been actively performed, an epoch-making photothermolysis therapy exhibiting both high selectivity and efficiency has yet not been discovered. For the first time, we have developed novel valuable therapeutic complexes, namely, dual aptamer-modified gold nanostars, for the targeting of prostate cancers, including PSMA(+) and PSMA(−) cells. The synthesized probes were characterized through several techniques, including UV-VIS spectral analysis, DLS analysis, zeta potential measurements, and TEM imaging, and were subsequently subjected to cytotoxicity tests, cell uptake confirmation, and in vitro photothermal therapy. The homogeneously well-fabricated nanostars presented high selectivity to prostate cancer cells and extremely high efficiency for therapy using an 808 nm laser under an irradiance of 0.3 W cm−2, which is lower than the permitted value for skin exposure (0.329 W cm−2). It is anticipated that this novel photothermal agent will become the general platform for targeted therapy.

Structural elements are key elements for understanding single-stranded nucleic acid folding. Although various RNA structural elements have been documented, structural elements of single-stranded DNA (ssDNA) have rarely been reported. Herein, we determined a crystal structure of PvLDH in complex with a DNA aptamer called pL1. This aptamer folds into a hairpin-bulge contact by adopting three novel structural elements, viz, DNA T-loop-like motif, base–phosphate zipper, and DNA G·G metal ion zipper. Moreover, the pL1:PvLDH complex shows unique properties compared with other protein:nucleic acid complexes. Generally, extensive intermolecular hydrogen bonds occur between unpaired nucleotides and proteins for specific recognitions. Although most protein-interacting nucleotides of pL1 are unpaired nucleotides, pL1 recognizes PvLDH by predominant shape complementarity with many bridging water molecules owing to the combination of three novel structural elements making protein-binding unpaired nucleotides stable. Moreover, the additional set of Plasmodium LDH residues which were shown to form extensive hydrogen bonds with unpaired nucleotides of 2008s does not participate in the recognition of pL1. Superimposition of the pL1:PvLDH complex with hLDH reveals steric clashes between pL1 and hLDH in contrast with no steric clashes between 2008s and hLDH. Therefore, specific protein recognition mode of pL1 is totally different from that of 2008s.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

Simultaneous evaluation of the binding affinity of a series of aptamers toward a target molecule was investigated using an electrochemical microarray chip. The chip was modified by immobilizing seven aptamers obtained from the SELEX process and a control sequence onto gold nanoparticle-comprised conducting polymer-coated microarray electrodes. The chip was then incubated with the target molecule, kanamycin. The electrochemical response of the captured kanamycin was studied to evaluate the binding affinity of the aptamers, which showed the same trend with the fluorescence spectroscopic results. The lowest dissociation constant between a selected aptamer and kanamycin was determined to be 38.06 � 0.73 nM.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

Recently, aptamers have attracted the attention of many scientists, because they not only have all of the advantages of antibodies, but also have unique merits, such as thermal stability, low cost, and unlimited applications. In this review, we present the reasons why aptamers are known as alternatives to antibodies. Furthermore, several types of in vitro selection processes, including nitrocellulose membrane filtration, affinity chromatography, magnetic bead, and capillary electrophoresis-based selection methods, are explained in detail. We also introduce various applications of aptamers for the diagnosis of diseases and detection of small molecules. Numerous analytical techniques, such as electrochemical, colorimetric, optical, and mass-sensitive methods, can be utilized to detect targets, due to convenient modifications and the stability of aptamers. Finally, several medical and analytical applications of aptamers are presented. In summary, aptamers are promising materials for diverse areas, not just as alternatives to antibodies, but as the core components of medical and analytical equipment.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.

A simple, sensitive, and selective colorimetric biosensor for the detection of the malarial biomarkers Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum LDH (PfLDH) was demonstrated using the pL1 aptamer as the recognition element and gold nanoparticles (AuNPs) as probes. The proposed method is based on the aggregation of AuNPs using hexadecyltrimethylammonium bromide (CTAB). The AuNPs exhibited a sensitive color change from red to blue, which could be seen directly with the naked eye and was monitored using UV-visible absorption spectroscopy and transmission electron microscopy (TEM). The reaction conditions were optimized to obtain the maximum color intensity. PvLDH and PfLDH were discernible with a detection limit of 1.25 pM and 2.94 pM, respectively. The applicability of the proposed biosensor was also examined in commercially available human serum.

Malaria, a major burden of disease caused by parasites of the genus Plasmodium, is widely spread in tropical and subtropical regions. Here, we have successfully developed a diagnostic technique for malaria. The proposed method is based on the interaction among the Plasmodium lactate dehydrogenase (pLDH), which is a biomarker for malaria, and pL1 aptamer against Plasmodium vivax lactate dehydrogenase (PvLDH) and Plasmodium falciparum lactate dehydrogenase (PfLDH). In addition, the cationic polymers, poly(diallyldimethylammonium chloride) (PDDA) and poly(allylamine hydrochloride) (PAH), aggregate gold nanoparticles (AuNPs) that should be possible to observe the change in color from red to blue, which depends on the concentration of pLDH. Using this aptasensor, pLDH proteins were successfully detected with low detection limits. Moreover, the specificity test proved that the aptasenor is very specific in targeting proteins over other interfering proteins. In addition, the pLDH from infected blood samples of the two main species of malaria were also detected. The limits of detection for P. vivax were determined as 80 parasites/μl for PDDA and 74 parasites/μl for PAH. The aptasenor has great advantages that can simply and rapidly diagnose malaria. Thus, the developed aptasensor for detection of pLDH can offer an effective and sensitive diagnosis of malaria.

Correct diagnosis and successful therapy are extremely important to enjoy a healthy life when suffering from a disease. To achieve these aims, various cutting-edge technologies have been designed and fabricated to diagnose and treat specific diseases. Among these technologies, aptamer–nanomaterial hybrids have received considerable attention from scientists and doctors because they have numerous advantages over other methods, such as good biocompatibility, low immunogenicity and controllable selectivity. In particular, aptamers, oligonucleic acids or peptides that bind to a specific target molecule, are regarded as outstanding biomolecules. In this review, several screening techniques for aptamers, also called systematic evolution of ligands by exponential enrichment (SELEX) methods, are introduced, and diagnostic and therapeutic aptamer applications are also presented. Furthermore, we describe diverse aptamer–nanomaterial conjugate designs and their applications for diagnosis and therapy. A wide variety ofnanoparticle complexes that target specific biomolecules are revolutionizing disease diagnostics and therapies. Hunho Jo and Changill Ban at Pohang University of Science and Technology, South Korea, reviewed recent advances into the medical uses of aptamerscomplexed with nanoparticles. Aptamers arepeptides or small sections of DNA or RNA that can target and bind to specific chemicals in the body. In a complex, they effectively act as guides escorting nanoparticles to the places where they are needed. For example, aptamers can lead fluorescent nanoparticles to cancer cells to ensure clear imaging and diagnosis of tumors. The authors describe several promising aptamer-nanoparticle complexes, including probes for detecting cocaine and diagnosing breast cancer,as well asa drug delivery system that targets specific brain cells and may provide a therapy for Alzheimer's disease.

A gold nanoparticle based dual fluorescence–colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5′-CACGGCATGGTGGGCGTCGTG-3′), AMP17 (5′-GCGGGCGGTTGTATAGCGG-3′), and AMP18 (5′-TTAGTTGGGGTTCAGTTGG-3′), were confirmed to have high sensitivity and specificity to ampicillin (K d, AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5′-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Using an RNA/peptide dual-aptamer probe, both PSMA (+) and PSMA (−) prostate cancer cells were simultaneously detected by electrochemical impedance spectroscopy. This approach can be applied as a general tool for early diagnosis of prostate cancer.

Tuberculosis is the most frequent cause of infection-related death worldwide. We constructed a simple and direct electrochemical sensor to detect interferon (IFN)-gamma, a selective marker for tuberculosis pleurisy, using its RNA and DNA aptamers. IFN-gamma was detected by its 5'-thiol-modified aptamer probe immobilized on the gold electrode. Interaction between IFN-gamma and the aptamer was recorded using electrochemical impedance spectroscopy and quartz crystal microbalance (QCM) with high sensitivity. The RNA-aptamer-based sensor showed a low detection limit of 100 fM, and the DNA-aptamer-based sensor detected IFN-gamma to 1 pM in sodium phosphate buffer. With QCM analysis, the aptamer immobilized on the electrode and IFN-gamma bound to the aptamer probe was quantified. This QCM result shows that IFN-gamma exists in multimeric forms to interact with the aptamers, and the RNA aptamer prefers the high multimeric state of IFN-gamma. Such a preference may describe the low detection limit of the RNA aptamer shown by impedance analysis. In addition, IFN-gamma was detected to 10 pM by the DNA aptamer in fetal bovine serum, a mimicked biological system, which has similar components to pleural fluid.

The folding of aptamer immobilized on an Au electrode was successfully detected using label-free electrochemical methods. A thrombin binding DNA aptamer was used as a model system in the presence of various monovalent cations. Impedance spectra showed that the extent to which monovalent cations assist in folding of aptamer is ordered as K(+) > NH(4)(+) > Na(+) > Cs(+). Our XPS analysis also showed that K(+) and NH(4)(+) caused a conformational change of the aptamer in which it forms a stable complex with these monovalent ions. Impedance results for the interaction between aptamer and thrombin indicated that thrombin interacts more with folded aptamer than with unfolded aptamer. The EQCM technique provided a quantitative analysis of these results. In particular, the present impedance results showed that thrombin participates a folding of aptamer to some extent, and XPS analysis confirmed that thrombin stabilizes and induces the folding of aptamer.