Search

Recently, owing to their special spatial structures, peptide-based macrocycles have shown tremendous promise and aroused great interest in multidisciplinary research ranging from potent antibiotics against resistant strains to functional biomaterials with novel properties. Besides traditional monocyclic peptides, many fascinating polycyclic and remarkable higher-order cyclic, spherical and cylindric peptidic systems have come into the limelight owing to breakthroughs in various chemical (e.g., native chemical ligation and transition metal catalysis), biological (e.g., post-translational enzymatic modification and genetic code reprogramming), and supramolecular (e.g., mechanically interlocked, metal-directed folding and self-assembly via noncovalent interactions) macrocyclization strategies developed in recent decades. In this tutorial review, diverse state-of-the-art macrocyclization methodologies and techniques for peptides and peptidomimetics are surveyed and discussed, with insights into their practical advantages and intrinsic limitations. Finally, the synthetic-technical aspects, current unresolved challenges, and outlook of this field are discussed. [ABSTRACT FROM AUTHOR]

Oxidation of a thioether linkage in thioether-closed macrocyclic peptides led to collision-induced site-selective linearization of the peptides. This method has allowed for de novo sequencing of thioether macrocyclic peptides. The utility of the sequencing method was demonstrated by identifying the correct peptide sequences from a virtually randomized thioether macrocyclic peptide library. [ABSTRACT FROM AUTHOR]

Despite the advances in cancer treatment achieved, for example, by the CD20 antibody rituximab, an urgent medical need remains to optimize the capacity of such antibodies to induce antibody-dependent cellular cytotoxicity (ADCC) that determines therapeutic efficacy. The cytokine IL-15 stimulates proliferation, activation, and cytolytic capacity of NK cells, but broad clinical use is prevented by short half-life, poor accumulation at the tumor site, and severe toxicity due to unspecific immune activation. We here report modified immunocytokines consisting of Fc-optimized CD19 and CD20 antibodies fused to an IL-15 moiety comprising an L45E-E46K double mutation (MIC+ format). The E46K mutation abrogated binding to IL-15Rα, thereby enabling substitution of physiological trans-presentation by target binding and thus conditional IL-15Rβγ stimulation, whereas the L45E mutation optimized IL-15Rβγ agonism and producibility. In vitro analysis of NK activation, anti-leukemia reactivity, and toxicity using autologous and allogeneic B cells confirmed target-dependent function of MIC+ constructs. Compared with Fc-optimized CD19 and CD20 antibodies, MIC+ constructs mediated superior target cell killing and NK cell proliferation. Mouse models using luciferase-expressing human NALM-6 lymphoma cells, patient acute lymphoblastic leukemia (ALL) cells, and murine EL-4 lymphoma cells transduced with human CD19/CD20 as targets and human and murine NK cells as effectors, respectively, confirmed superior and target-dependent anti-leukemic activity. In summary, MIC+ constructs combine the benefits of Fc-optimized antibodies and IL-15 cytokine activity and mediate superior NK cell immunity with potentially reduced side effects. They thus constitute a promising new immunotherapeutic approach shown here for B cell malignancies. Editor's summary: Monoclonal antibodies (mAbs) have been a useful therapeutic option for some cancers; however, their function has been limited by their efficacy to activate natural killer cells against tumor cells without inducing off-target toxicity. Here, Zekri et al. have modified immunocytokines (MICs) that combine an IL-15 moiety with CD19 or CD20 antibody-mediated targeting that activates NK cells against leukemic cells. In addition, treatment of leukemia mouse models demonstrated improved tumor control as compared with their parental mAbs and thus represents a promising strategy that will require further studies. —Dorothy Hallberg [ABSTRACT FROM AUTHOR]

Peptides are unique class of biomolecules for pharmaceutics and industries, given their structural features that can be applied to many approaches. Although their advantages are known, they suffer from some limitations that need to be overcome. Some disadvantages are peptidic conformations' flexibility and susceptibility to proteolytic degradation. Research has been in a constant endeavor to provide solutions. The discovery of cyclic peptides in plants opened the door for new insights into peptide‐based applications. These peptides display high stability to physical and chemical conditions. They possess a wide range of biological activities. In addition, cyclic peptides shows enhanced activities compared to linear peptides. Thus, the idea of non‐cyclic peptide cyclization can be of great use in eliminating issues and improving peptide capabilities. Inspired by the naturally found cyclic peptides, many approaches for synthetic cyclization have been proposed. The current review provides an overall discussion of the available methods for cyclization, applications, and characterization techniques. The present review offers a unique source for colleagues newly exposed to the subject and on the verge of entering the field of cyclic peptides by providing an initiating step covering the essential points needed to be considered around peptide cyclization. [ABSTRACT FROM AUTHOR]

Polyfluorinated aromatic reagents readily react with thiolates via nucleophilic aromatic substitution (SNAr) and provide excellent scaffolds for peptide cyclisation. Here we report a robust and versatile platform for peptide stapling and multicyclisation templated by 5,10,15,20‐tetrakis(pentafluorophenyl)porphyrin, opening the door to the next generation of functional scaffolds for 3D peptide architectures. We demonstrate that stapling and multicyclisation occurs with a range of non‐protected peptides under peptide‐compatible conditions, exhibiting chemoselectivity and wide‐applicability. Peptides containing two cysteine residues are readily stapled, and the remaining perfluoroaryl groups permit the introduction of a second peptide in a modular fashion to access bicyclic peptides. Similarly, peptides with more than two cysteine residues can afford multicyclic products containing up to three peptide 'loops'. Finally, we demonstrate that a porphyrin‐templated stapled peptide containing the Skin Penetrating and Cell Entering (SPACE) peptide affords a skin cell penetrating conjugate with intrinsic fluorescence. [ABSTRACT FROM AUTHOR]

Macrocyclisation provides a means of stabilising the conformation of peptides, often resulting in improved stability, selectivity, affinity, and cell permeability. In this work, a new approach to peptide macrocyclisation is reported, using a cyanobenzothiazole‐containing amino acid that can be incorporated into peptides by both in vitro translation and solid phase peptide synthesis, meaning it should be applicable to peptide discovery by mRNA display. This cyclisation proceeds rapidly, with minimal by‐products, is selective over other amino acids including non N‐terminal cysteines, and is compatible with further peptide elaboration exploiting such an additional cysteine in bicyclisation and derivatisation reactions. Molecular dynamics simulations show that the new cyclisation group is likely to influence the peptide conformation as compared to previous thioether‐based approaches, through rigidity and intramolecular aromatic interactions, illustrating their complementarity. [ABSTRACT FROM AUTHOR]

Technologies for cysteine disulfide detection and conjugation are pivotal to understanding protein functions and developing disulfide-derived therapeutic agents. Currently, disulfide modification requires reductive cleavage prior to functionalization, posing challenges to differentiating disulfides from free thiols. We describe herein Redox-assisted Disulfide Direct Conjugation (RDDC) as a new method to enable disulfide rebridging without cross-reacting with free thiols. [ABSTRACT FROM AUTHOR]

Ortho‐phthalaldehyde has recently found wide potentials for protein bioconjugation and peptide cyclization. Herein, the second‐generation dialdehyde‐based peptide cyclization method is reported. The thiophene‐2,3‐dialdehyde (TDA) reacts specifically with the primary amine (from Lys side chain or peptide N‐terminus) and thiol (from Cys side chain) within unprotected peptides to generate a highly stable thieno[2,3‐c]pyrrole‐bridged cyclic structure, while it does not react with primary amine alone. This reaction is carried out in the aqueous buffer and features tolerance of diverse functionalities, rapid and clean transformation, and operational simplicity. The features allow TDA to be used for protein stapling and phage displayed peptide cyclization. [ABSTRACT FROM AUTHOR]

Biological molecules such as DNA, proteins, and lipids can be assembled into naturally existing nanoparticles, such as bacterial viruses (also called bacteriophages or phages), plant viruses, nucleic acid nanoparticles (e.g., DNA origami), protein nanoparticles, and exosomes. These bionanoparticles have their own distinct properties (including compositions, structures, shapes, and functions), laying the foundation for their unique applications as probes for cancer imaging, as detectors for cancer diagnosis, or as therapeutics for cancer therapy. To highlight how the distinct properties of different bionanoparticles can be explored in cancer nanotheranostics, this review critically analyzed the use of bionanoparticles in cancer imaging, diagnosis, and treatment. Specifically, for each of these representative bionanoparticles, we describe its unique properties that render it powerful in cancer theranostics compared with synthetic inorganic nanoparticles. We also summarize how to genetically or chemically modify or redesign the bionanoparticles so that they gain new functions desired for cancer theranostics, such as tumor‐seeking or tumor‐destructive capabilities. Finally, we discussed the challenges in this exciting field. The bionanoparticles covered in this review represent different biomolecular assemblies with unique theranostic applications, showcasing the power of bionanoparticles in disease diagnosis and treatment. [ABSTRACT FROM AUTHOR]

1. The influence of glucose oxidase (GOD) supplementation on growth, gut inflammation and its compensatory effects in broilers was investigated before and after heat stress. 2. Before heat stress, one-day-old broilers were divided into two groups: the control (CON) and GOD (100 g/t complete feed) groups. On d 21, the CON group was equally divided into CON1 and CON2 groups, and heat stress (35°C) was applied to the CON2 and GOD groups for 8 h/day to the end of the study, d 27 of age. The chickens were either killed before heat stress and 2 d after heat stress for the determination of cytokines in the liver and ileum, serum antioxidant enzymes and ileal microbiota. Growth performance was determined before and 7 d after heat stress. 3. The GOD decreased Clostridiales and Enterobacteriaceae families of bacteria and increased ileal nuclear factor-κB, interleukin-1β, and interferon-γ (P < 0.05) before heat stress. The broilers exhibited compensatory effects, including increases in ileal sirtuin-1, heat shock protein 70 expression, liver nuclear factor erythroid 2-related factor 2 content, serum total antioxidant capacity and glutathione peroxidase level (P < 0.05). At 2 d after heat stress, inflammatory factors were increased in both the CON2 and GOD groups, but the levels were lower in the GOD than CON2 (P < 0.05). On d 7 after heat stress, GOS alleviated heat stress induced growth retardation (P < 0.05). 4. These data suggested that GOD supplementation in broiler diets before heat stress stimulated intestinal oxidative stress and produced a compensatory response, which prevented a rapid increase in intestinal inflammatory factors and helped to maintain growth performance under heat stress. [ABSTRACT FROM AUTHOR]

The emergence of the novel coronavirus (SARS‐CoV‐2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS‐CoV‐2, a class I fusion protein that aids ACE2 (angiotensin‐converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication‐defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole‐inactivated SARS‐CoV‐2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA‐based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269–277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A‐0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll‐like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS‐CoV‐2 infection. [ABSTRACT FROM AUTHOR]

Peptides and proteins are becoming increasingly valuable as medicines, diagnostic agents and as tools for biomedical sciences. Much of this has been underpinned by the emergence of new methods for the manipulation and augmentation of native biomolecules. Perfluoroaromatic reagents are perhaps one of the most diverse and exciting tools with which to modify peptides and proteins, due principally to their nucleophilic substitution chemistry, high electron deficiency and the ability for their reactivity to be tuned towards specific nucleophiles. As discussed in this minireview, in recent years, perfluoroaromatic reagents have found applications as protecting groups or activating groups in peptide synthesis and as orthogonal handles for peptide modification. Furthermore, they have applications in chemoselective 'tagging', stapling and bioconjugation of peptides and proteins, as well as tuning of 'drug‐like' properties. This review will also explore possible future applications of these reagents in biological chemistry. [ABSTRACT FROM AUTHOR]

mRNA display is a powerful biological display platform for the directed evolution of proteins and peptides. mRNA display libraries covalently link the displayed peptide or protein (phenotype) with the encoding genetic information (genotype) through the biochemical activity of the small molecule puromycin. Selection for peptide/protein function is followed by amplification of the linked genetic material and generation of a library enriched in functional sequences. Iterative selection cycles are then performed until the desired level of function is achieved, at which time the identity of candidate peptides can be obtained by sequencing the genetic material. The purpose of this review is to discuss the development of mRNA display technology since its inception in 1997 and to comprehensively review its use in the selection of novel peptides and proteins. We begin with an overview of the biochemical mechanism of mRNA display and its variants with a particular focus on its advantages and disadvantages relative to other biological display technologies. We then discuss the importance of scaffold choice in mRNA display selections and review the results of selection experiments with biological (e.g., fibronectin) and linear peptide library architectures. We then explore recent progress in the development of "drug-like" peptides by mRNA display through the post-translational covalent macrocyclization and incorporation of non-proteogenic functionalities. We conclude with an examination of enabling technologies that increase the speed of selection experiments, enhance the information obtained in post-selection sequence analysis, and facilitate high-throughput characterization of lead compounds. We hope to provide the reader with a comprehensive view of current state and future trajectory of mRNA display and its broad utility as a peptide and protein design tool. [ABSTRACT FROM AUTHOR]

Protein complexes are defined by the three‐dimensional structure of participating binding partners. Knowledge about these structures can facilitate the design of peptidomimetics which have been applied for example, as inhibitors of protein–protein interactions (PPIs). Even though β‐sheets participate widely in PPIs, they have only rarely served as the basis for peptidomimetic PPI inhibitors, in particular when addressing intracellular targets. Here, we present the structure‐based design of β‐sheet mimetics targeting the intracellular protein β‐catenin, a central component of the Wnt signaling pathway. Based on a protein binding partner of β‐catenin, a macrocyclic peptide was designed and its crystal structure in complex with β‐catenin obtained. Using this structure, we designed a library of bicyclic β‐sheet mimetics employing a late‐stage diversification strategy. Several mimetics were identified that compete with transcription factor binding to β‐catenin and inhibit Wnt signaling in cells. The presented design strategy can support the development of inhibitors for other β‐sheet‐mediated PPIs. [ABSTRACT FROM AUTHOR]

Viral diseases pose a major risk to human health and human society. Research on vaccines as an economical and effective countermeasure is of great importance to prevent the spread of viruses and to treat viral diseases. Here in this work, we first introduce the reader to the role of the immune system in which vaccines are involved, while reviewing the history of vaccine development. We then present a detailed classification of viral vaccines, describing representative applications to elucidate the research value of different vaccines. We conclude with our views on future trends in the development of vaccine designs. [ABSTRACT FROM AUTHOR]

The scaffolding protein RbAp48 is part of several epigenetic regulation complexes and is overexpressed in a variety of cancers. In order to develop tool compounds for the study of RbAp48 function, we have developed peptide inhibitors targeting the protein–protein interaction interface between RbAp48 and the scaffold protein MTA1. Based on a MTA1‐derived linear peptide with low micromolar affinity and informed by crystallographic analysis, a bicyclic peptide was developed that inhibits the RbAp48/MTA1 interaction with a very low nanomolar KD value of 8.56 nM, and which showed appreciable stability against cellular proteases. Design included exchange of a polar amide cyclization strategy to hydrophobic aromatic linkers enabling mono‐ and bicyclization by means of cysteine alkylation, which improved affinity by direct interaction of the linkers with a hydrophobic residue on RbAp48. Our results demonstrate that stepwise evolution of a structure‐based design is a suitable strategy for inhibitor development targeting PPIs. [ABSTRACT FROM AUTHOR]

Two decades after their discovery, stapled peptide methodologies have evolved to a point where they can be used with confidence to generate therapeutic leads. Research groups across the world are testing innovative methodologies for their design, with dozens of publications released every month. A number of stapled peptide drug candidates have recently entered clinical trials. In this review, we provide an overview of successful methods for their construction, highlight trends in the deposited crystal structures of stapled peptide complexed to their targets and discuss properties that contribute towards improved pharmacological profiles. [ABSTRACT FROM AUTHOR]

Identification of specific epitopes targeted by neutralizing antibodies is essential to advance epitope-based vaccine design strategies. We report a facile methodology for rapid epitope mapping of neutralizing antibodies (NAbs) against HIV-1 Envelope (Env) at single-residue resolution, using Cys labeling, viral neutralization assays, and deep sequencing. This was achieved by the generation of a library of Cys mutations in Env glycoprotein on the viral surface, covalent labeling of the Cys residues using a Cys-reactive label that masks epitope residues, followed by infection of the labeled mutant virions in mammalian cells in the presence of NAbs. Env gene sequencing from NAb-resistant viruses was used to accurately delineate epitopes for the NAbs VRC01, PGT128, and PGT151. These agreed well with corresponding experimentally determined structural epitopes previously inferred from NAb:Env structures. HIV-1 infection is associated with complex and polyclonal antibody responses, typically composed of multiple antibody specificities. Deconvoluting the epitope specificities in a polyclonal response is a challenging task. We therefore extended our methodology to map multiple specificities of epitopes targeted in polyclonal sera, elicited in immunized animals as well as in an HIV-1-infected elite neutralizer capable of neutralizing tier 3 pseudoviruses with high titers. The method can be readily extended to other viruses for which convenient reverse genetics or lentiviral surface display systems are available. [ABSTRACT FROM AUTHOR]