Search

Background Human herpesvirus 7 (HHV-7) is a common virus that infects children early and is accompanied by lifelong latency in cells, which is easy to reactivate in immunodeficient adults, but the underlying pathological mechanism is uncertain in immunocompetent adults without peculiar past medical history. Even though the clinical manifestation of the encephalitis caused by HHV-7 is uncommon in immunocompetent adults, the HHV-7 infection should not be neglected for encephalitis for unknown reasons. Case presentation We reported here a case of HHV-7 encephalitis with epileptic seizures. While the brain computer tomography was standard, electroencephalography displayed slow waves in the temporal and bilateral frontal areas, then HHV-7 DNA was detected in the metagenomic next-generation sequencing of cerebrospinal fluid. Fortunately, the patient recovered after treatment and was discharged 2 months later. We also collected the related cases and explored a better way to illuminate the underlying mechanism. Conclusion The case indicates clinicians should memorize HHV-7 as an unusual etiology of encephalitis to make an early diagnosis and therapy.

Background Certain clinical manifestations of coronavirus disease (COVID-19) mimic those associated with human herpesvirus (HHV) infection. In this study, we estimated the prevalence of herpesvirus in patients with COVID-19 and determined if coinfection is associated with poorer outcomes and neurological symptoms. Methods We analyzed samples of 53 patients diagnosed with COVID-19. The samples were evaluated for the presence of alphaherpesviruses, betaherpesviruses, and gammaherpesviruses, and the viral loads were quantified using quantitative polymerase chain reaction (qPCR) method. Results Among the patients, in 79.2% had detection at least one type of herpesvirus. HHV-6 (47.2%), cytomegalovirus (43.3%), and HHV-7 (39.6%) showed the highest detection rates. Patients with a high severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) load were more likely to show herpes simplex virus 1 detection (p = 0.037). Among patients coinfected with SARS-CoV-2 and HHVs, 26.4% showed central nervous system-associated neurological symptoms and herpetic manifestations. A statistically significant association was observed between neurological changes and HHV-6 detection (p = 0.034). Conclusions The findings showed a high prevalence of herpesvirus in patients with COVID-19. Furthermore, even though SARS-CoV-2 and HHV coinfection was not associated with poorer outcomes, the findings demonstrated the association between neurological symptoms and HHV-6 detection.

Bell's palsy (BP) represents a major cause leading to facial paralysis in the world. The etiology of BP is still unknown, and virology is the prevailing theory. The purpose of this study is to explore the pathogenic microorganisms that may be related to BP, and it is of great significance to study the pathogenesis and treatment of BP. Metagenomic next-generation sequencing (mNGS) detection was performed in the epineurium of the facial nerve of 30 BP patients who underwent facial nerve epineurium decompression. A total of 84 pathogenic microorganisms were detected in 30 clinical samples, including 4 viruses, 10 fungi, and 70 bacteria. The species with the highest detection frequency in virus was human betaherpesvirus 7 (HHV-7). The species with the highest detection frequency in Fungi was Malassezia restricta. The species with the highest detection frequency in Bacteria was Pseudomonas aeruginosa. In this study, mNGS method was firstly used to detect the pathogenic microorganisms in the epineurium of the facial nerve with BP patients. We have for the first time identified HHV-7 and aspergillus in the epineurium of the facial nerve of BP patients. These results suggest that these two pathogenic microorganisms should be considered in the pathogenesis of BP.

Background Human herpesviruses (HHVs) are responsible for a significant number of clinical manifestations in systemic lupus erythematous (SLE) patients. The aim of this study was to determine the frequency of active HHV infections in SLE patients and correlating them with disease activity. Methods Serum samples were collected from 71 SLE patients and their DNAs were extracted and analyzed to detect HHV-DNA viruses using the nucleic acid amplification technique. Results Fifteen out of the 71 (21.1%) patients tested positive for the HHV-DNA virus. Of them, 11/15 HHV-DNA-positive patients (73.3%) had SLE activity index (SLEDAI – Systemic Lupus Erythematosus Disease Activity Index) ≥8 (p = 0.0001). Active HCMV infection was the mostly frequently observed infection, occurring in 6/15 patients (40%). The frequencies of other active viral infections were 22% for HSV-1, 16.7% for HHV-7, and 5.5% for HSV-2. Viral coinfection (two or more viruses detected in the same sample) occurred in three patients (16.7%). Active HHV infections in SLE patients are more frequent in those with active SLE (≥8), who is at high risk of HHV reactivation and HCMV disease. Conclusion Viral surveillance is important to identify active HHV infections that can cause clinical symptoms and other complication in SLE patients.

Myalgic encephalomyelitis/chronic fatigue syndrome (ME/CFS) is a multifactorial disorder with many possible triggers. Human herpesvirus (HHV)–6 and HHV-7 are two infectious triggers for which evidence has been growing. To understand possible causative role of HHV-6 in ME/CFS, metabolic and antiviral phenotypes of U2-OS cells were studied with and without chromosomally integrated HHV-6 and with or without virus reactivation using the histone deacetylase inhibitor trichostatin-A. Proteomic analysis was conducted by pulsed stable isotope labeling by amino acids in cell culture analysis. Antiviral properties that were induced by HHV-6 transactivation were studied in virus-naive A549 cells challenged by infection with influenza-A (H1N1) or HSV-1. Mitochondria were fragmented and 1-carbon metabolism, dUTPase, and thymidylate synthase were strongly induced by HHV-6 reactivation, whereas superoxide dismutase 2 and proteins required for mitochondrial oxidation of fatty acid, amino acid, and glucose metabolism, including pyruvate dehydrogenase, were strongly inhibited. Adoptive transfer of U2-OS cell supernatants after reactivation of HHV-6A led to an antiviral state in A549 cells that prevented superinfection with influenza-A and HSV-1. Adoptive transfer of serum from 10 patients with ME/CFS produced a similar fragmentation of mitochondria and the associated antiviral state in the A549 cell assay. In conclusion, HHV-6 reactivation in ME/CFS patients activates a multisystem, proinflammatory, cell danger response that protects against certain RNA and DNA virus infections but comes at the cost of mitochondrial fragmentation and severely compromised energy metabolism.

Human roseolovirus U20 and U21 are type I membrane glycoproteins that have been implicated in immune evasion by interfering with recognition of classical and non-classical MHC proteins. U20 and U21 are predicted to be type I glycoproteins with extracytosolic immunoglobulin-like domains, but detailed structural information is lacking. AlphaFold and RoseTTAfold are next generation machine-learning-based prediction engines that recently have revolutionized the field of computational three-dimensional protein structure prediction. Here, we review the structural biology of viral immunoevasins and the current status of computational structure prediction algorithms. We use these computational tools to generate structural models for U20 and U21 proteins, which are predicted to adopt MHC-Ia-like folds with closed MHC platforms and immunoglobulin-like domains. We evaluate these structural models and place them within current understanding of the structural basis for viral immune evasion of T cell and natural killer cell recognition.

Primary HHV7 infection is almost ubiquitous, and it can present as exanthema subitem. Little is known on the clinical relevance of HHV7 neuroinvasion in immunocompetent children.We describe 12 patients (median age 9.45 years, 50% males) with acute encephalopathy and active HHV7 infection. In all patients, HHV7-DNA was detected on cerebrospinal fluid (CSF) by RT-PCR.7/12 patients had meningoencephalitis (two with ADEM and one with MOG antibody-associated CIS); 5/12 showed acute neuropsychiatric symptoms. EEG showed anomalies exclusively in patients with meningoencephalitis. Six patients had RMN anomalies. CSF HHV7 copies ranged between 20 and 3,500 copies/mL (median 66 copies/mL) and mean HHV7 CSF/blood ratio was 0.75. Outcome was favorable in all children, although 3/12 had minor neurobehavioral sequelae. Mean follow-up period of 5.2 months.HHV7 can determine neuroinvasion in immunocompetent children, leading to acute encephalopathy. Blood-brain barrier damage and high CSF/blood viral copies ratio correlated with a more severe presentation. We speculate on the importance of immune-mediated mechanisms in provoking clinical features.

Cell–cell fusion is a fundamental and complex process that occurs during reproduction, organ and tissue growth, cancer metastasis, immune response, and infection. All enveloped viruses express one or more proteins that drive the fusion of the viral envelope with cellular membranes. The same proteins can mediate the fusion of the plasma membranes of adjacent cells, leading to the formation of multinucleated syncytia. While cell–cell fusion triggered by alpha- and gammaherpesviruses is well-studied, much less is known about the fusogenic potential of betaherpesviruses such as human cytomegalovirus (HCMV) and human herpesviruses 6 and 7 (HHV-6 and HHV-7). These are slow-growing viruses that are highly prevalent in the human population and associated with several diseases, particularly in individuals with an immature or impaired immune system such as fetuses and transplant recipients. While HHV-6 and HHV-7 are strictly lymphotropic, HCMV infects a very broad range of cell types including epithelial, endothelial, mesenchymal, and myeloid cells. Syncytia have been observed occasionally for all three betaherpesviruses, both during in vitro and in vivo infection. Since cell–cell fusion may allow efficient spread to neighboring cells without exposure to neutralizing antibodies and other host immune factors, viral-induced syncytia may be important for viral dissemination, long-term persistence, and pathogenicity. In this review, we provide an overview of the viral and cellular factors and mechanisms identified so far in the process of cell–cell fusion induced by betaherpesviruses and discuss the possible consequences for cellular dysfunction and pathogenesis.

The causes that trigger the onset of dementia are still unknown. Recently there has been an increasing interest in the possible role of infectious agents in the brain in the pathogenesis of this condition. Amongst the viruses, members of the Herpesviridae family, namely herpes simplex virus-1 (HSV1), cytomegalovirus (CMV), human herpesvirus-6 (HHV6), human herpesvirus-7 (HHV7) and varicella zoster virus (VZV) have been suggested as potential causes of the disease. However, the relative importance of these and other viruses in contributing to dementia remains unclear. We evaluated the association between seropositivity status of all viruses available in a large, population-based dataset (the UK Biobank) and dementia risk in an unbiased way. Of the 15 viruses investigated, our results showed a statistically significant increase of dementia risk associated only with HSV1 seropositivity (OR 2.14, 95% C.I. 1.21–3.81). However, by combining the data we found that seropositivity for 4 viruses (HSV1, HHV6, HHV7 and VZV) also significantly increases the risk of dementia (OR = 2.37, 95% C.I. 1.43–3.92). These four viruses have been described previously as neurotropic viruses. Our results provide support for a role for neurotropic viruses in the pathology of dementia.

Pityriasis rosea (PR) has been manifested in patients suffering from COVID‐19 as well as after vaccine protocols against SARS‐CoV‐2. It has a possible association with the HHV‐6B virus (roseola infantum) and can be controlled by antivirals such as acyclovir as well as by the amino acid l‐Lysine that showed a positive result in reducing the number of lesions and healing time. The aim of this study was to report a case of PR after a second dose of Oxford‐AstraZeneca, the adopted therapy and a brief literature review. A 53‐year‐old woman, phototype II, presented an erythematous lesion in the posterior right thigh 15 days after the second dose of Oxford‐AstraZeneca vaccine. Eight days after the initial injury, new injuries appeared in the calf, buttocks and thighs. The diagnosis was PR with a 5‐week eruption cycle. The treatment consisted of the use of l‐Lysine, 3 grams loading dose and 500 mg for 30 days and moisturizing/healing lotion, starting 14 days after the herald patch. After the 5th week of the disease cycle, there were no new eruptions and the repair cycle continued for up to 8 weeks leaving some residual skin spots. It is concluded that the patient may be a carrier a latent virus, HHV‐6, and the vaccine administration with immune system stimulation, would have activated the possible virus causing PR. l‐Lysine helped to control the manifestation by limiting the number of lesions and their location, which were restricted to the legs, thighs and buttocks.

Like all herpesviruses, the roseoloviruses (HHV6A, -6B, and -7) establish lifelong infection within their host, requiring these viruses to evade host antiviral responses. One common host-evasion strategy is the downregulation of host-encoded, surface-expressed glycoproteins. Roseoloviruses have been shown to evade the host immune response by downregulating NK-activating ligands, class I MHC, and the TCR/CD3 complex. To more globally identify glycoproteins that are differentially expressed on the surface of HHV6A-infected cells, we performed cell surface capture of N-linked glycoproteins present on the surface of T cells infected with HHV6A, and compared these to proteins present on the surface of uninfected T cells. We found that the protein tyrosine phosphatase CD45 is downregulated in T cells infected with HHV6A. We also demonstrated that CD45 is similarly downregulated in cells infected with HHV7. CD45 is essential for signaling through the T cell receptor and, as such, is necessary for developing a fully functional immune response. Interestingly, the closely related betaherpesviruses human cytomegalovirus (HCMV) and murine cytomegalovirus (MCMV) have also separately evolved unique mechanisms to target CD45. While HCMV and MCMV target CD45 signaling and trafficking, HHV6A acts to downregulate CD45 transcripts. IMPORTANCE Human herpesviruses-6 and -7 infect essentially 100% of the world's population before the age of 5 and then remain latent or persistent in their host throughout life. As such, these viruses are among the most pervasive and stealthy of all viruses. Host immune cells rely on the presence of surface-expressed proteins to identify and target virus-infected cells. Here, we investigated the changes that occur to proteins expressed on the cell surface of T cells after infection with human herpesvirus-6A. We discovered that HHV-6A infection results in a reduction of CD45 on the surface of infected T cells and impaired activation in response to T cell receptor stimulation.

Background In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. Methods The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. Results The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. Conclusion With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

A direct association between joint inflammation and the progression of osteoarthritis (OA) has been proposed, and synovitis is considered a powerful driver of the disease. Among infections implicated in the development of joint disease, human herpesvirus 7 (HHV-7) infection remains poorly characterized. Therefore, we assessed synovitis in OA patients, determined the occurrence and distribution of the HHV-7 antigen within the synovial membrane of OA-affected subjects, and correlated plasma levels of the pro-inflammatory cytokines tumor necrosis factor (TNF), interleukin-6 (IL-6), and TNF expressed locally within lesioned synovial tissues with HHV-7 observations, suggesting differences in persistent latent and active infection. Synovial HHV-7, CD4, CD68, and TNF antigens were detected immunohistochemically. The plasma levels of TNF and IL-6 were measured by an enzyme-linked immunosorbent assay. Our findings confirm the presence of persistent HHV-7 infection in 81.5% and reactivation in 20.5% of patients. In 35.2% of patients, virus-specific DNA was extracted from synovial membrane tissue samples. We evidenced the absence of histopathologically detectable synovitis and low-grade changes in the majority of OA patients enrolled in the study, in both HHV-7 PCR+ and HHV-7 PCR‒ groups. The number of synovial CD4-positive cells in the HHV-7 polymerase chain reaction (PCR)+ group was significantly higher than that in the HHV-7 PCR‒ group. CD4- and CD68-positive cells were differently distributed in both HHV-7 PCR+ and HHV-7 PCR‒ groups, as well as in latent and active HHV-7 infection. The number of TNF+ and HHV-7+ lymphocytes, as well as HHV-7+ vascular endothelial cells, was strongly correlated. Vascular endothelial cells, especially in the case of infection reactivation, appeared vulnerable. The balance between virus latency and reactivation is a long-term relationship between the host and infectious agent, and the immune system appears to be involved in displaying overreaction when a shift in the established equilibrium develops.

INTRODUCTION: Human herpesvirus (HHV)-7 establishes a latent infection during the lifetime of the host and can reactivate after the primary infection, leading to lytic replication in immunosuppressed patients. METHODS: This study aimed to develop an enzyme-linked immunosorbent assay (ELISA) to identify HHV-7 serum antibodies and compare its performance with that of an indirect immunofluorescence assay (IFA). RESULTS: Serum samples (n=102) were tested by IgG-IFA and by ELISA. IFA and ELISA showed IgG-positive results in 77 and 73 samples, respectively. Qualitative concordance of 96% was demonstrated between the two techniques. CONCLUSIONS: ELISA may be useful to diagnose HHV-7 infection.

The idea that infectious agents in the brain have a role in the pathogenesis of Alzheimer disease (AD) was proposed nearly 30 years ago. However, this theory failed to gain substantial traction and was largely disregarded by the AD research community for many years. Several recent discoveries have reignited interest in the infectious theory of AD, culminating in a debate on the topic at the Alzheimer's Association International Conference (AAIC) in July 2019. In this Viewpoint article, experts who participated in the AAIC debate weigh up the evidence for and against the infectious theory of AD and suggest avenues for future research and drug development.

Acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) is a recently described entity so far exclusively in East Asian children. AESD diagnosis is based on clinicoradiologic criteria, often without pleocytic CSF and characterized by hyperglycemia and transaminasemia. Here, we present the first case of human herpesvirus 7-related AESD in an immunocompetent child >2 years old and of Caucasian origin.

Objectives: Kawasaki disease (KD) is one of the most common childhood vasculitides. Some serological studies have suggested an etiological relationship between KD and human herpesvirus (HHV)-6 or HHV-7. However, primary or reactivated HHV-6 and -7 has not been fully investigated in patients with KD. Methods: Twenty-three patients with KD were prospectively enrolled in this study. Peripheral blood was collected in the acute and convalescence phases, and HHV-6 and -7 viral loads were measured by real-time PCR. Results: In the acute phase, HHV-6 and -7 DNA was detected in 7 (30%) patients each, compared to 13 (57%) and 9 (39%) patients in the convalescence phase, respectively. HHV-6 and -7 DNA loads were significantly higher in the convalescence phase than in the acute phase. Significant increases in HHV-6 and -7 DNA loads were not observed in disease control patients. Taking into account HHV-6 and -7 serostatus, reactivation of HHV-6 and -7 was observed in 7 and 9 patients, respectively. KD patients with HHV-6 reactivation showed higher C-reactive protein levels and more frequently required steroid therapies than patients without reactivation. Conclusion: HHV-6 and -7 reactivation is frequent in KD patients. HHV-6 reactivation might exacerbate the severity of KD., Published online: 05 Sep 2018

The human herpesvirus-7 (HHV-7) U21 glycoprotein binds to class I major histocompatibility complex (MHC) molecules in the endoplasmic reticulum (ER) and reroutes them to lysosomes. How this single viral glycoprotein efficiently redirects the U21/class I MHC complex to the lysosomal compartment is poorly understood. To investigate the trafficking of HHV-7 U21, we followed synchronous release of U21 from the ER as it traffics through the secretory system. Sorting of integral membrane proteins from the trans-Golgi network (TGN) has been shown to occur through tubular carriers that emanate from the TGN or through vesicular carriers that recruit GGA (Golgi-localized, γ-ear-containing, ARF-binding protein), clathrin adaptors, and clathrin. Here, we present evidence for the existence of a third type of Golgi-derived carrier that is vesicular, yet clathrin independent. This U21-containing carrier also carries a Golgi membrane protein engineered to form inducible oligomers. We propose that U21 employs the novel mechanism of forming oligomeric complexes with class I MHC molecules that result in sorting of the oligomeric U21/class I MHC complexes to Golgi--derived quality control carriers destined for lysosomes.

Background: The etiology of myocarditis in children has not yet been completely elucidated. Objective: Medical records of eight pediatric patients diagnosed with acute myocarditis within a 41-day period in a small-town hospital were retrospectively analyzed. Methods: We examined antibody titers of adenovirus, Epstein-Barr virus, herpes simplex virus, respiratory syncytial virus, varicella-zoster virus and cytomegalovirus in peripheral blood. We used polymerase chain reaction (PCR) amplification to detect genetic sequences from Human herpesvirus (HHV) 7, HHV 6, enterovirus, measles or parvovirus in peripheral blood. Results: The causative agent was HHV 7 in four patients. HHV 7 sequences were detected through PCR in one patient with rapid deterioration. Of four patients with HHV 7, two presented with dilated cardiomyopathy. Conclusion: To our knowledge, this is the first report to suggest HHV 7 as a causative agent for acute myocarditis. We believe HHV 7 should be considered as a possible etiologic pathogen for patients with suspected myocarditis. © The Author [2017]. Published by Oxford University Press. All rights reserved.

Human herpesviruses 6A, 6B, and 7 (HHV-6A, HHV-6B, HHV-7) are genetically related to cytomegalovirus. They belong to the Roseolovirus genus and to the Betaherpesvirinae subfamily. They infect T cells, monocytes-macrophages, epithelial cells, and central nervous system cells. These viruses are ubiquitous and are responsible for lifelong chronic infections, most often asymptomatic, in the vast majority of the general adult population. HHV-6B is responsible for exanthema subitum, which is a benign disease of infants. HHV-6A and HHV-6B also cause opportunistic infections in immunocompromised patients: encephalitis, hepatitis, bone marrow suppression, colitis, and pneumonitis. Their etiological role in chronic diseases such as multiple sclerosis, cardiomyopathy, and thyroiditis is still controversial. The pathogenicity of HHV-7 is less clear and seems to be much more restricted. Chromosomal integration of HHV-6A and HHV-6B is transmissible from parents to offspring and observed in about 1% of the general population. This integration raises the question of potential associated diseases and can be a confounding factor for the diagnosis of active infections by both viruses. The diagnosis of HHV-6A, HHV-6B, and HHV-7 infections is rather based on gene amplification (PCR), which allows for the detection and quantification of the viral genome, than on serology, which is mainly indicated in case of primary infection. Ganciclovir, foscarnet, and cidofovir inhibit the replication of HHV-6A, HHV-6B, and HHV-7. Severe infections may thus be treated but these therapeutic indications are still poorly defined.

Human herpesvirus 7 (HHV-7) is a betaherpesvirus, and is phylogenetically related to both HHV-6A and HHV-6B. The presence of telomeric repeat sequences at both ends of its genome should make it equally likely to integrate into the human telomere as HHV-6. However, numerous studies have failed to detect germline integration of HHV-7, suggesting an important difference between the HHV-6A/-6B and HHV-7 genomes. In search of possible germline integrated HHV-7, we developed a sensitive and quantitative real-time PCR assay and discovered that primers designed against some parts of the HHV-7 genome can frequently miss HHV-7 positive clinical samples even though they work efficiently in cell-culture-derived HHV-7 positive materials. Using a primer pair against the U90 ORF of HHV-7, we identified a possible case of germline integration of HHV-7 with one copy of viral genome per cell in both peripheral blood cells and hair follicles. Chromosomal integration of HHV-7 in these individuals was confirmed by fluorescence in situ hybridization analysis. Germline integration of HHV-7 was further confirmed by detection of ~2.6 copies of HHV-7 in the hair follicles of one of the parents. Our results shed light on the complex nature of the HHV-7 genome in human-derived materials in comparison to cell-culture-derived materials and show the need for stringent criteria in the selection of primers for epidemiological HHV-7 studies.

A 35-year-old male who had not previously suffered any major illnesses was admitted to our hospital because of general fatigue, fever, headache, vomiting, consciousness disturbance, and seizures. A neurological examination showed that he was in a semi-comatose state and exhibited neck stiffness. Brain magnetic resonance imaging detected high-intensity areas in the bilateral hippocampi and periventricular white matter. A cerebrospinal fluid examination revealed mononuclear pleocytosis, an elevated protein level, and positivity for human herpesvirus-7 (HHV-7) DNA. The patient's condition improved after the administration of methylprednisolone, intravenous immunoglobulins, and acyclovir. This is the first known case of limbic encephalitis associated with HHV-7 in an immunocompetent Japanese adult.

Rationale: West syndrome (WS) is an age-dependent epileptic encephalopathy that is characterized by intractable epileptic seizures, hypsarrhythmia, and observed through electroencephalogram (EEG) and significant neurodevelopmental regression. The spontaneous remission of epileptic seizure is clinically rare and has not previously been reported in a Chinese infant. Herein, we reported a Chinese infant with WS whose seizures disappeared following a human herpesvirus 7 (HHV-7) infection. Patient concerns: The male Chinese infant was born at the gestational age of 36 weeks with a birth weight of 1.65 kg and an Apgar score of 7 at the first minute. At the age of 6 months, the infant developed seizures that manifested as flexor spasms with trunk involvement and mental regression. Diagnosis: Brain magnetic resonance imaging revealed leukomalacia of the posterior horn and a reduction in the size of the periventricular of the bilateral ventricle and the corpus callosum. An EEG revealed hypsarrhythmia and typical spasm seizures. Therefore, the infant was diagnosed with symptomatic WS. Interventions: The infant was treated with adequate vitamin B6 intravenous drip and oral treatment with topiramate and levetiracetam. Outcomes: The observed seizures disappeared spontaneously 40 days after onset, without any changes in the anti-epileptic drug treatment, following a febrile rash due to a HHV-7 infection. Lessons: Spontaneous remission of epileptic seizures can occur following viral infection of HHV-7 in children with WS. The mechanism behind this spontaneous remission warrants further research.

These updated guidelines from the Infectious Diseases Community of Practice of the American Society of Transplantation review the diagnosis, prevention, and management of HHV-6A, HHV-6B, HHV-7, and HHV-8 in the pre- and post-transplant period. The majority of HHV-6 (A and B) and HHV-7 infections in transplant recipients are asymptomatic; symptomatic disease is reported infrequently across organs. Routine screening for HHV-6 and 7 DNAemia is not recommended in asymptomatic patients, nor is prophylaxis or preemptive therapy. Detection of viral nucleic acid by quantitative PCR in blood or CSF is the preferred method for diagnosis of HHV-6 and HHV-7 infection. The possibility of chromosomally integrated HHV-6 DNA should be considered in individuals with persistently high viral loads. Antiviral therapy should be initiated for HHV-6 encephalitis and should be considered for other manifestations of disease. HHV-8 causes Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman disease and is also associated with hemophagocytic syndrome and bone marrow failure. HHV-8 screening and monitoring may be indicated to prevent disease. Treatment of HHV-8 related disease centers on reduction of immunosuppression and conversion to sirolimus, while chemotherapy may be needed for unresponsive disease. The role of antiviral therapy for HHV-8 infection has not yet been defined.

Human herpes virus-6 (HHV-6) and human herpes virus-7 (HHV-7) are immunomodulating viruses potentially affecting the nervous system. We evaluated the influence of HHV-6 and HHV-7 infections on fibromyalgia (FM) clinical course. Forty-three FM patients and 50 control group participants were enrolled. 39.50% (n = 17) FM patients had light A delta and C nerve fiber damage, 27.91% (n = 12) had severe A delta and C nerve fiber damage. 67.44% (n = 29) FM patients had loss of warm sensation in feet, loss of heat pain sensation, and increased cold pain sensation (34.90%, n = 15 in both findings). HHV-6 and HHV-7 genomic sequences in peripheral blood DNA in 23/43 (51.00%) and 34/43 (75.50%) of samples from FM patients and in 3/50 (6.00%) and 26/50 (52.00%) of samples from the control group individuals were detected. Active HHV-6 (plasma viremia) or HHV-7 infection was revealed only in FM patients (4/23, 17.40% and 4/34, 11.80%, respectively). A statistically significant moderate positive correlation was found between A delta and C nerve fiber damage severity and HHV-6 infection (p 0.01, r = 0.410). 23/43 patients from the FM group and control group participants HHV-6 and 34/45 HHV-7 did have infection markers. A statistically significant moderate positive correlation was found between A delta and C nerve fiber damage severity and HHV-6 infection (p 0.01, r = 0.410). No difference was found between detection frequency of persistent HHV-6 and HHV-7 infection between FM patients and the control group. Statistically significant correlation was observed between quantitation of changes in QST thermal modalities and HHV-6 infection. There was no correlation between A delta and C nerve fiber damage and HHV-7 infection.

Herpesviruses are common components of the human microbiome that become clinically relevant when a competent immunosurveillance is compromised, such as in transplantation. Members of the beta and gamma subfamilies are associated with a wide diversity of pathologies, including end-organ disease and cancer. In this study, we developed a multiplex qPCR technique with high specificity, sensitivity, efficiency and predictability that allowed the simultaneous detection and quantification of beta and gamma human herpesviruses. The technique was tested in a cohort of 34 kidney- or liver-transplanted pediatric patients followed up for up to 12 months post-transplant. Viral load was determined in 495 leukocyte-plasma paired samples collected bi-weekly or monthly. Human herpesvirus (HHV) 7 was the herpesvirus most frequently found in positive samples (39%), followed by Epstein-Barr virus (EBV) (20%). Also, EBV and HHV7 were present in the majority of coinfection episodes (62%). The share of positive samples exclusively detected either in leukocytes or plasma was 85%, suggesting that these herpesviruses tended to take a latent or lytic path in an exclusive manner. Infection by human cytomegalovirus (HCMV) and HHV6, as well as coinfection by EBV/HHV7 and EBV/HHV6/HHV7, were associated with graft rejection (RR = 40.33 (p = 0.0013), 5.60 (p = 0.03), 5.60 (p = 0.03) and 17.64 (p = 0.0003), respectively). The routine monitoring of beta and gamma herpesviruses should be mandatory in transplant centers to implement preventive strategies.

During persistent human beta-herpesvirus (HHV) infection, clinical manifestations may not appear. However, the lifelong influence of HHV is often associated with pathological changes in the central nervous system. Herein, we evaluated possible associations between immunoexpression of HHV-6, -7, and cellular immune response across different brain regions. The study aimed to explore HHV-6, -7 infection within the cortical lobes in cases of unspecified encephalopathy (UEP) and nonpathological conditions. We confirmed the presence of viral DNA by nPCR and viral antigens by immunohistochemistry. Overall, we have shown a significant increase (p &lt, 0.001) of HHV antigen expression, especially HHV-7 in the temporal gray matter. Although HHV-infected neurons were found notably in the case of HHV-7, our observations suggest that higher (p &lt, 0.001) cell tropism is associated with glial and endothelial cells in both UEP group and controls. HHV-6, predominantly detected in oligodendrocytes (p &lt, 0.001), and HHV-7, predominantly detected in both astrocytes and oligodendrocytes (p &lt, 0.001), exhibit varying effects on neural homeostasis. This indicates a high number (p &lt, 0.001) of activated microglia observed in the temporal lobe in the UEP group. The question remains of whether human HHV contributes to neurological diseases or are markers for some aspect of the disease process.

Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. IMPORTANCE Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally infected with viral homologs of HHV-6 and HHV-7, which we provisionally named MneHV6 and MneHV7, respectively. In this study, we confirm that MneHV7 is genetically and biologically similar to its human counterpart, HHV-7. We determined the complete unique MneHV7 genome sequence and provide a comprehensive annotation of all genes. We also characterized viral transcription profiles in salivary glands from naturally infected macaques. We show that broad transcriptional activity across most of the viral genome is associated with high viral loads in infected parotid glands and that late viral protein expression is detected in salivary duct cells and peripheral nerve ganglia. Our study provides new insights into the natural behavior of an extremely prevalent virus and establishes a basis for subsequent investigations of the mechanisms that cause HHV-7 reactivation and associated disease.

is missing (Correspondence)

Recent study by Joel Dudley and colleagues published in Neuron on July 11, demonstrated that both HHV-6A and HHV-7 could be key causal contributors to Alzheimer’s disease (AD). However, among various biological and technical issues, we review how complicate to demonstrate the link of HHV-6A and HHV-7 infection with AD in current situation, and highlight the potential open research directions of follow-up studies in the future.

Pityriasis rosea (PR) usually presents as acute exanthema with oval erythematous-squamous lesions localized on the trunk, arms, and legs with spontaneous remission. We present an unusual case of PR with frequent relapses during a period of 7 years. An 11-year-old white female patient presented with many pruritic erythematous oval lesions on her trunk. A second episode followed 2 years later with several pruritic erythematous lesions on her lower limbs. During the following 5 years, the patient had several relapses per year, with 1 to 3 lesions on changing localizations. PR was diagnosed on the basis of the clinical presentation and detection of human herpesvirus 7 DNA. Spontaneous remission occurred without treatment in each episode. Relapsing PR is a rare form of PR characterized by a lower number of lesions and smaller sized lesions compared with the classic form of PR. Pediatricians should consider the diagnosis of relapsing PR even if only a single or few erythematous lesions are present.

is missing (Correspondence)

Neurological manifestations associated with HHV-7 have been described in primary infection in children, and very occasionally in immunocompromised adult patients. However, the role of HHV-7 reactivation as a cause of central nervous system (CNS) diseases in immunocompetent adults has not yet been defined. We retrospectively analyzed clinical and microbiological features of adults with neurological symptoms who underwent lumbar puncture and a multiplex polymerase chain reaction (PCR) for herpesviruses (HHV-1–8) and enteroviruses performed in cerebrospinal fluid (CSF), during a 4-year period. A total of 251 subjects were included. Mean age was 55 years, ranging 15–89. Globally, HHV-7 DNA was detected in CSF in 14 patients (5.6%). It was detected in 1 of 36 patients with microbiologically confirmed CNS infections, and in 7 of 172 patients with diagnoses of non-infectious neurological disorders (Specificity 0.96, 95% confidence interval 0.93–0.99). Additionally, HHV-7 DNA was detected in 6 of 21 patients (28.6%) with probable CNS infections (compatible clinical syndrome and CSF changes) in the absence of other causative agent: four meningitis, one myelitis, and one encephalitis. Treatment with foscarnet was effective in achieving improvement of symptoms and clearance of HHV-7 DNA in CSF in the cases of encephalitis and myelitis, while ganciclovir was ineffective in the case of encephalitis. Our results show that HHV-7 reactivation may cause CNS disease in immunocompetent adults and that detection of HHV-7 DNA in CSF as a false-positive result or as asymptomatic reactivation in adult patients with neurological diseases is uncommon. Foscarnet seems the first-line treatment for HHV-7 CNS disease.

The roseoloviruses, human herpesvirus-6A -6B and -7 (HHV-6A, HHV-6B and HHV-7) cause acute infection, establish latency, and in the case of HHV-6A and HHV-6B, whole virus can integrate into the host chromosome. Primary infection with HHV-6B occurs in nearly all children and was first linked to the clinical syndrome roseola infantum. However, roseolovirus infection results in a spectrum of clinical disease, ranging from asymptomatic infection to acute febrile illnesses with severe neurologic complications and accounts for a significant portion of healthcare utilization by young children. Recent advances have underscored the association of HHV-6B and HHV-7 primary infection with febrile status epilepticus as well as the role of reactivation of latent infection in encephalitis following cord blood stem cell transplantation.

The human roseoloviruses human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 comprise the

A 28-year-old Japanese male without a significant past medical history presented with new-onset generalized clonic seizure and headache. A brain MRI revealed multiple enhanced lesions on both cerebral hemispheres. Laboratory exams showed no evidence of systemic inflammation or auto-immune antibodies such as ANCAs. Despite four courses of high-dose methylprednisolone pulse therapy and five treatments with plasmapheresis, his symptoms worsened and the MRI lesions progressed rapidly. During these treatments, we performed a targeted brain biopsy, that revealed histological findings consistent with a predominant angiitis of parenchymal and subdural small vessels. He was provided with diagnosis of central nervous system vasculitis (CNSV). Subsequent cyclophosphamide pulse therapy enabled a progressive successful improvement of his symptoms. While diagnostic methods for CNSV remain controversial, histological findings are thought to be more useful in obtaining a more definitive diagnosis than findings in image studies, such as MRI and angiography. We suggest that a brain biopsy should be considered during the early period of cases with suspected CNSV and rapid clinical deterioration. We also detected human herpesvirus 7 (HHV-7) using PCR technology in brain biopsy specimens, however the relationship between CNSV and HHV-7 infection is unknow.

Human herpes virus 7 (HHV-7) is a cause of encephalitis, meningitis and myeloradiculoneuropathy in adults who are immunocompetent or with immunosuppression. The involvement of the peripheral nervous system is always associated with myelitis. We report a case of acute polyradiculoneuropathy due to HHV-7, without involvement of central nervous system, in an immunocompetent patient. A 35-years-old man complained of lumbar pain radiating to both buttocks. On examination muscle strength and tendon reflexes were normal. He had asymmetric pinprick and light touch saddle hypoesthesia and also in the perineal region, dorsum and lateral aspect of the left foot. Magnetic resonance imaging showed mild thickening and contrast enhancement of cauda equina nerve roots. Polymerase chain reaction performed on cerebrospinal fluid was positive for HVV-7. Other inflammatory, infectious and neoplastic etiologies were ruled out. Lumbar pain and hypoesthesia improved progressively and neurological examination was normal after one month. He did not receive antiviral therapy.

Background Primary Human herpesvirus-7 (HHV-7) infection usually occurs during childhood and causes several clinical manifestations: mainly exanthem subitum (roseola infantum), followed by a lifelong latent state with possible reactivation in case of immunodeficiency. Nevertheless, some considerably different approaches exist regarding the natural history of HHV-7 and the possible consequences of HHV-7 infection in immunocompetent adults. In particular, little is known about its pathogenic role in central nervous system (CNS) disease in nonimmunosuppressed adults. Specifically, in case of encephalitis, it is important to distinguish between infectious encephalitis and postinfectious encephalomyelitis for the management of patients Case presentation We describe here a case of encephalitis associated to human herpesvirus-7 with associated polymyeloradiculopathy in an immunocompetent patient which may contribute to the delineation of the approach to a patient profile with a similar clinical presentation and evolution to those presented in the literature. Conclusions This case may alert clinicians to consider this specific etiology in the differential diagnosis of encephalopathy in patients with suspected infectious encephalitis who do not respond to acyclovir or in patients who develop acute polymyeloradiculopathy, considering that HHV-7 may be a pathological factor and that a timely diagnosis is crucial for the early administration of specific treatment. Electronic supplementary material The online version of this article (doi:10.1186/s12985-017-0764-y) contains supplementary material, which is available to authorized users.

Background Lung transplant patients are a vulnerable group of immunosuppressed patients that are prone to frequent respiratory infections. We studied 60 episodes of respiratory symptoms in 71 lung transplant patients. Almost half of these episodes were of unknown infectious etiology despite extensive routine diagnostic testing. Methods We re-analyzed respiratory samples of all episodes with undetermined etiology in order to detect potential viral pathogens missed/not accounted for in routine diagnostics. Respiratory samples were enriched for viruses by filtration and nuclease digestion, whole nucleic acids extracted and randomly amplified before high throughput metagenomic virus sequencing. Viruses were identified by a bioinformatic pipeline and confirmed and quantified using specific real-time PCR. Results In completion of routine diagnostics, we identified and confirmed a viral etiology of infection by our metagenomic approach in four patients (three Rhinovirus A, one Rhinovirus B infection) despite initial negative results in specific multiplex PCR. Notably, the majority of samples were also positive for Torque teno virus (TTV) and Human Herpesvirus 7 (HHV-7). While TTV viral loads increased with immunosuppression in both throat swabs and blood samples, HHV-7 remained at low levels throughout the observation period and was restricted to the respiratory tract. Conclusion This study highlights the potential of metagenomic sequencing for virus diagnostics in cases with previously unknown etiology of infection and in complex diagnostic situations such as in immunocompromised hosts.

Background Human herpesviruses have been hypothesized as environmental triggers in the development of autoimmune thyroid diseases (AITD), and in particular active human herpesvirus 6A (HHV-6A) infection was detected in thyrocytes of Hashimoto’s thyroiditis (HT) patients, who also show specific anti-viral immune responses. On the other hand, AITD patients display modulation of specific miRNAs in thyroid tissue and blood. We wanted to ascertain whether HHV-6A infection might be correlated to the miRNA dysregulation observed in AITD. Methods Human thyroid and T-cell lines were infected in vitro with HHV-6A,-6B or −7, and analysed for miRNAs expression, either by microarray or by specific RT-PCR assays detecting miRNAs associated with AITD in vivo. Results HHV-6A infection, but not -6B or −7 infections, induced a decrease in miR-155_2 expression and an increase in miR-1238 expression in thyrocytes, as well as an increase in the expression levels of several autoimmunity-associated miRNAs in T lymphocytes, including miR-16_1, miR34a, miR-130a, miR-143_1, miR-202, miR-301b, miR-302c, miR-449b, miR-451_1, and miR-1238_2. Conclusions HHV-6A infection modulates miRNAs expression in the cell types involved in the development of AITD. Notably, our in vitro findings correlate with what observed in AITD patients, further supporting the association between HHV-6A infection and AITD development. Moreover, these effects are 6A-specific, emphasizing the differences between the two HHV-6 virus species, and suggesting diverse virus mechanisms of action and therapeutic approaches.

Background. Betaherpesviruses are established causes of morbidity and mortality in immunosuppressed patient groups but have been little studied in sub-Saharan Africa, the epicenter of the human immunodeficiency virus (HIV) pandemic. In this region, primary infections with human cytomegalovirus (HCMV) and human herpesvirus type 6 (HHV-6) type 6 are endemic in infancy, but the clinical impact of these infections among pediatric inpatient groups is poorly characterized and assumptive, based largely on data from Western populations. Methods. We used TaqMan polymerase chain reaction to screen sera from a group of 303 pediatric inpatients aged between 3 weeks and 2 years, at the University Teaching Hospital in Lusaka, Zambia. We report the prevalence of DNAemia and viral loads within this patient group, and evaluate possible clinical associations/risk factors for betaherpesvirus infections in these hospitalized children. Results. We detected betaherpesvirus DNAemia in 59.1% (179/303) of children. HCMV was the most prevalent (41.3%), followed by HHV-6B (20.5%), HHV-7 (20.1%), and HHV-6A (0.3%). HIV infection (odds ratio OR], 2.31; 95% confidence interval CI], 1.37-3.90; P = .002), being underweight (OR, 1.82; 95% CI, 1.06-3.12; P = .03), and an admission diagnosis of suspected meningitis (OR, 5.72; 95% CI, 1.07-30.5; P = .041) were independently associated with an increased odds of HCMV DNAemia. Conversely, HHV-6B and HHV-7 DNAemia were not associated with HIV, underweight, or admission diagnosis. Median HCMV viral load was moderately but significantly higher in HIV-infected children. Conclusions. Highly prevalent HCMV DNAemia was independently associated with HIV infection and being underweight across all age groups, and was also associated with meningitis, with previously underappreciated implications for the health and development of African children.

NKG2D is an activating receptor expressed on several types of human lymphocytes. NKG2D ligands can be induced upon cell stress and are frequently targeted post-translationally in infected or transformed cells to avoid immune recognition. Virus infection and inflammation alter protein N-glycosylation, and we have previously shown that changes in cellular N-glycosylation are involved in regulation of NKG2D ligand surface expression. The specific mode of regulation through N-glycosylation is, however, unknown. Here we investigated whether direct N-glycosylation of the NKG2D ligand MICA itself is critical for cell surface expression and sought to identify the essential residues. We found that a single N-glycosylation site (Asn(8)) was important for MICA018 surface expression. The frequently expressed MICA allele 008, with an altered transmembrane and intracellular domain, was not affected by mutation of this N-glycosylation site. Mutational analysis revealed that a single amino acid (Thr(24)) in the extracellular domain of MICA018 was essential for the N-glycosylation dependence, whereas the intracellular domain was not involved. The HHV7 immunoevasin, U21, was found to inhibit MICA018 surface expression by affecting N-glycosylation, and the retention was rescued by T24A substitution. Our study reveals N-glycosylation as an allele-specific regulatory mechanism important for regulation of surface expression of MICA018, and we pinpoint the residues essential for this N-glycosylation dependence. In addition, we show that this regulatory mechanism of MICA surface expression is likely targeted during different pathological conditions.