Search

Herein, we report the structure-based selection via molecular docking of four N -heterocyclic bis-carbene gold(I) complexes, whose potential as ligands for the hTel23 G-quadruplex structure has been investigated using circular dichroism (CD) spectroscopy, CD melting, and polyacrylamide gel electrophoresis (PAGE). The complex containing a bis(1,2,3,4,6,7,8,9-octahydro-11 H -11 λ -pyridazino[1,2-a]indazol-11-yl) scaffold induces a transition from the hybrid (3 + 1) topology to a prevalent parallel G-quadruplex conformation, whereas the complex featuring a bis(2-(2-acetamidoethyl)-3 3 -pyridazino[1,2-a]indazol-11-yl) scaffold induces a transition from the hybrid (3 + 1) topology to a prevalent parallel G-quadruplex conformation, whereas the complex featuring a bis(2-(2-acetamidoethyl)-3 λ )-yl) moiety disrupted the original G-quadruplex structure. These results deserve particular attention in light of the recent findings on the pathological involvements of G-quadruplexes in neurodegenerative diseases.3 -imidazo[1,5-a]pyridin-3(2 H )-yl) moiety disrupted the original G-quadruplex structure. These results deserve particular attention in light of the recent findings on the pathological involvements of G-quadruplexes in neurodegenerative diseases.

Peptide nucleic acid (PNA) is a DNA mimic that shows good stability against nucleases and proteases, forming strongly recognized complementary strands of DNA and RNA. However, due to its feeble ability to cross the cellular membrane, PNA activity and its targeting gene action is limited. Halloysite nanotubes (HNTs) are a natural and low-cost aluminosilicate clay. Because of their peculiar ability to cross cellular membrane, HNTs represent a valuable candidate for delivering genetic materials into cells. Herein, two differently charged 12-mer PNAs capable of recognizing as molecular target a 12-mer DNA molecule mimicking a purine-rich tract of neuroglobin were synthetized and loaded onto HNTs by electrostatic attraction interactions. After characterization, the kinetic release was also assessed in media mimicking physiological conditions. Resonance light scattering measurements assessed their ability to bind complementary single-stranded DNA. Furthermore, their intracellular delivery was assessed by confocal laser scanning microscopy on living MCF-7 cells incubated with fluorescence isothiocyanate (FITC)-PNA and HNTs labeled with a probe. The nanomaterials were found to cross cellular membrane and cell nuclei efficiently. Finally, it is worth mentioning that the HNTs/PNA can reduce the level of neuroglobin gene expression, as shown by reverse transcription-quantitative polymerase chain reaction and western blotting analysis., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier Inc. All rights reserved.)

Peptide Nucleic Acids (PNAs) represent a promising tool for gene modulation in anticancer treatment. The uncharged peptidyl backbone and the resistance to chemical and enzymatic degradation make PNAs highly advantageous to form stable hybrid complexes with complementary DNA and RNA strands, providing higher stability than the corresponding natural analogues. Our and other groups' research has successfully shown that tailored PNA sequences can effectively downregulate the expression of human oncogenes using antigene, antisense, or anti-miRNA approaches. Specifically, we identified a seven bases-long PNA sequence, complementary to the longer loop of the main G-quadruplex structure formed by the bcl2midG4 promoter sequence, capable of downregulating the expression of the antiapoptotic Bcl-2 protein and enhancing the anticancer activity of an oncolytic adenovirus. Here, we extended the length of the PNA probe with the aim of including the double-stranded Bcl-2 promoter among the targets of the PNA probe. Our investigation primarily focused on the structural aspects of the resulting DNA 2 -PNA heterotriplex that were determined by employing conventional and accelerated microsecond-scale molecular dynamics simulations and chemical-physical analysis. Additionally, we conducted preliminary biological experiments using cytotoxicity assays on human A549 and MDA-MB-436 adenocarcinoma cell lines, employing the oncolytic adenovirus delivery strategy., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2024 The Author(s).)

Fmoc-diphenylalanine (Fmoc-FF) is a low-molecular-weight peptide hydrogelator. This simple all-aromatic peptide can generate self-supporting hydrogel materials, which have been proposed as novel materials for diagnostic and pharmaceutical applications. Our knowledge of the molecular determinants of Fmoc-FF aggregation is used as a guide to design new peptide-based gelators, with features for the development of improved tools. Here, we enlarge the plethora of Fmoc-FF-based hydrogelated matrices by studying the properties of the Fmoc-FFK tripeptide, alone or in combination with Fmoc-FF. For multicomponent matrices, the relative weight ratios between Fmoc-FFK and Fmoc-FF (specifically, 1/1, 1/5, 1/10, and 1/20 w / w ) are evaluated. All the systems and their multiscale organization are studied using different experimental techniques, including rheology, circular dichroism, Fourier transform infrared spectroscopy, and scanning electron microscopy (SEM). Preliminary profiles of biocompatibility for the studied systems are also described by testing them in vitro on HaCaT and 3T3-L1 cell lines. Additionally, the lysine (K) residue at the C-terminus of the Fmoc-FF moiety introduces into the supramolecular material chemical functions (amino groups) which may be useful for modification/derivatization with bioactive molecules of interest, including diagnostic probes, chelating agents, active pharmaceutical ingredients, or peptide nucleic acids.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications., Competing Interests: The authors declare no conflict of interest.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes., Competing Interests: Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2022 Elsevier Inc. All rights reserved.)

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δ β-turn + Δ β-sheet = +23.6%, Δ α = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the β-structure are consistent with a partial protein destabilization due to the interaction with U2O.

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL., Competing Interests: The authors have declared that no competing interests exist.

Rewiring glucose metabolism toward aerobic glycolysis provides cancer cells with a rapid generation of pyruvate, ATP, and NADH, while pyruvate oxidation to lactate guarantees refueling of oxidized NAD + to sustain glycolysis. CtPB2, an NADH-dependent transcriptional co-regulator, has been proposed to work as an NADH sensor, linking metabolism to epigenetic transcriptional reprogramming. By integrating metabolomics and transcriptomics in a triple-negative human breast cancer cell line, we show that genetic and pharmacological down-regulation of CtBP2 strongly reduces cell proliferation by modulating the redox balance, nucleotide synthesis, ROS generation, and scavenging. Our data highlight the critical role of NADH in controlling the oncogene-dependent crosstalk between metabolism and the epigenetically mediated transcriptional program that sustains energetic and anabolic demands in cancer cells.

The evolution of antibacterial resistance has arisen as the main downside in fighting bacterial infections pushing researchers to develop novel, more potent and multimodal alternative drugs.Silver and its complexes have long been used as antimicrobial agents in medicine due to the lack of silver resistance and the effectiveness at low concentration as well as to their low toxicities compared to the most commonly used antibiotics. N -Heterocyclic Carbenes (NHCs) have been extensively employed to coordinate transition metals mainly for catalytic chemistry. However, more recently, NHC ligands have been applied as carrier molecules for metals in anticancer applications. In the present study we selected from literature two NHC-carbene based on acridinescaffoldand detailed nonclassicalpyrazole derived mono NHC-Ag neutral and bis NHC-Ag cationic complexes. Their inhibitor effect on bacterial strains Gram-negative and positivewas evaluated. Imidazolium NHC silver complex containing the acridine chromophore showed effectiveness at extremely low MIC values. Although pyrazole NHC silver complexes are less active than the acridine NHC-silver, they represent the first example of this class of compounds with antimicrobial properties. Moreover all complexesare not toxic and they show not significant activity againstmammalian cells (Hek lines) after 4 and 24 h. Based on our experimental evidence, we are confident that this promising class of complexes could represent a valuable starting point for developing candidates for the treatment of bacterial infections, delivering great effectiveness and avoiding the development of resistance mechanisms.

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus . In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

Mature microRNAs are short non-coding RNA sequences which upon incorporation into the RISC ribonucleoprotein complex, play a crucial role in regulation of gene expression. However, miRNAs can exist within the cell also as free molecules fulfilling their biological activity. Therefore, it is emerging that in addition to sequence even the structure adopted by mature miRNAs might play an important role to reach the target. Indeed, we analysed by several spectroscopic techniques the secondary structures of two artificial miRNAs selected by computational tool (miR-Synth) as best candidates to silence c-MET and EGFR genes and of two endogenous miRNAs (miR-15a and miR-15b) having the same seed region, but different biological activity. Our results demonstrate that both endogenous and artificial miRNAs can arrange in several 3D-structures which affect their activity and selectivity toward the targets.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca 2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca 2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG₄T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG₄T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG₄T)₄. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

The development of new strategies for enhancing drug delivery to the brain represents a major challenge in treating cerebral diseases. In this paper, we report on the synthesis and structural characterization of a biocompatible nanoparticle (NP) made up of poly(lactic-co-glycolic acid) (PLGA)-polyethylene glycol (PEG) co-polymer (namely PELGA) functionalized with the membranotropic peptide gH625 (gH) and the iron-mimicking peptide CRTIGPSVC (CRT) for transport across the blood-brain barrier (BBB). gH possesses a high translocation potency of the cell membrane. Conversely, CRT selectively recognizes the brain endothelium, which interacts with transferrin (Tf) and its receptor (TfR) through a non-canonical ligand-directed mechanism. We hypothesize that the delivery across the BBB of PELGA NPs should be efficiently enhanced by the NP functionalization with both gH and CRT. Synthesis of peptides and their conjugation to the PLGA as well as NP physical-chemical characterization are performed. Moreover, NP uptake, co-localization, adhesion under dynamic conditions, and permeation across in vitro BBB model are evaluated as a function of gH/CRT functionalization ratio. Results establish that the cooperative effect of CRT and gH may change the intra-cellular distribution of NPs and strengthen NP delivery across the BBB at the functionalization ratio 33% gH⁻66% CRT.

Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca 2+ -releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca 2+ release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca 2+ release properties., Competing Interests: The authors declare no conflict of interest.

Cystic Fibrosis (CF) is one of the most common life shortening conditions in Caucasians. CF is caused by mutations in the CF Transmembrane Conductance Regulator (CFTR) gene which result in reduced or altered CFTR functionality. Several microRNAs (miRNAs) downregulate the expression of CFTR, thus causing or exacerbating the symptoms of CF. In this context, the design of anti-miRNA agents represents a valid functional tool, but its translation to the clinic might lead to unpredictable side effects because of the interference with the expression of other genes regulated by the same miRNAs. Herein, for the first time, is proposed the use of peptide nucleic acids (PNAs) to protect specific sequences in the 3'UTR (untranslated region) of the CFTR messenger RNA (mRNA) by action of miRNAs. Two PNAs (7 and 13 bases long) carrying the tetrapeptide Gly-SerP-SerP-Gly at their C-end, fully complementary to the 3'UTR sequence recognized by miR-509-3p, have been synthesized and the structural features of target PNA/RNA heteroduplexes have been investigated by spectroscopic and molecular dynamics studies. The co-transfection of the pLuc-CFTR-3´UTR vector with different combinations of PNAs, miR-509-3p, and controls in A549 cells demonstrated the ability of the longer PNA to rescue the luciferase activity by up to 70% of the control, thus supporting the use of suitable PNAs to counteract the reduction in the CFTR expression., Competing Interests: The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

Obtaining DNA nanostructures with potential applications in drug discovery, diagnostics, and electronics in a simple and affordable way represents one of the hottest topics in nanotechnological and medical sciences. Herein, we report a novel strategy to obtain structurally homogeneous DNA G-wire nanostructures of known length, starting from the short unmodified G-rich oligonucleotide d(5'-CGGT-3'-3'-GGC-5') ( 1 ) incorporating a 3'-3' inversion of polarity site. The reported approach allowed us to obtain long G-wire assemblies through 5'-5' π-π stacking interactions in between the tetramolecular G-quadruplex building blocks that form when 1 is annealed in the presence of potassium ions. Our results expand the repertoire of synthetic methodologies to obtain new tailored DNA G-wire nanostructures.

A chiral pool protocol toward the synthesis of the smenamide family of natural products is described. Two stereoisomers of smenamide A, namely, ent -smenamide A and 16- epi -smenamide A were synthesized with a 2.6 and 2.5% overall yield, respectively. Their carboxylic acid moieties were assembled starting from S -citronellene via two Wittig reactions and a Grignard process. Its coupling with either ( S )- or ( R )-dolapyrrolidinone, synthesized from Boc-l-Phe and Boc-d-Phe, respectively, was accomplished by using the Andrus protocol. This work also established the previously unknown relative and absolute configurations of smenamide A., Competing Interests: The authors declare no competing financial interest.

The title compound, C 12 H 20 N 4 O 5 , crystallizes in the monoclinic space group P 2 1 , with four crystallographically independent mol-ecules in the asymmetric unit. The four mol-ecules have a very similar conformation that is basically determined by the formation of two intra-molecular hydrogen bonds between the amino NH 2 donors and the carbonyl and ring O-atom acceptors, forming, respectively, R (6) and R (7) ring motifs.. In the crystal, inter-molecular hydrogen bonding leads to the formation of R 2 2 (10) ring patterns, involving one amide CONH 2 donor and an imidazole N-atom acceptor. The cluster of the four independent mol-ecules has approximate non-crystallographic C 2 point symmetry. The structural analysis also shows that during the synthesis of the title compound, the reductive cleavage of the d-ribose ring of the inosine precursor proceeds stereoselectively, with retention of configuration.

The ability of the water-soluble protein extracts from Zea mais L. cv. PR32-B10 to degrade some representative polycyclic aromatic hydrocarbons (PAHs), has been evaluated. Surface sterilized seeds of corn (Zea mais L. Pioneer cv. PR32-B10) were hydroponically cultivated in a growth chamber under no-stressful conditions. The water-soluble protein extracts isolated from maize tissues showed peroxidase, polyphenol oxidase and catalase activities. Incubation of the extracts with naphthalene, fluorene, phenanthrene and pyrene, led to formation of oxidized and/or degradation products. GC-MS and TLC monitoring of the processes showed that naphthalene, phenanthrene, fluorene and pyrene underwent 100%, 78%, 92% and 65% oxidative degradation, respectively, after 120 min. The chemical structure of the degradation products were determined by (1)H NMR and ESI-MS spectrometry., (Copyright © 2016 Elsevier Ltd. All rights reserved.)

Cyclic N (1)-pentylinosine monophosphate (cpIMP), a novel simplified inosine derivative of cyclic ADP-ribose (cADPR) in which the N (1)-pentyl chain and the monophosphate group replace the northern ribose and the pyrophosphate moieties, respectively, was synthesized. The role played by the position of the phosphate group in the key cyclization step, which consists in the formation of a phosphodiester bond, was thoroughly investigated. We have also examined the influence of the phosphate bridge on the ability of cpIMP to mobilize Ca(2+) in PC12 neuronal cells in comparison with the pyrophosphate bridge present in the cyclic N (1)-pentylinosine diphosphate analogue (cpIDP) previously synthesized in our laboratories. The preliminary biological tests indicated that cpIMP and cpIDP induce a rapid increase of intracellular Ca(2+) concentration in PC12 neuronal cells.

The synthesis of four novel platinum complexes, bearing N6-(6-amino-hexyl)adenosine or a 1,6-di(adenosin-N6-yl)-hexane respectively, as ligands of mono-functional cisplatin or monochloro(ethylendiamine)platinum(II), is reported. The chemistry exploits the high affinity of the charged platinum centres towards the N7 position of the adenosine base system and a primary amine of an alkyl chain installed on the C6 position of the purine. The cytotoxic behaviour of the synthesized complexes has been studied in A549 adenocarcinomic human alveolar basal epithelial and MCF7 human breast adenocarcinomic cancer cell lines, in order to investigate their effects on cell viability and proliferation.

Rapid screening tests in medical diagnostic and environmental analysis are often based on oligonucleotide biochips. In this paper, we studied the stability of functionalized mesoporous silicon supports in the solid-phase synthesis of oligonucleotides, exploiting several chemical procedures. A 19-mer mixed sequence has been successfully synthesized on aminosilane-modified porous silicon photonic structures. The process and the materials have been characterized by optical reflectivity, atomic force microscopy and high-performance liquid chromatography.

In recent years considerable attention has been given to the use of natural substances as anticancer drugs. The natural antioxidant dipeptide L-carnosine belongs to this class of molecules because it has been proved to have a significant anticancer activity both in vitro and in vivo. Previous studies have shown that L-carnosine inhibits the proliferation of human colorectal carcinoma cells by affecting the ATP and Reactive Oxygen Species (ROS) production. In the present study we identified the Hypoxia-Inducible Factor 1α (HIF-1α) as a possible target of L-carnosine in HCT-116 cell line. HIF-1α protein is over-expressed in multiple types of human cancer and is the major cause of resistance to drugs and radiation in solid tumours. Of particular interest are experimental data supporting the concept that generation of ROS provides a redox signal for HIF-1α induction, and it is known that some antioxidants are able to suppress tumorigenesis by inhibiting HIF-1α. In the current study we found that L-carnosine reduces the HIF-1α protein level affecting its stability and decreases the HIF-1 transcriptional activity. In addition, we demonstrated that L-carnosine is involved in ubiquitin-proteasome system promoting HIF-1α degradation. Finally, we compared the antioxidant activity of L-carnosine with that of two synthetic anti-oxidant bis-diaminotriazoles (namely 1 and 2, respectively). Despite these three compounds have the same ability in reducing intracellular ROS, 1 and 2 are more potent scavengers and have no effect on HIF-1α expression and cancer cell proliferation. These findings suggest that an analysis of L-carnosine antioxidant pathway will clarify the mechanism underlying the anti-proliferative effects of this dipeptide on colon cancer cells. However, although the molecular mechanism by which L-carnosine down regulates or inhibits the HIF-1α activity has not been yet elucidated, this ability may be promising in treating hypoxia-related diseases.

Computational techniques, and in particular molecular dynamics (MD) simulations, have been successfully used as a complementary technique to predict and analyse the structural behaviour of nucleic acids, including peptide nucleic acid- (PNA-) RNA hybrids. This study shows that a 7-base long PNA complementary to the seed region of miR-509-3p, one of the miRNAs involved in the posttranscriptional regulation of the CFTR disease-gene of Cystic Fibrosis, and bearing suitable functionalization at its N- and C-ends aimed at improving its resistance to nucleases and cellular uptake, is able to revert the expression of the luciferase gene containing the 3'UTR of the gene in A549 human lung cancer cells, in agreement with the MD results that pointed at the formation of a stable RNA/PNA heteroduplex notwithstanding the short sequence of the latter. The here reported results widen the interest towards the use of small PNAs as effective anti-miRNA agents.

The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the ribose moiety is mimicked by a D-ribityl or by a hydroxybutyl chain.

Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores.

The substitution of a hydroxyl group by a fluorine atom in a potential drug is an efficient reaction that can, in principle, improve its pharmacological properties. Herein, the synthesis of the novel compound 5'-fluoro-5'-deoxyacadesine (5'-F-AICAR), a strict analogue of AICAR that cannot be 5'-phosphorylated to ZMP by cellular kinases, is reported.

The solid-phase synthesis of the first example of a new diphosphate AICAR derivative is reported. The new substance is characterized by the presence of a 5'-phosphate group while a second phosphate moiety is installed on a 5-hydroxypentyl chain attached to the 4-N-position of AICAR. Cyclization of the diphosphate derivative by pyrophosphate bond formation allowed for the formation of a novel AICAR-based cyclic ADP-ribose (cADPR) mimic.

Among non-canonical DNA secondary structures, G-quadruplexes are currently widely studied because of their probable involvement in many pivotal biological roles, and for their potential use in nanotechnology. The overall quadruplex scaffold can exhibit several morphologies through intramolecular or intermolecular organization of G-rich oligodeoxyribonucleic acid strands. In particular, several G-rich strands can form higher order assemblies by multimerization between several G-quadruplex units. Here, we report on the identification of a novel dimerization pathway. Our Nuclear magnetic resonance, circular dichroism, UV, gel electrophoresis and mass spectrometry studies on the DNA sequence dCGGTGGT demonstrate that this sequence forms an octamer when annealed in presence of K(+) or NH(4)(+) ions, through the 5'-5' stacking of two tetramolecular G-quadruplex subunits via unusual G(:C):G(:C):G(:C):G(:C) octads.

In this work we investigated the interaction between the short ac(4)a C-rich peptide nucleic acid (PNA) probe and two intramolecular G-quadruplex targets having the same G-tetrad core, but different folding topologies. The T(G(4)T)(3)G(4)T and the recently reported tetra-end-linked-(TG(4)T)(4) G-rich oligonucleotides (GROs) were chosen and synthesized for this study. UV, CD, and MS experiments revealed the formation of novel 1:1 G-quadruplex-PNA complexes besides the expected DNA-PNA heteroduplexes.

The binding properties of a series of known G-quadruplex ligands have been studied by ESI-MS experiments. The tetramolecular (TG(4)T)(4) quadruplex and its analogues I and II blocked, respectively, at the 3' or 5'-end by a tetra-end-linker (TEL) unit were chosen as the ligands targets. The stoichiometries of the obtained complexes as well as the ligand affinity and selectivity to the different quadruplexes were determined to deduce the ligand binding site. The TEL derivatives I and II allowed the probing of the grooves contribution to the binding of ligands to G-quadruplexes, demonstrating that the 3' and 5' quartets are not equivalent binding sites for ligand end-stacking.

A solid phase oligonucleotide (ON) synthesis on porous silicon (PSi) chip is presented. The prepared Si-OH surface were analyzed by FT-IR and the OH functions were quantified by reaction with 3'-phosphoramidite nucleotide building block. Short ONs were synthesized on the chip surface and the coupling yields evaluated.

Herein we report an efficient solid-phase synthesis of some N-1-alkyl-substituted analogs of cyclic inosine-diphosphate-ribose (cIDPR), a mimic of cyclic ADP-ribose (cADPR) which has been described as an agonist of the cADPR/Ca(2+) signalling system. The proposed synthetic strategy uses a polystyrene support bearing inosine by a 2',3'-acetal linkage which is converted into several N-1-alkylinosine-bis-phosphate derivatives which in turn were cyclized by a solid-phase pyrophosphate bond formation.

The absolute stereochemistry at the C-7, C-8, and C-9 chiral centers of pinolidoxin (1) has been determined by chemical and spectral methods. First, the synthesis of four stereoisomeric fully benzoylated 2,3-erythro-1,2,3,4-heptanetetrols, corresponding to the C(6)-C(18) portion of the natural substance, has been accomplished starting from meso-tartaric acid. As next step, the selection of the synthetic tetrabenzoate possessing "natural" stereochemistry (10a'), suitable for absolute configuration determination, has been carried out by correlation with its "natural" homologue derived from degradation of pinolidoxin. Determination of the stereochemistry at the title chiral centers has been carried out by application of the Mosher's method both to 7a', a compound stereochemically related to 10a', and to pinolidoxin itself. The stereoselective synthesis of a protected form of the C(6)-C(18) portion of pinolidoxin, to be used in its total synthesis, has also been accomplished starting from commercially available D-erythronolactone.

The recombinant beta-glycosidase (EcS beta gly) from Sulfolobus solfataricus was immobilised on chitosan to perform the enzymatic hydrolysis of commercial oleuropein (heterosidic ester of elenolic acid and 3,4-dihydroxy-phenylethanol (hydroxytyrosol)) at two temperatures (60 and 70 degrees C). Interestingly, on the basis of the reasonable assumption that the enzyme hydrolyses only the sugar linkage, the biotransformation produces unstable aglycone species formed by oleuropein hydrolysis that, differently from some commercially available beta-glucosidases tested, give rise to the formation of hydroxytyrosol, at the operative temperatures of the bioreactor. The results of the biotransformation at 70 degrees C showed that the main products are hydroxytyrosol, and glucose, being the oleuropein aglycone present in low amount at the end of reaction. Both in single step approach or in recycle approach the amounts of glucose and oleuropein aglycone were lightly dependent from flow rate. The amount of hydroxytyrosol, increased on decreasing the flow rate of bioreactor in recycle approach, following a non-linear trend and obtaining the highest value at a flow rate of 15 ml h-1 while in the single step approach the 3,4-dihydroxy-phenylethanol was at its maximum at higher flow rate (16 ml h-1). For the hydrolysis of the oleuropein by bioreactor at 60 degrees C we used lower molar ratio oleuropein/enzyme only by the single step approach. In these conditions it is possible to obtain high amounts of only two products (glucose and hydroxytyrosol) in short time (2 h). The stability of the bioreactor at the operative temperatures showed a t1/2 of 30 days at 70 degrees C and a t1/2 of 56 days at 60 degrees C.

The Ets family of transcription factors, of which there are now about 35 members regulate gene expression during growth and development. They share a conserved domain of around 85 amino acids which binds as a monomer to the DNA sequence 5'-C/AGGAA/T-3'. We have determined the crystal structure of an ETS domain complexed with DNA, at 2.3-A resolution. The domain is similar to alpha + beta (winged) 'helix-turn-helix' proteins and interacts with a ten-base-pair region of duplex DNA which takes up a uniform curve of 8 degrees. The domain contacts the DNA by a novel loop-helix-loop architecture. Four of amino acids that directly interact with the DNA are highly conserved: two arginines from the recognition helix lying in the major groove, one lysine from the 'wing' that binds upstream of the core GGAA sequence, and another lysine, from the 'turn' of the 'helix-turn-helix' motif, which binds downstream and on the opposite strand.

Bovine seminal ribonuclease, the only dimeric ribonuclease described thus far, is found to exist in two different quaternary structure forms. In one, the N-terminal segment (residues 1-17) of each subunit is interchanged with the remaining segment of the other subunit, whereas in the second, such interchange does not occur. Functionally, they differ in that the catalytic activity of the form with interchange can be modulated by the substrate, whereas the noninterchange form exhibits no cooperativity. Each form can convert into the other, up to an equilibrium ratio, which is that found for the isolated protein. The results of refolding experiments of unfolded protein chains suggest that also in vivo the form lacking interchange may be produced first and is then partially transformed into the other dimeric form until equilibrium is reached. Although the implications of these findings may not be immediately apparent, they are intriguing and may have an impact on the unusual noncatalytic actions of the protein, such as its selective cytotoxicity toward tumor cells, activated T cells, and differentiated male germ cells.