Search

ABSTRACT Glucose can activate the carbohydrate response element binding protein (ChREBP) transcription factor to control gene expressions in the metabolic pathways. The way of ChREBP involvement in human prostate cancer development remains undetermined. This study examined the interactions between prostate fibroblasts and cancer cells under the influences of ChREBP. Results showed that high glucose (30 mM) increased the phosphorylation of AKT at S473 and AMP‐activated protein kinase (AMPK) at S485 in human prostate fibroblast (HPrF) cells and prostate cancer PC‐3 cells. High glucose enhanced the expression of ChREBP, which increased the expressions of fibronectin, alpha‐smooth muscle actin (α‐SMA), and WNT1 inducible signaling pathway protein 1 (WISP1), magnifying the cell growth and contraction in HPrF cells in vitro. The cell proliferation, invasion, and tumor growth in prostate cancer PC‐3 cells were enhanced by inducing the expressions of ChREBP, mucosa‐associated lymphoid tissue 1 (MALT1), and epithelial‐mesenchymal transition markers with high glucose treatment. Moreover, ectopic ChREBP overexpression induced NF‐κB signaling activities via upregulating MALT1 expression in PC‐3 cells. Our findings illustrated that ChREBP is an oncogene in the human prostate. High glucose condition induces a glucose/ChREBP/MALT1/NF‐κB axis which links the glucose metabolism to the NF‐κB activation in prostate cancer cells, and a glucose/ChREBP/WISP1 axis mediating autocrine and paracrine signaling between fibroblasts and cancer cells to promote cell migration, contraction, growth, and invasion of the human prostate. [ABSTRACT FROM AUTHOR]

Objective Methods Results Conclusion This study aims to investigate the potential causal relationship, shared genomic loci, as well as potential molecular pathways and tissue‐specific expression patterns between gastroesophageal reflux disease (GERD) and the risk of hospitalized/severe 2019 coronavirus disease (COVID‐19).We employed linkage disequilibrium score regression and bidirectional Mendelian randomization (MR) analysis to explore potential genetic associations between GERD (N = 602,604) and hospitalized COVID‐19 (N = 2095,324) as well as severe COVID‐19 (N = 1086,211). Additionally, shared genomic loci were extracted from common pivotal regions, further confirmed through corresponding colocalization analyses. GERD‐driven molecular pathway network was constructed using extensive literature data mining to understand the molecular‐level impacts of GERD on COVID‐19.Our results revealed a significant positive genetic correlation between GERD and both hospitalized (rg  =  0.418) and severe COVID‐19 (rg  =  0.314). Furthermore, the MR analysis demonstrated a unidirectional causal effect of genetic predisposition to GERD on COVID‐19 outcomes, including hospitalized COVID‐19 (odds ratio [OR]: 1.33, 95% confidence interval [CI]: 1.27–1.44, p = 9.17e − 12) and severe COVID‐19 (OR: 1.27, 95% CI: 1.18–1.37, p = 1.20e − 05). Additionally, GERD and both COVID‐19 conditions shared one genomic locus with lead‐SNPs rs1011407 and rs1123573, corresponding to the transcription factor BCL11A. Colocalization analysis further demonstrated a significant positive correlation between genome‐wide association study and expression quantitative trait locus (eQTL) abnormalities, including rs1011407 (eQTL_p = 2.35e − 07) and rs1123573 (eQTL_p = 2.74e − 05). Molecular pathway analysis indicated that GERD might promote the progression of COVID‐19 by inducting immune‐activated and inflammation‐related pathways.These findings confirm that genetically determined GERD may increase the susceptibility to hospitalized/severe COVID‐19. The shared genetic loci and the potential molecular pathways offer valuable insights into causal connections between GERD and COVID‐19. [ABSTRACT FROM AUTHOR]

The article discusses the enhancement of salt tolerance in wheat through the overexpression of the TaDSU gene, which encodes a SUMO protease. The study shows that TaDSU overexpression leads to increased growth and yield in wheat under saline soil conditions by reducing Na+ content, increasing K+ levels, and enhancing metabolic markers of salt tolerance. The research also highlights the role of the TaDSU gene in deSUMOylating the transcription factor TaMYC2, which contributes to salt tolerance in wheat and Arabidopsis. The study suggests a conserved mechanism of salt tolerance mediated by TaDSU through MYC2 deSUMOylation, providing insights for genetic strategies to improve wheat under saline conditions. [Extracted from the article]

ABSTRACT Rose (Rosa rugosa) is an important perfume plant, but its cultivation is significantly constrained by salt stress. Terpenes represent the most abundant volatile aromatic compounds in roses, yet little is known about how terpene metabolism responds to salt stress. In this study, salt‐treated rose petals presented significant accumulation of monoterpenes, including geraniol, due to the disruption of jasmonic acid (JA) biosynthesis and signalling. Overexpression and silencing analyses revealed a MYC transcription factor involved in JA signalling (RrbHLH105) as a repressor of geraniol biosynthesis. RrbHLH105 was shown to activate the trehalose‐6‐phosphate synthase genes RrTPS5 and RrTPS8 by binding to the E‐box (5′‐CANNTG‐3′). The increased trehalose‐6‐phosphate content and decreased geraniol content in rose petals overexpressing TPS5 or RrTPS8, along with the high accumulation of geraniol in petals where both RrbHLH105 and TPSs were cosilenced, indicate that trehalose signalling plays a role in the negative regulation of geraniol accumulation via the RrbHLH105‐TPS module. In summary, the suppression of RrbHLH105 by salt stress leads to excessive geraniol accumulation through the inhibition of both RrbHLH105‐mediated JA signalling and RrTPS‐mediated trehalose signalling in rose petals. Additionally, this study highlights the emerging role of RrbHLH105 as a critical integrator of JA and trehalose signalling crosstalk. [ABSTRACT FROM AUTHOR]

SUMMARY Calmodulin7 (CAM7) is a key transcription factor of Arabidopsis seedling development. CAM7 works together with HY5 bZIP protein to promote photomorphogenesis at various wavelengths of light. In this study, we show that AtMYB4, identified from a yeast two‐hybrid screen, physically interacts with CAM7 and works as a positive regulator of photomorphogenesis at various wavelengths of light. CAM7 and HY5 directly bind to the promoter of AtMYB4 to promote its expression for photomorphogenic growth. On the other hand, ARA4, identified from the same yeast two‐hybrid screen, works as a negative regulator of photomorphogenic growth specifically in white light. The double mutant analysis reveals that the altered hypocotyl elongation of atmyb4 and ara4 is either partly or completely suppressed by additional loss of function of CAM7. Furthermore, ARA4 genetically interacts with AtMYB4 in an antagonistic manner to suppress the elongated hypocotyl phenotype of atmyb4. The transactivation studies reveal that while CAM7 activates the promoter of AtMYB4 in association with HY5, ARA4 negatively regulates AtMYB4 expression. Taken together, these results demonstrate that working as a negative regulator of photomorphogenesis, ARA4 plays a balancing act on CAM7 and HY5‐mediated regulation of AtMYB4. [ABSTRACT FROM AUTHOR]

Objective Methods Results Significance Epilepsy involves significant changes in neural cells during epileptogenesis. Although the molecular mechanism of epileptogenesis remains obscure, changes in gene regulation play a crucial role in the evolution of epilepsy. This study aimed to compare changes in a subset of specific genes during epilepsy development, focusing on the period after the first spontaneous seizure, to identify critical time windows for targeting different regulators.Using a rat model of acquired focal neocortical epilepsy induced by tetanus toxin, we characterized gene expression at acute, subacute, and chronic stages (48–72 h, 2 weeks, and 30 days after first spontaneous seizure, respectively), focusing on genes' potential contribution to epilepsy progression.We observed dynamic changes in the expression of these genes throughout the period after the first spontaneous seizure. Astrocytic reactions primarily occur early, before epilepsy is well established. Changes in Mtor (mammalian target of rapamycin) and Rest (repressor element 1 silencing transcription factor) signaling pathways are highly dynamic and correlated with the progression of epilepsy development. Ccl2 (chemokine C‐C‐motif ligand) is upregulated at the chronic stage, indicating activation of the neuroinflammatory pathway. Finally, Gabra5 (γ‐aminobutyric acidergic signaling) is downregulated at the late stage after epilepsy is established. Surprisingly, changes in the expression of specific genes are linked to the time since the first seizure, rather than seizure frequency or duration.These results suggest that the regulation of specific genes is essentially stage‐dependent during the development of epilepsy, highlighting the importance of targeting specific genes at appropriate stages of epilepsy development. [ABSTRACT FROM AUTHOR]

The article discusses autosomal-recessive agammaglobulinemia caused by genetic abnormalities affecting B cell development, with a focus on the role of Transcription Factor 3 (TCF-3) in regulating gene expression and immune cell function. The study presents four cases of patients with TCF-3 mutations and diverse clinical presentations, including recurrent infections, hypogammaglobulinemia, and neutropenia. The research highlights the clinical variability of TCF-3 mutations and their impact on immune cell development and function, emphasizing the need for further studies to understand the underlying mechanisms. [Extracted from the article]

Summary The growth and development of maize (Zea mays L.) are significantly impeded by prolonged exposure to high temperatures. Heat stress transcription factors (HSFs) play crucial roles in enabling plants to detect and respond to elevated temperatures. However, the genetic mechanisms underlying the responses of HSFs to heat stress in maize remain unclear. Thus, we aimed to investigate the role of ZmHSFA2B in regulating heat tolerance in maize. Here, we report that ZmHSFA2B has two splicing variants, ZmHSFA2B‐I and ZmHSFA2B‐II. ZmHSFA2B‐I encodes full‐length ZmHSFA2B (ZmHSFA2B‐I), whereas ZmHSFA2B‐II encodes a truncated ZmHSFA2B (ZmHSFA2B‐II). Overexpression of ZmHSFA2B‐I improved heat tolerance in maize and Arabidopsis thaliana, but it also resulted in growth retardation as a side effect. RNA‐sequencing and CUT&Tag analyses identified ZmMBR1 as a putative target of ZmHSFA2B‐I. Overexpression of ZmMBR1 also enhanced heat tolerance in Arabidopsis. ZmHSFA2B‐II was primarily synthesized in response to heat stress and competitively interacted with ZmHSFA2B‐I. This interaction consequently reduced the DNA‐binding activities of ZmHSFA2B‐I homodimers to the promoter of ZmMBR1. Subsequent investigations indicate that ZmHSFA2B‐II limits the transactivation and tempers the function of ZmHSFA2B‐I, thereby reducing the adverse effects of excessive ZmHSFA2B‐I accumulation. Based on these observations, we propose that the alternative splicing of ZmHSFA2B generates a self‐regulatory loop that fine‐tunes heat stress response in maize. [ABSTRACT FROM AUTHOR]

The C. elegans Argonaute protein PRG‐1/Piwi and associated piRNAs protect metazoan genomes by silencing transposons and other types of foreign DNA. As prg‐1 mutants are propagated, their fertility deteriorates prior to the onset of a reproductive arrest phenotype that resembles a starvation‐induced stress response. We found that late‐generation prg‐1 mutants with substantially reduced fertility were long‐lived, whereas early‐ or mid‐generation prg‐1 mutants had normal lifespans. Loss of the stress response transcription factor DAF‐16 caused mid‐ or late‐generation prg‐1 mutants to live very short lives, whereas overexpression of DAF‐16 enabled both mid‐ and late‐generation prg‐1 mutants to live long. Cytoplasmic P‐bodies that respond to stress increased in long‐lived late‐generation prg‐1 mutants and were transmitted to F1 but not F2 cross‐progeny. Moreover, moderate levels of heritable stress shorten late‐generation prg‐1 mutant longevity when DAF‐16 or P bodies are deficient. Together, these results suggest that the longevity of late‐generation prg‐1 mutants is a hormetic stress response. However, dauer larvae that occur in response to stress were not observed in late‐generation prg‐1 mutants. Small germ cell nucleoli that depended on germline DAF‐16 were present in late‐generation prg‐1 mutants but were not necessary for their longevity. We propose that prg‐1 mutant germ cells transmit a form of heritable stress, high levels of which promote longevity and strongly reduce fertility. The heritable stress transmitted by prg‐1/Piwi mutant germ cells may be generally relevant to epigenetic inheritance of longevity. [ABSTRACT FROM AUTHOR]

Summary Sun‐loving plants undergo shade avoidance syndrome (SAS) to compete with their neighbors for sunlight in shade conditions. Phytochrome B (phyB) plays a dominant role in sensing the shading signals (low red to far‐red ratios) and triggering SAS. Shade drives phyB conversion to inactive form, consequently leading to the accumulation of PHYTOCHROMEINTERACTING FACTOR 4 (PIF4) that promotes plant growth. Here, we show B‐box PROTEIN 7 (BBX7)/BBX8 and CIRCADIAN CLOCK ASSOCIATED 1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) positively regulate the low R : FR‐induced PIF4 expression and promote the low R : FR‐triggered hypocotyl growth in Arabidopsis. Shade interferes the interactions of phyB with BBX7 or BBX8 and triggers the accumulation of BBX7 and BBX8 independent of phyB. BBX7 and BBX8 associate with CCA1 and LHY to activate their transcription, the gene produces of which subsequently upregulate the expression of PIF4 in shade. Genetically, BBX7 and BBX8 act upstream of CCA1, LHY, and PIF4 with respect to hypocotyl growth in shade conditions. Our study reveals the BBX7/8‐CCA1/LHY transcription factor cascade upregulates PIF4 expression and increases its abundance to promote plant growth and development in response to shade. [ABSTRACT FROM AUTHOR]

SUMMARY Cotton seed development and fiber elongation are the inseparable and overlapped development processes requiring the continuous supply of sucrose as the direct carbon source. However, little is known about the molecular mechanism of how sucrose is transported from the source tissues (leaves) into growing cotton seeds. Here, we identify the function of a sucrose transporter gene, Sugars Will Eventually be Exported Transporter 10, GhSWEET10 in cotton seed development. GhSWEET10 encodes a functional sucrose transporter, predominantly expressing in the funiculus, inner seedcoat, and endosperm during fiber elongation. GhSWEET10 RNAi plants (GhSWEET10i) accumulated less sucrose and glucose in growing seeds and that led to shorter fibers and smaller seeds, whereas GhSWEET10 overexpressed plants (GhSWEET10OE) had bigger seeds and longer fibers with more sugar accumulation during fiber elongation. GhSWEET10 gene is transcriptionally controlled by the transcription factor GhDOFD45. GhDOFD45 knockout plants (GhDOFD45‐KO) possessed the phenotypes of smaller seeds and shorter fibers like those of GhSWEET10i plants. Furthermore, GhSWEET10 mainly exports the sucrose from the funiculus into developing seeds according to the mimic‐analysis of sucrose transporting. Collectively, all these findings show that GhDOFD45 positively regulates GhSWEET10 expression to mainly transport sucrose from leaves into developing cotton seeds. Our findings also imply that the sucrose transport into enlarging seeds benefits fiber development, and thus GhSWEET10 can be selected as a target of breeding novel cotton varieties with larger and more vigorous seeds. [ABSTRACT FROM AUTHOR]

Lysosomes are important cellular structures for human health as centers for recycling, signaling, metabolism and stress adaptation. However, the potential role of lysosomes in stress‐related emotions has long been overlooked. Here, it is found that lysosomal morphology in astrocytes is altered in the medial prefrontal cortex (mPFC) of susceptible mice after chronic social defeat stress. A screen of lysosome‐related genes revealed that the expression of the mucolipin 1 gene (Mcoln1; protein: mucolipin TRP channel 1) is decreased in susceptible mice and depressed patients. Astrocyte‐specific knockout of mucolipin TRP channel 1 (TRPML1) induced depressive‐like behaviors by inhibiting lysosomal exocytosis‐mediated adenosine 5′‐triphosphate (ATP) release. Furthermore, this stress response of astrocytic lysosomes is mediated by the transcription factor EB (TFEB), and overexpression of TRPML1 rescued depressive‐like behaviors induced by astrocyte‐specific knockout of TFEB. Collectively, these findings reveal a lysosomal stress‐sensing signaling pathway contributing to the development of depression and identify the lysosome as a potential target organelle for antidepressants. [ABSTRACT FROM AUTHOR]

De novo lipogenesis (DNL), a hallmark of cancer, facilitates tumor growth and metastasis. Therapeutic drugs targeting DNL are being developed. However, how DNL is directly regulated in cancer remains largely unknown. Here, transcription factor sine oculis homeobox 1 (SIX1) is shown to directly increase the expression of DNL‐related genes, including ATP citrate lyase (ACLY), fatty acid synthase (FASN), and stearoyl‐CoA desaturase 1 (SCD1), via histone acetyltransferases amplified in breast cancer 1 (AIB1) and lysine acetyltransferase 7 （HBO1/KAT7）, thus promoting lipogenesis. SIX1 expression is regulated by insulin/lncRNA DGUOK‐AS1/microRNA‐145‐5p axis, which also modulates DNL‐related gene expression as well as DNL. The DGUOK‐AS1/microRNA‐145‐5p/SIX1 axis regulates liver cancer cell proliferation, invasion, and metastasis in vitro and in vivo. In patients with liver cancer, SIX1 expression is positively correlated with DGUOK‐AS1 and SCD1 expression and is negatively correlated with microRNA‐145‐5p expression. DGUOK‐AS1 is a good predictor of prognosis. Thus, the DGUOK‐AS1/microRNA‐145‐5p/SIX1 axis strongly links DNL to tumor growth and metastasis and may become an avenue for liver cancer therapeutic intervention. [ABSTRACT FROM AUTHOR]

SUMMARY Arsenic (As) is extremely toxic to plants, posing a serious concern for food safety. Identification of genes responsive to As is significative for figuring out this issue. Here, we identified a bHLH transcription factor OsbHLH6 that was involved in mediating the processes of As tolerance, uptake, and root‐to‐shoot translocation in rice. The expression of OsbHLH6 gene was strongly induced after 3 and 48 h of arsenite [As(III)] treatment. The OsbHLH6‐overexpressed transgenic rice (OE‐OsbHLH6) was sensitive to, while the knockout mutant of OsbHLH6 gene (Osbhlh6) was tolerant to As(III) stress by affecting the contents of reactive oxygen species (ROS) and non‐protein thiols (NPT), etc. Knockout of OsbHLH6 gene increased significantly the As concentration in roots, but decreased extensively As accumulation in shoots, compared to that in OE‐OsbHLH6 and WT plants. The transcripts of phytochelatins (PCs) synthetase encoding genes OsPCS1 and OsPCS2, as well as As(III) transporter encoding genes OsLsi1 and OsABCC1 were greatly abundant in Osbhlh6 mutants than in OE‐OsbHLH6 and WT plants under As(III) stress. In contrast, the expression of OsLsi2 gene was extensively suppressed by As(III) in Osbhlh6 mutants. OsbHLH6 acted as a transcriptional activator to bind directly to the promoter and regulate the expression of OsPrx2 gene that encodes a peroxidase precursor. Moreover, overexpression of OsbHLH6 gene resulted in significant change of expression of amounts of abiotic stress‐related genes, which might partially contribute to the As sensitivity of OE‐OsbHLH6 plants. These findings may broaden our understanding of the molecular mechanism of OsbHLH6‐mediated As response in rice and provide novel useful genes for rice As stress‐resistant breeding. [ABSTRACT FROM AUTHOR]

The study investigated the expression of GATA3, a transcription factor involved in immune regulation, in tubo‐ovarian carcinomas and its association with clinicopathological factors and prognosis. Immunohistochemical analysis was performed on 91 tubo‐ovarian carcinoma samples to determine the presence of GATA3‐positive inflammatory cells in the tumor microenvironment. A threshold of 10% or higher was considered a positive expression. The results showed that 46.7% of tubo‐ovarian carcinomas exhibited positive expression of GATA3 in inflammatory cells. There was no significant difference in GATA3 expression between patients who received pre‐surgical chemotherapy and those who underwent primary surgery. However, high‐grade serous carcinomas had a significantly higher proportion of GATA3‐positive inflammatory cells compared to other subtypes. Advanced‐stage tumors (stage III) had a higher percentage of GATA3‐positive inflammatory cells compared to stage II and I tumors. Patients with positive GATA3 expression had a significantly lower disease‐free survival rate. However, there was no significant association between GATA3 expression and chemotherapy response score. These findings suggest that increased expression of GATA3 in mononuclear inflammatory cells is associated with higher grade, advanced stage, and increased risk of recurrence in tubo‐ovarian carcinoma. This implies that heightened GATA3 expression negatively impacts anti‐tumor immunity, tumor growth progression, and invasiveness in tubo‐ovarian carcinomas. [ABSTRACT FROM AUTHOR]

Summary Transcription factors of the CYCLING DOF FACTOR (CDF) family activate in potato the SP6A FT tuberization signal in leaves. In modern cultivars, truncated StCDF1.2 alleles override strict SD control by stabilizing the StCDF1 protein, which leads to StCOL1 suppression and impaired activation of the antagonic SP5G paralog. By using DAP‐seq and RNA‐seq studies, we here show that StCDF1 not only acts as an upstream regulator of the day length pathway but also directly regulates several N assimilation and transport genes. StCDF1 directly represses expression of NITRATE REDUCTASE (NR/NIA), which catalyses the first reduction step in nitrate assimilation, and is encoded by a single potato locus. StCDF1 knock‐down lines performed better in N‐limiting conditions, and this phenotype correlated with derepressed StNR expression. Also, deletion of the StNR DAP‐seq region abolished repression by StCDF1, while it did not affect NLP7‐dependent activation of the StNR promoter. We identified multiple nucleotide polymorphisms in the DAP‐seq region in potato cultivars with early StCDF1 alleles, suggesting that this genetic variation was selected as compensatory mechanism to the negative impact of StCDF1 stabilization. Thereby, directed modification of the StCDF1‐recognition elements emerges as a promising strategy to enhance limiting StNR activity in potato. [ABSTRACT FROM AUTHOR]

ABSTRACT Rapeseed (Brassica napus L.) exhibits high‐sulfur requirements to achieve optimal growth, development, and pathogen resistance. Despite the importance of sulfur, the mechanisms regulating its metabolism and disease resistance are not fully understood. In this study, we found that the zinc finger transcription factors BnaSTOP2s play a pivotal role in sulfur metabolism and Sclerotinia sclerotiorum resistance. Our findings indicate that BnaSTOP2s are involved in sulfur metabolism, as evidenced by extensive protein interaction screening. BnaSTOP2s knockout reduced the content of essential sulfur‐containing metabolites, including glucosinolate and glutathione, which is consistent with the significantly lowered transcriptional levels of BnaMYB28s and BnaGTR2s, key factors involved in glucosinolate synthesis and transportation, respectively. Comprehensive RNA‐seq analysis revealed the substantial effect of BnaSTOP2s on sulfur metabolism from roots to siliques, which serve as pivotal sources and sinks for sulfur metabolism, respectively. Furthermore, we found that leaf lesion size significantly decreased and increased in the BnaSTOP2‐OE and Bnastop2 mutants, respectively, compared with the wild‐type during S. sclerotiorum infection, suggesting a vital role of BnaSTOP2s in plant defense response. In conclusion, BnaSTOP2s act as global regulators of sulfur metabolism and confer resistance to S. sclerotiorum infection in B. napus. Thus, they have potential implications for improving crop resilience. [ABSTRACT FROM AUTHOR]

Lipidated ATG8/LC3 proteins are recruited to single membrane compartments as well as autophagosomes, supporting their functions. Although recent studies have shown that Golgi-LC3 lipidation follows Golgi damage, its molecular mechanism and function under Golgi stress remain unknown. Here, by combining DLK1 overexpression as a new strategy for induction of Golgi-specific LC3 lipidation, and the application of Golgi-damaging reagents, we unravel the mechanism and role of Golgi-LC3 lipidation. Upon DLK1 overexpression, LC3 is lipidated on the Golgi apparatus in an ATG12-ATG5-ATG16L1 complex-dependent manner; a post-Golgi trafficking blockade is the primary cause of this lipidation. During Golgi stress, ATG16L1 is recruited through its interaction with V-ATPase for Golgi-LC3 lipidation. After post-Golgi trafficking inhibition, TFE3, a key regulator of the Golgi stress response, is translocated to the nucleus. Defects in LC3 lipidation disrupt this translocation, leading to an attenuation of the Golgi stress response. Together, our results reveal the mechanism and unexplored function of Golgi-LC3 lipidation in the Golgi stress response. Synopsis: Lipidated LC3 attaches to the Golgi apparatus if it is damaged; however, the underlying mechanisms of this recruitment and its function remain elusive. This study demonstrates that Golgi-LC3 lipidation is induced by post-Golgi trafficking inhibition and facilitates activation of the transcription factor TFE3 for Golgi homeostasis. Overexpression of the non-canonical Notch ligand DLK1 stimulates non-autophagic Golgi-LC3 lipidation. Post-Golgi trafficking inhibition is the primary cause of Golgi-LC3 lipidation. The WD40 domain of ATG16L1 is essential for its interaction with V-ATPase and subsequent recruitment to the Golgi apparatus. LC3 lipidation stimulates a TFE3-mediated Golgi stress response. Stress-induced post-Golgi trafficking inhibition stimulates conjugation of ATG8/LC3 to single membranes at the Golgi apparatus. [ABSTRACT FROM AUTHOR]

Transcription factors (TFs) regulate gene expression by binding with varying strengths to DNA via their DNA-binding domain. Additionally, some TFs also interact with RNA, which modulates transcription factor binding to chromatin. However, whether RNA-mediated TF binding results in differential transcriptional outcomes remains unknown. In this study, we demonstrate that estrogen receptor α (ERα), a ligand-activated TF, interacts with RNA in a ligand-dependent manner. Defects in RNA binding lead to genome-wide loss of ERα recruitment, particularly at weaker ERα-motifs. Furthermore, ERα mobility in the nucleus increases in the absence of its RNA-binding capacity. Unexpectedly, this increased mobility coincides with robust polymerase loading and transcription of ERα-regulated genes that harbor low-strength motifs. However, highly stable binding of ERα on chromatin negatively impacts ligand-dependent transcription. Collectively, our results suggest that RNA interactions spatially confine ERα on low-affinity sites to fine-tune gene transcription. Synopsis: RNA modulates transcription factor binding to DNA, though the subsequent effect on transcription remains unclear. The study demonstrates that the binding of transcription factor ERα is stabilized at weaker motifs through its interaction with RNA, which fine-tunes ligand-induced transcription of estrogen-responsive genes. ERα interacts with a variety of coding and non-coding RNAs in ligand-dependent manner. RNA assists in the stabilization of ERα on weaker estrogen-response elements. Lack of RNA binding allows dynamic ERα interactions with chromatin. Dynamic binding of ERα is more conducive to transcription compared to stable binding. RNA interactions regulate the dynamics of transcription factor binding to consensus DNA motifs, dictating transcriptional output [ABSTRACT FROM AUTHOR]

Astrocytes in the brain exhibit regional heterogeneity contributing to regional circuits involved in higher-order brain functions, yet the mechanisms controlling their distribution remain unclear. Here, we show that the precise allocation of astrocytes to specific brain regions during development is achieved through transcription factor 4 (Tcf4)-mediated fate restriction based on their embryonic origin. Loss of Tcf4 in ventral telencephalic neural progenitor cells alters the fate of oligodendrocyte precursor cells to transient intermediate astrocyte precursor cells, resulting in mislocalized astrocytes in the dorsal neocortex. These ectopic astrocytes engage with neocortical neurons and acquire features reminiscent of dorsal neocortical astrocytes. Furthermore, Tcf4 functions as a suppressor of astrocyte fate during the differentiation of oligodendrocyte precursor cells derived from the ventral telencephalon, thereby restricting the fate to the oligodendrocyte lineage in the dorsal neocortex. Together, our findings highlight a previously unappreciated role for Tcf4 in regulating astrocyte allocation, offering additional insights into the mechanisms underlying neurodevelopmental disorders linked to Tcf4 mutations. Synopsis: Astrocytes in the brain exhibit significant regional diversity, but the mechanisms controlling their heterogeneity remain unclear. This study demonstrates that transcription factor 4 (Tcf4) regulates astrocyte allocation to specific brain regions through fate restriction based on their embryonic origin. Loss of Tcf4 in the Nkx2.1 lineage results in ectopic astrocytes in the dorsal neocortex. Tcf4-deficient ectopic astrocytes with ventral origin can adapt to the local neocortical environment engaging with nearby neurons. Tcf4 suppresses the expression of genes related to astrocytogenesis in the Nkx2.1 lineage of the dorsal neocortex. Transcription factor Tcf4 confines precursor cell fate and determines regional astrocyte diversification during brain development. [ABSTRACT FROM AUTHOR]

Summary Tomato is one of the most economically important vegetable crops in the world and has been seriously affected by the devastating agricultural pest root‐knot nematodes (RKNs). Current understanding of tomato resistance to RKNs is quite limited. VQ motif‐containing family proteins are plant‐specific regulators; however, whether and how tomato VQs regulate resistance to RKNs is unknown. Here, we found that SlVQ15 recruited SlWRKY30IIc to coordinately control tomato defence against the RKN Meloidogyne incognita without affecting plant growth and productivity. The jasmonate (JA)‐ZIM domain (JAZ) repressors of the phytohormone JAs signalling associated and interfered with the interaction of SlVQ15 and SlWRKY30IIc. In turn, SlWRKY30IIc bound to SlJAZs promoters and cooperated with SlVQ15 to repress their expression, whereas this inhibitory effect was antagonized by SlJAZ5, forming a feedback regulatory mechanism. Moreover, SlWRKY30IIc expression was directly regulated by SlMYC2, a SlJAZ‐interacting negative regulator of resistance to RKNs. In conclusion, our findings revealed that a regulatory circuit of SlVQ15‐SlWRKY30IIc and the JA pathway fine‐tunes tomato defence against the RKN M. incognita, and provided candidate genes and clues with great potential for crop improvement. [ABSTRACT FROM AUTHOR]

Summary Accumulation of triacylglycerols (TAGs) is crucial during various stages of plant development. In Arabidopsis, two enzymes share overlapping functions to produce TAGs, namely acyl‐CoA:diacylglycerol acyltransferase 1 (DGAT1) and phospholipid:diacylglycerol acyltransferase 1 (PDAT1). Loss of function of both genes in a dgat1‐1/pdat1‐2 double mutant is gametophyte lethal. However, the key regulatory elements controlling tissue‐specific expression of either gene has not yet been identified. We transformed a dgat1‐1/dgat1‐1//PDAT1/pdat1‐2 parent with transgenic constructs containing the Arabidopsis DGAT1 promoter fused to the AtDGAT1 open reading frame either with or without the first intron. Triple homozygous plants were obtained, however, in the absence of the DGAT1 first intron anthers fail to fill with pollen, seed yield is c. 10% of wild‐type, seed oil content remains reduced (similar to dgat1‐1/dgat1‐1), and non‐Mendelian segregation of the PDAT1/pdat1‐2 locus occurs. Whereas plants expressing the AtDGAT1pro:AtDGAT1 transgene containing the first intron mostly recover phenotypes to wild‐type. This study establishes that a combination of the promoter and first intron of AtDGAT1 provides the proper context for temporal and tissue‐specific expression of AtDGAT1 in pollen. Furthermore, we discuss possible mechanisms of intron mediated regulation and how regulatory elements can be used as genetic tools to functionally replace TAG biosynthetic enzymes in Arabidopsis. [ABSTRACT FROM AUTHOR]

SUMMARY Post‐embryonic primary root growth is effectively an interplay of several hormone signalling pathways. Here, we show that the ABA‐responsive transcription factor ABI3 controls primary root growth through the regulation of JA signalling molecule JAZ1 along with ABA‐responsive factor ABI1. In the absence of ABI3, the primary root elongation zone is shortened with significantly reduced cell length. Expression analyses and ChIP‐based assays indicate that ABI3 negatively regulates JAZ1 expression by occupying its upstream regulatory sequence and enriching repressive histone modification mark H3K27 trimethylation, thereby occluding RNAPII occupancy. Previous studies have shown that JAZ1 interacts with ABI1, the protein phosphatase 2C, that works during ABA signalling. Our results indicate that in the absence of ABI3, when JAZ1 expression levels are high, the ABI1 protein shows increased stability, compared to when JAZ1 is absent, or ABI3 is overexpressed. Consequently, in the abi3‐6 mutant, due to the higher stability of ABI1, reduced phosphorylation of plasma membrane H+‐ATPase (AHA2) occurs. HPTS staining further indicated that abi3‐6 root cell apoplasts show reduced protonation, compared to wild‐type and ABI3 overexpressing seedlings. Such impeded proton extrusion negatively affects cell length in the primary root elongation zone. ABI3 therefore controls cell elongation in the primary root by affecting the ABI1‐dependent protonation of root cell apoplasts. In summary, ABI3 controls the expression of JAZ1 and in turn modulates the function of ABI1 to regulate cell length in the elongation zone during primary root growth. [ABSTRACT FROM AUTHOR]

Summary The abscisic acid (ABA) signalling pathway plays a crucial role in plants’ response to drought stress. In this study, we aimed to characterize the impact of an ABA signalling module, which consisted of TaPYL9 and its downstream partners in Triticum aestivum, on plant drought adaptation. Our results showed that TaPYL9 protein contains conserved motifs and targets plasma membrane and nucleus after being sorted by the endoplasmic reticulum. In addition, TaPYL9 transcripts in both roots and leaves were significantly upregulated in response to drought stress. We conducted glucuronidase (GUS) histochemical staining analysis for transgenic plants carrying a truncated TaPYL9 promoter, which suggested that cis‐elements associate with ABA and drought response, such as ABRE, DRE and recognition sites MYB and MYC, regulating the gene transcription under drought conditions. Using protein interaction assays (i.e., yeast two‐hybrid, bimolecular fluorescence complementation (BiFC), co‐immunoprecipitation (Co‐IP) and in vitro pull‐down), we demonstrated interactions between the intermediate segment of TaPYL9, the intermediate segment of TaPP2C6, the N‐terminus of TaSnRK2.8 and the C‐terminus of the transcription factor TabZIP1 in wheat, indicating the involvement of TaPYL9 in the constitution of an ABA signalling module, namely TaPYL9/TaPP2C6/TaSnRK2.8/TabZIP1. Transgene analysis revealed that TaPYL9, TaSnRK2.8 and TabZIP1 positively regulated drought response, while TaPP2C6 negatively regulated it, and that these genes were closely associated with the regulation of stomata movement, osmolyte accumulation and ROS homeostasis. Electrophoretic mobility shift (EMSA) and transcriptioal activation assays indicated that TabZIP1 interacted promoters of TaP5CS2, TaSLAC1‐1 and TaCAT2 and activated transcription of these genes, which regulated proline biosynthesis, stomata movement and ROS scavenging upon drought signalling, respectively. Furthermore, we found that the transcripts of TaPYL9 and stress‐responsive genes were positively correlated with yields in wheat cultivars under field drought conditions. Altogether, our findings suggest that the TaPYL9‐involved signalling pathway significantly regulates drought response by modulating osmotic stress‐associated physiological processes in T. aestivum. [ABSTRACT FROM AUTHOR]

SUMMARY Tartary buckwheat is known for its ability to adapt to intricate growth conditions and to possess robust stress‐resistant properties. Nevertheless, it remains vulnerable to drought stress, which can lead to reduced crop yield. To identify potential genes involved in drought resistance, a genome‐wide association study on drought tolerance in Tartary buckwheat germplasm was conducted. A gene encoding pectin methylesterase inhibitors protein (FtPMEI13) was identified, which is not only associated with drought tolerance but also showed induction during drought stress and abscisic acid (ABA) treatment. Further analysis revealed that overexpression of FtPMEI13 leads to improved drought tolerance by altering the activities of antioxidant enzymes and the levels of osmotically active metabolites. Additionally, FtPMEI13 interacts with pectin methylesterase (PME) and inhibits PME activity in response to drought stress. Our results suggest that FtPMEI13 may inhibit the activity of FtPME44/FtPME61, thereby affecting pectin methylesterification in the cell wall and modulating stomatal closure in response to drought stress. Yeast one‐hybrid, dual‐luciferase assays, and electrophoretic mobility shift assays demonstrated that an ABA‐responsive transcription factor FtbZIP46, could bind to the FtPMEI13 promoter, enhancing FtPMEI13 expression. Further analysis indicated that Tartary buckwheat accessions with the genotype resulting in higher FtPMEI13 and FtbZIP46 expression exhibited higher drought tolerance compared to the others. This suggests that this genotype has potential for application in Tartary buckwheat breeding. Furthermore, the natural variation of FtPMEI13 was responsible for decreased drought tolerance during Tartary buckwheat domestication. Taken together, these results provide basic support for Tartary buckwheat breeding for drought tolerance. [ABSTRACT FROM AUTHOR]

The Snail superfamily of transcription factors plays a crucial role in metazoan development; one of the most important vertebrate members of this family is Snai1 which is orthologous to the Drosophila melanogaster esg gene. This review offers a comprehensive examination of the roles of the esg gene in Drosophila development, covering its expression pattern and downstream targets, and draws parallels between the vertebrate Snai1 family proteins on controlling the epithelial‐to‐mesenchymal transition and esg. This gene regulates stemness, ploidy, and pluripontency. esg is expressed in various tissues during development, including the gut, imaginal discs, and neuroblasts. The functions of the esg include the suppression of differentiation in intestinal stem cells and the preservation of diploidy in imaginal cells. In the nervous system development, esg expression also inhibits neuroblast differentiation, thus regulating the number of neurons and the moment in development of neuronal differentiation. Loss of esg function results in diverse developmental defects, including defects in intestinal stem cell maintenance and differentiation, and alters imaginal disc and nervous system development. Expression levels of esg also play a role in regulating longevity and metabolism in adult stages. This review provides an overview of the current understanding of esg's developmental role, emphasizing cellular and tissue effects that arise from its loss of function. The insights gained may contribute to a better understanding of evolutionary conserved developmental mechanisms and certain metabolic diseases. [ABSTRACT FROM AUTHOR]

Pancreatic cancer cells have a much higher metabolic demand than that of normal cells. However, the abundant interstitium and lack of blood supply determine the lack of nutrients in the tumour microenvironment. Although pancreatic cancer has been reported to supply extra metabolic demand for proliferation through autophagy and other means, the specific regulatory mechanisms have not yet been elucidated. In this study, we focused on transcription factor EB (TFEB), a key factor in the regulation of autophagy, to explore its effect on the phenotype and role in the unique amino acid utilisation pattern of pancreatic cancer cells (PCCs). The results showed that TFEB, which is generally highly expressed in pancreatic cancer, promoted the proliferation and metastasis of PCCs. TFEB knockdown inhibited the proliferation and metastasis of PCCs by blocking the catabolism of branched‐chain amino acids (BCAAs). Concerning the mechanism, we found that TFEB regulates the catabolism of BCAAs by regulating BCAT1, a key enzyme in BCAA metabolism. BCAA deprivation alone did not effectively inhibit PCC proliferation. However, BCAA deprivation combined with eltrombopag, a drug targeting TFEB, can play a two‐pronged role in exogenous supply deprivation and endogenous utilisation blockade to inhibit the proliferation of pancreatic cancer to the greatest extent, providing a new therapeutic direction, such as targeted metabolic reprogramming of pancreatic cancer. [ABSTRACT FROM AUTHOR]

The in‐depth mechanisms of microRNA regulation of premature ovarian failure (POF) remain unclear. Crispr‐cas9 technology was used to construct transgenic mice. The qPCR and Western blot was used to detect the expression level of genes. H&E staining were used to detect ovarian pathological phenotypes. We found that the expression levels of microRNA‐3061 were significantly higher in ovarian granulosa cells (OGCs) of POF mouse models than in controls. The miR‐3061+/−/AMH‐Cre+/− transgenic mice manifested symptoms of POF. RNA‐Seq and luciferase reporter assay confirmed that the PAX7 was one of the target genes negatively regulated by microRNA‐3061 (miR‐3061–5p). Moreover, PAX7 mediated the expression of non‐canonical Wnt/Ca2+ signalling pathway by binding to the motifs of promoters to stimulate the transcriptional activation of Wnt5a and CamK2a. In contrast, specific knock‐in of microRNA‐3061 in OGCs significantly downregulated the expression levels of PAX7 and inhibited the expression of downstream Wnt/Ca2+ signalling pathway. We also discerned a correlation between the expression levels of mRNAs of the Wnt/Ca2+ signalling pathway and the levels of E2 and FSH in POF patients by examining gene expression in the follicular fluid‐derived exosomes of women. We confirmed that overexpression of microRNA‐3061 induced proliferative inhibition of OGCs and ultimately induced POF in mice by suppressing the transcription factor PAX7 and downregulating expression levels of its downstream Wnt/Ca2+ signalling pathway genes. [ABSTRACT FROM AUTHOR]

Heat shock factor 2 (HSF2) is a versatile transcription factor that regulates gene expression under stress conditions, during development, and in disease. Despite recent advances in characterizing HSF2‐dependent target genes, little is known about the protein networks associated with this transcription factor. In this study, we performed co‐immunoprecipitation coupled with mass spectrometry analysis to identify the HSF2 interactome in mouse testes, where HSF2 is required for normal sperm development. Endogenous HSF2 was discovered to form a complex with several adhesion‐associated proteins, a finding substantiated by mass spectrometry analysis conducted in human prostate carcinoma PC‐3 cells. Notably, this group of proteins included the focal adhesion adapter protein talin‐1 (TLN1). Through co‐immunoprecipitation and proximity ligation assays, we demonstrate the conservation of the HSF2‐TLN1 interaction from mouse to human. Additionally, employing sequence alignment analyses, we uncovered a TLN1‐binding motif in the HSF2 C terminus that binds directly to multiple regions of TLN1 in vitro. We provide evidence that the 25 C‐terminal amino acids of HSF2, fused to EGFP, are sufficient to establish a protein complex with TLN1 and modify cell–cell adhesion in human cells. Importantly, this TLN1‐binding motif is absent in the C‐terminus of a closely related HSF family member, HSF1, which does not form a complex with TLN1. These results highlight the unique molecular characteristics of HSF2 in comparison to HSF1. Taken together, our data unveil the protein partners associated with HSF2 in a physiologically relevant context and identifies TLN1 as the first adhesion‐related HSF2‐interacting partner. [ABSTRACT FROM AUTHOR]

SUMMARY: Cold stress restricts the metabolic and physiological activities of plants, thereby affecting their growth and development. Although broad‐complex, tramtrack, and bric‐à‐brac (BTB) proteins are essential for diverse biological processes and stress responses, the mechanisms underlying BTB‐mediated cold responses remain not fully understood. Here, we characterize the function of the cold‐induced SlBTB19 protein in tomato (Solanum lycopersicum). Overexpression of SlBTB19 resulted in increased plant sensitivity to cold stress, whereas SlBTB19 knockout mutants exhibited a cold‐tolerance phenotype. Further analyses, including protein–protein interaction studies and cell‐free degradation assays, revealed that SlBTB19 interacts with and destabilizes the transcription factor SlWRKY2. Using virus‐induced gene silencing (VIGS) to silence SlWRKY2 in both wild‐type and slbtb19 mutants, we provided genetic evidence that SlWRKY2 acts downstream of SlBTB19 in regulating cold tolerance. Importantly, we demonstrated that SlWRKY2 positively regulates cold tolerance in a CRT/DRE binding factor (CBF)‐dependent manner. Under cold stress, SlWRKY2 binds to the W‐box in the CBF1 and CBF3 promoters, directly activating their expression. In summary, our findings identify a SlBTB19‐SlWRKY2 module that negatively regulates the CBF‐dependent cold tolerance pathway in tomato. Significance Statement: Our findings not only contribute to the broader understanding of the molecular basis of plant responses to cold stress but also highlight the importance of post‐transcriptional mechanisms in regulating these responses. In summary, we proposed an updated model: A cold‐induced BTB family protein SlBTB19 negatively regulates cold tolerance. SlBTB19 interacts with and facilitates the proteolysis of the SlWRKY2 protein. SlWRKY2 is a positive regulator of cold tolerance, which activates cold‐responsive genes SlCBFs. [ABSTRACT FROM AUTHOR]

SUMMARY: In plants, RNA silencing constitutes a strong defense against viral infection, which viruses counteract with RNA‐silencing suppressors (RSSs). Understanding the interactions between viral RSSs and host factors is crucial for elucidating the molecular arms race between viruses and host plants. We report that the helicase motif (Hel) of the replicase encoded by apple stem grooving virus (ASGV)—the main virus affecting pear trees in China—is an RSS that can inhibit both local and systemic RNA silencing, possibly by binding double‐stranded (ds) siRNA. The transcription factor related to ABSCISIC ACID INSENSITIVE3/VIVIPAROUS1 from pear (PbRAV1) enters the cytoplasm and binds Hel through its C terminus, thereby attenuating its RSS activity by reducing its binding affinity to 21‐ and 24‐nt ds siRNA, and suppressing ASGV infection. PbRAV1 can also target p24, an RSS encoded by grapevine leafroll‐associated virus 2 (GLRaV‐2), with similar negative effects on p24's suppressive function and inhibition of GLRaV‐2 infection. Moreover, like the positive role of the PbRAV1 homolog from grapevine (VvRAV1) in p24's previously reported RSS activity, ASGV Hel can also hijack VvRAV1 and employ the protein to sequester 21‐nt ds siRNA, thereby enhancing its own RSS activity and promoting ASGV infection. Furthermore, PbRAV1 neither interacts with CP, an RSS encoded by grapevine inner necrosis virus, nor has any obvious effect on CP's RSS activity. Our results identify an RSS encoded by ASGV and demonstrate that PbRAV1, representing a novel type of RAV transcription factor, plays a defensive role against viral infection by targeting viral RSSs. Significance Statement: Our results demonstrate that the helicase motif (Hel) of the replicase encoded by apple stem grooving virus (ASGV) can suppress RNA silencing, and reveal that PbRAV1, a novel type of RAV transcription factor, targets two unrelated viral RSSs—ASGV Hel and GLRaV‐2 p24—to attenuate their RSS activity, thereby suppressing viral infection. [ABSTRACT FROM AUTHOR]

Sorghum is a crop that is susceptible to low temperatures. However, due to the extreme global temperatures, new genotypes have been bred to adapt better to cold climates. Therefore, to better understand the metabolic and molecular differences that may contribute to the improved cold tolerance of these genotypes, it is essential to investigate whether specific molecules play a key role in determining the degree of sorghum tolerance. Furthermore, identifying genes associated with cold tolerance may assist in the development of more robust and productive sorghum cultivars. Here, we analysed the changes in selected elements of the antioxidant metabolism, genes, and miRNAs in two sorghum varieties with different degrees of tolerance to cold stress at different times of exposure to cold stress. The high expression of SbCBF6 in response to cold treatment in early time in the tolerant variety suggests its involvement in the cold response, thereby facilitating a better adaptation of the plant to cold conditions. MiR398 and miR394 showed contrasting behaviour in both varieties in low temperatures, resulting in interesting miRNAs in the degree of sorghum tolerance. MiR319, a marker for the selection of cold‐tolerant cultivars, presents a decrease, suggesting that the better capacity to repress the expression of several members of TCP family of transcription factor genes might be involved in better tolerance to cold stress. This study shows the changes of molecules of interest in response to cold stress in sorghum, marking the difference between cold‐susceptible and cold‐tolerant sorghum plants, which can contribute to selecting tolerant genotypes, allowing new strategies to enhance crop productivity and food security, in regions where low temperatures significantly constrain crop growth and yield. [ABSTRACT FROM AUTHOR]

WRKY transcription factor (TF) family is well known to govern essential physiological functioning as well as regulate plant response to biotic and abiotic stress. In this study, we have identified 108 OsWRKY genes in the genome of Oryza sativa subsp. japonica, using the updated genomic data from the Rice Annotation Project Database and Oryzabase, which were further used to conduct the phylogenetic study, motif analysis, gene structure analysis, chromosomal mapping, and prediction of sub‐cellular localization. The multiple sequence alignment OsWRKY proteins revealed the presence of nine different types of alterations in the conserved heptapeptide sequence WRKYGQK associated with 19 OsWRKY genes. Physiochemical analysis discloses the hydrophobic amino acid‐rich, thermally stable, and polar nature of OsWRKY proteins. These genes were noted as highly conserved between the two cultivated sub‐species of Oryza sativa, that is Indica and japonica type. Additionally, from motif analysis, we have found a new motif, which was categorized as hAT family C‐terminal dimerization region associated with four members of group IIc. We have identified 21 stress‐responsive OsWRKY genes, and their significance to the different biotic and abiotic stress‐mediated cascades was further evaluated by analysing 1500 kb upstream sequences and this disclosed the presence of important phytohormone‐responsive cis‐elements in the OsWRKY gene, suggesting its direct involvement in defence against a wide range of external stressors and these 21 OsWRKY genes are tentatively listed as possible candidates for more study. [ABSTRACT FROM AUTHOR]

ABSTRACT Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP‐type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid‐maturity stage. Co‐analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL‐like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular‐assisted breeding efforts aimed at establishing high‐protein soybean varieties. [ABSTRACT FROM AUTHOR]

ABSTRACT The increasing contamination of agricultural soils with cadmium (Cd) poses a significant threat to human health and global food security. Plants initiate a series of mechanisms to reduce Cd toxicity. However, the response of maize to Cd toxicity remains poorly understood. In this study, we identified that ZmHMT3, which encodes a homocysteine S‐methyltransferases family protein, acted as a regulator of Cd tolerance in maize. Subcellular localization and in situ PCR exhibited that ZmHMT3 was localized in the cytoplasm and predominantly expressed in the phloem. Overexpression of ZmHMT3 enhanced Cd tolerance and reduced Cd concentration in both shoots and roots. In contrast, ZmHMT3 mutants attenuated Cd tolerance but did not change shoot Cd concentration. Heterologous overexpression of ZmHMT3 in rice enhanced Cd tolerance and reduced grain Cd concentration. Transcriptome analysis revealed that ZmHMT3 upregulated the expression of stress‐responsive genes, especially glutathione S‐transferases (GSTs) and transcription factors, including MYBs, NACs and WRKYs, and modulates the expression of different ATP‐binding cassette (ABC) transporters, thereby enhancing Cd tolerance. Collectively, these findings highlight the pivotal role of ZmHMT3 in Cd tolerance and as a candidate gene for improving Cd tolerance in elite maize varieties. [ABSTRACT FROM AUTHOR]

SUMMARY Manipulating plant height is an essential component of crop improvement. Plant height was generally reduced through breeding in wheat, rice, and sorghum to resist lodging and increase grain yield but kept high for bioenergy crops. Here, we positionally cloned a plant height quantitative trait locus (QTL) qHT7.1 as a MYB transcription factor controlling internode elongation, cell proliferation, and cell morphology in sorghum. A 740 bp transposable element insertion in the intronic region caused a partial mis‐splicing event, generating a novel transcript that included an additional exon and a premature stop codon, leading to short plant height. The dominant allele had an overall higher expression than the recessive allele across development and internode position, while both alleles' expressions peaked at 46 days after planting and progressively decreased from the top to lower internodes. The orthologue of qHT7.1 was identified to underlie the brachytic1 (br1) locus in maize. A large insertion in exon 3 and a 160 bp insertion at the promoter region were identified in the br1 mutant, while an 18 bp promoter insertion was found to be associated with reduced plant height in a natural recessive allele. CRISPR/Cas9–induced gene knockout of br1 in two maize inbred lines showed significant plant height reduction. These findings revealed functional connections across natural, mutant, and edited alleles of this MYB transcription factor in sorghum and maize. This enriched our understanding of plant height regulation and enhanced our toolbox for fine‐tuning plant height for crop improvement. [ABSTRACT FROM AUTHOR]

Morphine tolerance (MT) is currently a challenging issue related to intractable pain treatment. Studies have shown that reactive oxygen species (ROSs) derived from NADPH oxidase (NOX) and produced in response to endoplasmic reticulum (ER) stress participate in MT development. However, which NOX subtype initiates ER stress during MT development is unclear. NOX4 is mainly expressed on intracellular membranes, such as the ER and mitochondrial membranes, and its sole function is to produce ROS. Whether NOX4 is activated during MT development and the mechanisms underlying the association between NOX4 and ER stress during this process still need to be confirmed. In our study, we used the classic morphine‐tolerant rat model and evaluated the analgesic effect of intrathecally injected morphine through a hot water tail‐flick assay. Our research demonstrated for the first time that chronic morphine administration upregulates NOX4 expression in the spinal cord by activating three ER stress sensors, protein kinase RNA‐like ER kinase (PERK), inositol‐requiring enzyme 1 (IRE1) and activating transcription factor 6 (ATF6), subsequently leading to the activation of microtubule‐associated protein 1 light chain 3 b (LC3B) and P62 (a well‐known autophagy marker) in GABAergic neurons. Our results may suggest that regulating NOX4 and the key mechanism underlying ER stress or autophagy may be a promising strategy to treat and prevent MT development. [ABSTRACT FROM AUTHOR]

Background and Aims: Cholangiocarcinoma (CCA) is an aggressive malignancy arising from the intrahepatic (iCCA) or extrahepatic (eCCA) bile ducts with poor prognosis and limited treatment options. Prior evidence highlighted a significant contribution of the non‐canonical NF‐κB signalling pathway in initiation and aggressiveness of different tumour types. Lymphotoxin‐β (LTβ) stimulates the NF‐κB‐inducing kinase (NIK), resulting in the activation of the transcription factor RelB. However, the functional contribution of the non‐canonical NF‐κB signalling pathway via the LTβ/NIK/RelB axis in CCA carcinogenesis and progression has not been established. Methods: Human CCA‐derived cell lines and organoids were examined to determine the expression of NF‐κB pathway components upon activation or inhibition. Proliferation and cell death were analysed using real‐time impedance measurement and flow cytometry. Immunoblot, qRT‐PCR, RNA sequencing and in situ hybridization were employed to analyse gene and protein expression. Four in vivo models of iCCA were used to probe the activation and regulation of the non‐canonical NF‐κB pathway. Results: Exposure to LTα1/β2 activates the LTβ/NIK/RelB axis and promotes proliferation in CCA. Inhibition of NIK with the small molecule inhibitor B022 efficiently suppresses RelB expression in patient‐derived CCA organoids and nuclear co‐translocation of RelB and p52 stimulated by LTα1/β2 in CCA cell lines. In murine CCA, RelB expression is significantly increased and LTβ is the predominant ligand of the non‐canonical NF‐κB signalling pathway. Conclusions: Our study confirms that the non‐canonical NF‐κB axis LTβ/NIK/RelB drives cholangiocarcinogenesis and represents a candidate therapeutic target. [ABSTRACT FROM AUTHOR]

Summary: Branch length is an important plant architecture trait in cotton (Gossypium) breeding. Development of cultivars with short branch has been proposed as a main object to enhance cotton yield potential, because they are suitable for high planting density. Here, we report the molecular cloning and characterization of a semi‐dominant quantitative trait locus, Short Branch Internode 1(GhSBI1), which encodes a NAC transcription factor homologous to CUP‐SHAPED COTYLEDON 2 (CUC2) and is regulated by microRNA ghr‐miR164. We demonstrate that a point mutation found in sbi1 mutants perturbs ghr‐miR164‐directed regulation of GhSBI1, resulting in an increased expression level of GhSBI1. The sbi1 mutant was sensitive to exogenous gibberellic acid (GA) treatments. Overexpression of GhSBI1 inhibited branch internode elongation and led to the decreased levels of bioactive GAs. In addition, gene knockout analysis showed that GhSBI1 is required for the maintenance of the boundaries of multiple tissues in cotton. Transcriptome analysis revealed that overexpression of GhSBI1 affects the expression of plant hormone signalling‐, axillary meristems initiation‐, and abiotic stress response‐related genes. GhSBI1 interacted with GAIs, the DELLA repressors of GA signalling. GhSBI1 represses expression of GA signalling‐ and cell elongation‐related genes by directly targeting their promoters. Our work thus provides new insights into the molecular mechanisms for branch length and paves the way for the development of elite cultivars with suitable plant architecture in cotton. [ABSTRACT FROM AUTHOR]

Summary: As an essential macronutrient, phosphorus (P) is often a limiting nutrient because of its low availability and mobility in soils. Drought is a major environmental stress that reduces crop yield. How plants balance and combine P‐starvation responses (PSRs) and drought resistance is unclear. In this study, we identified the transcription factor ZmPHR1 as a major regulator of PSRs that modulates phosphate (Pi) signaling and homeostasis. We found that maize zmphr1 mutants had reduced P concentration and were sensitive to Pi starvation, whereas ZmPHR1‐OE lines displayed elevated Pi concentration and yields. In addition, 57% of PSR genes and nearly 70% of ZmPHR1‐regulated PSR genes in leaves were transcriptionally responsive to drought. Under moderate and early drought conditions, the Pi concentration of maize decreased, and PSR genes were up‐regulated before drought‐responsive genes. The ZmPHR1‐OE lines exhibited drought‐resistant phenotypes and reduced stomatal apertures, whereas the opposite was true of the zmphr1 mutants. ZmPT7‐OE lines and zmspx3 mutants, which had elevated Pi concentration, also exhibited drought resistance, but zmpt7 mutants were sensitive to drought. Our results suggest that ZmPHR1 plays a central role in integrating Pi and drought signals and that Pi homeostasis improves the ability of maize to combat drought. [ABSTRACT FROM AUTHOR]

Summary: The Arabidopsis BLADE‐ON‐PETIOLE (BOP) genes are primarily known for their roles in regulating leaf and floral patterning. However, the broader functions of BOPs in regulating plant traits remain largely unexplored. In this study, we investigated the role of the Gossypium hirsutum BOP1 gene in the regulation of fibre length and plant height through the brassinosteroid (BR) signalling pathway. Transgenic cotton plants overexpressing GhBOP1 display shorter fibre lengths and reduced plant height compared to the wild type. Conversely, GhBOP1 knockdown led to increased plant height and longer fibre, indicating a connection with phenotypes influenced by the BR pathway. Our genetic evidence supports the notion that GhBOP1 regulates fibre length and plant height in a GhBES1‐dependent manner, with GhBES1 being a major transcription factor in the BR signalling pathway. Yeast two‐hybrid, luciferase complementation assay and pull‐down assay results demonstrated a direct interaction between GhBOP1 and GhSUMO1, potentially forming protein complexes with GhBES1. In vitro and in vivo SUMOylation analyses revealed that GhBOP1 functions in an E3 ligase‐like manner to mediate GhBES1 SUMOylation and subsequent degradation. Therefore, our study not only uncovers a novel mechanism of GhBES1 SUMOylation but also provides significant insights into how GhBOP1 regulates fibre length and plant height by controlling GhBES1 accumulation. [ABSTRACT FROM AUTHOR]

Summary: Isoxaben is a pre‐emergent herbicide used to control broadleaf weeds. While the phytotoxic mechanism is not completely understood, isoxaben interferes with cellulose synthesis. Certain mutations in cellulose synthase complex proteins can confer isoxaben tolerance; however, these mutations can cause compromised cellulose synthesis and perturbed plant growth, rendering them unsuitable as herbicide tolerance traits. We conducted a genetic screen to identify new genes associated with isoxaben tolerance by screening a selection of Arabidopsis thaliana T‐DNA mutants. We found that mutations in a FERREDOXIN‐NADP(+) OXIDOREDUCTASE‐LIKE (FNRL) gene enhanced tolerance to isoxaben, exhibited as a reduction in primary root stunting, reactive oxygen species accumulation and ectopic lignification. The fnrl mutant did not exhibit a reduction in cellulose levels following exposure to isoxaben, indicating that FNRL operates upstream of isoxaben‐induced cellulose inhibition. In line with these results, transcriptomic analysis revealed a highly reduced response to isoxaben treatment in fnrl mutant roots. The fnrl mutants displayed constitutively induced mitochondrial retrograde signalling, and the observed isoxaben tolerance is partially dependent on the transcription factor ANAC017, a key regulator of mitochondrial retrograde signalling. Moreover, FNRL is highly conserved across all plant lineages, implying conservation of its function. Notably, fnrl mutants did not show a growth penalty in shoots, making FNRL a promising target for biotechnological applications in breeding isoxaben tolerance in crops. [ABSTRACT FROM AUTHOR]

Oral squamous cell carcinoma (OSCC) is the most common oral malignancy. DEAD/H‐box helicase 11 (DDX11), a DNA helicase, has been implicated in the progression of several cancers. Yet, the precise function of DDX11 in OSCC is poorly understood. The DDX11 expression in OSCC cells and normal oral keratinocytes was evaluated in the Gene Expression Omnibus database (GSE146483 and GSE31853). SCC‐4 and CAL‐27 cells expressing doxycycline‐inducible DDX11 or DDX11 shRNA were generated by lentiviral infection. The role of DDX11 in OSCC cells was determined by 3‐(4, 5‐Dimethylthiazol‐2‐yl)‐2, 5‐diphenyltetrazolium bromide assay, colony formation assay, flow cytometry assay, TUNEL staining, and western blot. The effects of DDX11 on tumor growth were explored in a xenograft nude mouse model. The relationship between DDX11 and transcription factor Yin Yang‐1 (YY1) was researched using the dual luciferase report assay and chromatin immunoprecipitation assay. DDX11 expression was significantly upregulated in OSCC cells. Knockdown of DDX11 inhibited cell proliferation, induced cell cycle arrest, and suppressed PI3K‐AKT pathway, while DDX11 overexpression showed opposite effects. The number of apoptotic cells was increased in DDX11 silenced cells. DDX11 upregulation or knockdown accelerated or suppressed tumor growth in vivo, respectively. Moreover, the YY1 bound and activated the DDX11 promoter, resulting in increasing DDX11 expression. Forced expression DDX11 reversed the anticancer effects of YY1 silencing on OSCC cells. DDX11 has tumor‐promoting function in OSCC and is transcriptionally regulated by YY1, indicating that DDX11 may serve as a potential target for the OSCC treatment. [ABSTRACT FROM AUTHOR]

BACKGROUND: This study aimed to elucidate the mechanism of oleuropein (OLE) ameliorates non‐alcoholic fatty liver disease (NAFLD) and its underlying mechanisms. RESULTS: Male C57BL/6J mice were fed either a low‐fat diet (LFD), a high‐fat diet (HFD), or a HFD supplemented with 0.03% (w/w) OLE for 16 weeks. OLE supplementation decreased body weight and liver weight, improved serum lipid profiles, and ameliorated HFD‐induced hepatic dysfunction. Liver metabolomics analysis revealed that OLE increased the levels of nicotinamide, tauroursodeoxycholic acid, taurine, and docosahexaenoic acid, which were beneficial for lipid homeostasis and inflammation regulation. OLE exerted its protective effects by activating peroxisome proliferator‐activated receptor alpha (PPARα), a key transcription factor that regulates fibroblast growth factor 21 (FGF21) expression and modulates lipid oxidation, lipogenesis and inflammation pathways. Importantly, OLE supplementation did not significantly affect body weight or liver weight in PPARα knockout (PPARα KO) mice, indicating that PPARα is essential for OLE‐mediated NAFLD prevention. CONCLUSION: Our results suggest that OLE alleviates NAFLD in mice by activating PPARα and modulating liver metabolites. © 2024 Society of Chemical Industry. [ABSTRACT FROM AUTHOR]

Adipocyte enhancer‐binding protein 1 (AEBP1) is closely implicated in osteoblastic differentiation and bone fracture; this research aimed to investigate the effect of AEBP1 on restoring osteoblastic differentiation under dexamethasone (Dex) treatment, and its interaction with the phosphatidylinositol 3‐kinase (PI3K)/protein kinase B (AKT) pathway. Pre‐osteoblastic MC3T3‐E1 cells were cultured in osteogenic medium and treated by Dex to mimic steroid‐induced osteonecrosis cellular model. They were then further transfected with control or AEBP1‐overexpressed lentiviral vectors. Finally, cells were treated with the PI3K inhibitor LY294002, with or without AEBP1‐overexpressed lentiviral vectors. AEBP1 expression showed a downward trend in MC3T3‐E1 cells under Dex treatment in a dose‐dependent manner. AEBP1‐overexpressed lentiviral vectors increased relative cell viability, alkaline phosphatase (ALP) staining, Alizarin red staining and osteoblastic differentiation markers including osteocalcin (OCN), osteopontin (OPN), collagen type I alpha 1 (COL1A1), runt‐related transcription factor 2 (RUNX2) and bone morphogenetic protein 2 (BMP2), but decreased cell apoptosis rate in MC3T3‐E1 cells under Dex treatment; besides, AEBP1‐overexpressed lentiviral vectors positively regulated p‐PI3K and p‐AKT expressions. Furthermore, LY294002 treatment decreased relative cell viability, Alizarin red staining, osteoblastic differentiation markers including OCN, OPN, RUNX2 and BMP, increased cell apoptosis rate and did not affect ALP staining in MC3T3‐E1 cells under Dex treatment; meanwhile, LY294002 treatment weakened the effect of AEBP1 overexpression vectors on the above cell functions. AEBP1 restores osteoblastic differentiation under Dex treatment by activating the PI3K/AKT pathway. [ABSTRACT FROM AUTHOR]

Sepsis‐induced acute lung injury (ALI) is characterized by inflammatory damage to pulmonary endothelial and epithelial cells. The aim of this study is to probe the significance and mechanism of tripartite motif‐containing protein 21 (TRIM21) in sepsis‐induced ALI. The sepsis‐induced ALI mouse model was established by cecum ligation and puncture. The mice were infected with lentivirus and treated with proteasome inhibitor MG132. The lung respiratory damage, levels of interleukin‐6 (IL‐6), tumour necrosis factor α (TNF‐α), IL‐10 and pathological changes were observed. The expression levels of TRIM21, interferon regulatory factors 1 (IRF1) and triggering receptor expressed on myeloid cells 2 (TREM2) were measured and their interactions were analysed. The ubiquitination level of IRF1 was detected. TRIM21 and TREM2 were downregulated and IRF1 was upregulated in sepsis‐induced ALI mice. TRIM21 overexpression eased inflammation and lung injury. TRIM21 promoted IRF1 degradation via ubiquitination modification. IRF1 bonded to the TREM2 promoter to inhibit its transcription. Overexpression of IRF1 or silencing TREM2 reversed the improvement of TRIM21 overexpression on lung injury in mice. In conclusion, TRIM21 reduced IRF1 expression by ubiquitination to improve TREM2 expression and ameliorate sepsis‐induced ALI. [ABSTRACT FROM AUTHOR]

Epithelioid glioblastoma (eGB) is a rare and aggressive brain tumor that primarily affects children and young adults. This article presents a case study of a young adult male with eGB, describing the characteristics of the tumor and the genetic alterations commonly found in eGB. The patient had a poor prognosis and died four months after diagnosis. The article emphasizes the importance of recognizing and studying this rare subtype of glioblastoma to improve patient care and prognosis. Treatment options for eGB include BRAF and MEK inhibitor combination therapy. [Extracted from the article]

Summary: Plants frequently encounter adverse conditions and stress during their lives. Abscisic acid (ABA) plays a crucial role in response to salt stress, and dynamic regulation of ABA levels is essential for plant growth and stress resistance.In this study, we identified a transcription factor, OsSGL (Oryza sativa Stress tolerance and Grain Length), which acts as a negative regulator in salt stress, controlling ABA synthesis. OsSGL‐overexpressing and mutant materials exhibited sensitivity and tolerance to salt stress, respectively. Notably, under salt treatment, several ABA‐related genes, including the ABA synthesis enzyme OsNCED3 and the ABA response gene OsRAB21, were bound by OsSGL, leading to the inhibition of their transcription.Additionally, we found that a key enzyme involved in glycolysis, OsGAPC1, interacted with OsSGL and enhanced the inhibitory effect of OsSGL on OsNCED3. Upon salt stress, OsGAPC1 underwent acetylation and then translocated from the nucleus to the cytoplasm, partially alleviating the inhibitory effect of OsSGL on OsNCED3. Identification of the OsGAPC1‐OsSGL module revealed a negative regulatory mechanism involved in the response of rice to salt stress.This discovery provides insight into the dynamic regulation of ABA synthesis in plants under salt stress conditions, highlighting the delicate balance between stress resistance and growth regulation. [ABSTRACT FROM AUTHOR]

Living organisms have the capacity to respond to environmental stimuli, including warm conditions. Upon sensing mild temperature, plants launch a transcriptional response that promotes morphological changes, globally known as thermomorphogenesis. This response is orchestrated by different hormonal networks and by the activity of different transcription factors, including the heat shock factor A1 (HSFA1) family. Members of this family interact with heat shock protein 70 (HSP70) and heat shock protein 90 (HSP90); however, the effect of this binding on the regulation of HSFA1 activity or of the role of cochaperones, such as the HSP70‐HSP90 organizing protein (HOP) on HSFA1 regulation, remains unknown. Here, we show that AtHOPs are involved in the folding and stabilization of the HSFA1a and are required for the onset of the transcriptional response associated to thermomorphogenesis. Our results demonstrate that the three members of the AtHOP family bind in vivo to the HSFA1a and that the expression of multiple HSFA1a‐responsive‐responsive genes is altered in the hop1 hop2 hop3 mutant under warm temperature. Interestingly, HSFA1a is accumulated at lower levels in the hop1 hop2 hop3 mutant, while control levels are recovered in the presence of the proteasome inhibitor MG132 or the synthetic chaperone tauroursodeoxycholic acid (TUDCA). This uncovers the HSFA1a as a client of HOP complexes in plants and reveals the participation of HOPs in HSFA1a stability. Summary statement: This work describes that HOP cochaperones play a major role in thermomorphogenesis by modulating the stability of the HSFA1a in Arabidopsis. [ABSTRACT FROM AUTHOR]

Loss of Lon1 led to stunted plant growth and accumulation of nuclear‐encoded mitochondrial proteins including Lon1 substrates. However, an in‐depth label‐free proteomics quantification of mitochondrial proteins in lon1 revealed that the majority of mitochondrial‐encoded proteins decreased in abundance. Additionally, we found that lon1 mutants contained protein aggregates in the mitochondrial that were enriched in metabolic enzymes, ribosomal subunits and PPR‐containing proteins of the translation apparatus. These mutants exhibited reduced general mitochondrial translation as well as deficiencies in RNA splicing and editing. These findings support the role of Lon1 in maintaining a functional translational apparatus for mitochondrial‐encoded gene translation. Transcriptome analysis of lon1 revealed a mitochondrial unfolded protein response reminiscent of the mitochondrial retrograde signalling dependent on the transcription factor ANAC017. Notably, lon1 mutants exhibited transiently elevated ethylene production, and the shortened hypocotyl observed in lon1 mutants during skotomorphogenesis was partially alleviated by ethylene inhibitors. Furthermore, the short root phenotype was partially ameliorated by introducing a mutation in the ethylene receptor ETR1. Interestingly, the upregulation of only a select few target genes was linked to ETR1‐mediated ethylene signalling. Together this provides multiple steps in the link between loss of Lon1 and signalling responses to restore mitochondrial protein homoeostasis in plants. Summary statement: Plant Lon1 prevents the aggregation of mitochondrial proteins, including metabolic enzymes and components of the translational apparatus such as ribosomal and PPR proteins. Dysfunctional proteins within these aggregates inhibit the translation of mitochondrial‐encoded genes and trigger unfolded protein responses associated with ANAC017. [ABSTRACT FROM AUTHOR]