Search

4‐Hydroxy‐2,5‐dimethyl‐3(2H)‐furanone (HDMF) is a flavor compound widely found in natural products and is used in food as a flavor‐enhancing agent. Quinone oxidoreductase (QOR) was verified as a key enzyme to synthesize HDMF in strawberry, while its impact on HDMF production by Zygosaccharomyces rouxii was still unknown. The QOR gene was cloned and overexpressed in Z. rouxii, and its impact on HDMF production by Z. rouxii was then further analyzed. At the same time, it is expected to obtain engineered strains of Z. rouxii with high HDMF production. The results showed that the engineered strains of Z. rouxii exhibit different levels of QOR gene expression and HDMF production; among them, the QOR6 strain exhibiting the highest gene expression level and HDMF production was named as ZrQOR. The HDMF production of the ZrQOR strain was significantly higher than that of wild‐type Z. rouxii at 3 and 5 days of culture, with 1.41‐fold and 1.08‐fold increases, respectively. At 3 days of fermentation, the highest HDMF yield of ZrQOR strain was obtained (2.75 mg/L), 2 days ahead of the reported highest HDMF production by Z. rouxii. At 3, 5, and 7 days, QOR gene expression was 4.8‐fold, 3.3‐fold, and 5.6‐fold higher in the ZrQOR strain than in the wild‐type Z. rouxii, respectively. Therefore, overexpression of the QOR gene facilitates HDMF synthesis. The genetic stability of the 0–20 generation ZrQOR strain was stable, and there was no significant difference in colony shape, QOR expression, or HDMF production compared to the wild type. In this study, the genetic engineering Z. rouxii strain was used to improve HDMF production. This research has laid the groundwork for further industrial production of HDMF via microbial synthesis. [ABSTRACT FROM AUTHOR]

Although ventricular capture during the atrial threshold test is possible, there are rare reports on the insulation defect and inactive leads thereof. In this case, we present a pacemaker‐dependent patient with a history of pacemaker generator replacements. The patient experienced ventricular capture induced by atrial pacing due to adhesion of the atrial and ventricular leads with an insulation defect. The atrial lead was abandoned and a new lead was implanted. However, there was a significant decrease in ventricular impedance detected shortly after the new lead was implanted. When observing the phenomenon of atrial pacing‐induced ventricular depolarization, one uncommon reason to consider is lead adhesive wear. It is important to pay attention to the contact and bending sites of the leads. [ABSTRACT FROM AUTHOR]

In this paper, a nonoverestimated adaptive prescribed performance sliding mode control algorithm based on time‐varying barrier function is proposed, for high‐order integrator systems subject to bounded but unknown disturbances. The developed algorithm has some remarkable features. Firstly, it is able to ensure that the system states are confined in a performance function from the initial instant. Secondly, it is easy‐implementable and some exponential stability and practical fixed‐time stability algorithms can be easily obtained. Finally, with the system states to be known, the size of the performance function is independent of the upper bound of the external disturbance. To show the efficiency of the developed algorithm, some numerical simulations are provided. [ABSTRACT FROM AUTHOR]

Peptides with suitable aggregation behavior and electrical properties are potential siRNA delivery vectors. However, identifying suitable peptides with ideal delivery and safety features is difficult owing to the variations in amino acid sequences. Here, a holistic program based on computer modeling and single‐cell RNA sequencing (scRNA‐seq) is used to identify ideal siRNA delivery peptides. Stage one of this program consists of a sequential screening process for candidates with ideal assembly and delivery ability; stage two is a cell subtype‐level analysis program that screens for high in vivo tissue safety. The leading candidate peptide selected from a library containing 12 amino acids showed strong lung‐targeted siRNA delivery capacity after hydrophobic modification. Systemic administration of these compounds caused the least damage to liver and lung tissues and has little impact on macrophage and neutrophil numbers. By loading STAT3 siRNA, strong anticancer effects are achieved in multiple models, including patient‐derived xenografts (PDX). This screening procedure may facilitate the development of peptide‐based RNA interference (RNAi) therapeutics. [ABSTRACT FROM AUTHOR]

Studies have shown that antidiabetic drugs can alter the gut microbiota. The hypoglycemic effects of the drugs can be attributed in part to certain species in the gut microbiome that help the drugs work more effectively. In addition, increasing energy expenditure via the induction of adipose tissue browning has become an appealing strategy to treat obesity and associated metabolic complications. Currently, glucagon‐like peptide‐1 receptor agonist (GLP‐1 RA) treatment for metabolic disorders such as obesity and type 2 diabetes has been widely studied. To determine the mechanism of a long‐acting GLP‐1 RA affects adipose tissue browning and the gut microbiome, we treated high‐fat diet mice with GLP‐1 RA and demonstrated that the drug can regulate adipose tissue browning. 16S rRNA and untargeted metabolomics assays suggested that it increased the abundance of bacterium Lactobacillus reuteri and decreased serum ceramide levels in mice. L. reuteri was negatively correlated with ceramide. We found that the mechanism of ceramide decline was alkaline ceramidase 2 (Acer2) overexpression. Moreover, L. reuteri can play a therapeutic synergistic role with GLP‐1 RA, suggesting that gut microbiota can be used as a part of the treatment of diabetes. [ABSTRACT FROM AUTHOR]

Kv2.1 is widely expressed in brain, and inhibiting Kv2.1 is a potential strategy to prevent cell death and achieve neuroprotection in ischemic stroke. Herein, an in silico model of Kv2.1 tetramer structure was constructed by employing the AlphaFold‐Multimer deep learning method to facilitate the rational discovery of Kv2.1 inhibitors. GaMD was utilized to create an ion transporting trajectory, which was analyzed with HMM to generate multiple representative receptor conformations. The binding site of RY785 and RY796(S) under the P‐loop was defined with Fpocket program together with the competitive binding electrophysiology assay. The docking poses of the two inhibitors were predicted with the aid of the semi‐empirical quantum mechanical calculation, and the IGMH results suggested that Met375, Thr376, and Thr377 of the P‐helix and Ile405 of the S6 segment made significant contributions to the binding affinity. These results provided insights for rational molecular design to develop novel Kv2.1 inhibitors. [ABSTRACT FROM AUTHOR]

In situ vaccination is a desirable strategy for cancer immunotherapy due to its convenience and capacity to target tumor antigens. Here, an in situ nanovaccine based on a cationic peptide with cholesterol‐modified, DP7‐C, for cancer immunotherapy is rationally designed, and developed a cancer nanovaccine that is easy to preparate. The nanovaccine includes cocktail small interfering RNAs (siRNAs) and immunologic adjuvant CpG ODNs, has synergistic effect in the cancer treatment. This nanovaccine can induce tumor cell death, promote antigen presentation and relieve immune suppression in the tumor microenvironment (TME). Moreover, this nanovaccine is administered to CT26 (hot) and B16F10 (cold) tumor model mice, in which it targeted the primary tumors and induced systemic antitumor immunity to inhibit metastasis. It is validated that the nanovaccine can convert cold tumors into hot tumors. Furthermore, the nanovaccine increased the immune response to anti‐PD‐1 therapy by modulating the TME in both CT26‐ and B16F10‐tumor‐bearing mice. The siRNA cocktail/CpG ODN/self‐assembling peptide nanovaccine is a simple and universal tool that can effectively generate specific tumor cell antigens and can be combined with immuno‐oncology agents to enhance antitumor immune activity. The versatile methodology provides an alternative approach for developing cancer nanovaccines. [ABSTRACT FROM AUTHOR]

Background: The study aimed to evaluate the prognostic value of preoperative systemic inflammation response index (SIRI) for acute type A aortic dissection (ATAD) following open surgery. Methods and results: Totally, 410 ATAD patients underwent open surgery from 2019 to 2021 were enrolled in the study. Among the patients, the in-hospital mortality was 14.4%. Cox regression (95%CI 1.033–1.114p < 0.001) and receiver operating characteristic curve analysis (AUC = 0.718, p < 0.001) demonstrated the prognostic role of SIRI for in-hospital mortality after surgery. The optimal cut-off value of SIRI for in-hospital mortality was identified as 9.43 by maximally selected Log-Rank statistics. The patients were divided into high SIRI group (SIRI ≥ 9.43) and low SIRI group (SIRI < 9.43)) after the linear inverse relationship between SIRI and hazard ratio for in-hospital mortality was demonstrated by restricted cubic spline analysis (p = 0.0742). The Kaplan–Meier analysis illustrated that in-hospital mortality increased significantly in high SIRI group (p < 0.001). In addition, elevating SIRI was significantly associated with the incidence of coronary sinus tear (95%CI 1.020–4.475p = 0.044). Furthermore, the incidence rate of postoperative complications including renal failure (p < 0.001) and infection (p = 0.019) was higher in high SIRI group. Conclusion: The study indicated that preoperative SIRI could provide strong prognostic value for in-hospital mortality in ATAD patients following open surgery. Thus, SIRI was a promising biomarker for risk stratification and management prior to open surgery. [ABSTRACT FROM AUTHOR]

Currently, many prostate cancer patients, detected through the prostate specific antigen test, harbor organ‐confined indolent disease that cannot be differentiated from aggressive cancer according to clinically and pathologically known measures. Spermine has been considered as an endogenous inhibitor for prostate‐confined cancer growth and its expression has shown correlation with prostate cancer growth rates. If established clinically, measurements of spermine bio‐synthesis rates in prostates may predict prostate cancer growth and patient outcomes. Using rat models, we tested the feasibility of quantifying spermine bio‐synthesis rates with 13C NMR. Male Copenhagen rats (10 weeks, n = 6) were injected with uniformly 13C‐labeled L‐ornithine HCl, and were sacrificed in pairs at 10, 30, and 60 min after injection. Another two rats were injected with saline and sacrificed at 30 min as controls. Prostates were harvested and extracted with perchloric acid and the neutralized solutions were examined by 13C NMR at 600 MHz. 13C NMR revealed measurable ornithine, as well as putrescine‐spermidine‐spermine syntheses in rat prostates, allowing polyamine bio‐synthetic and ornithine bio‐catabolic rates to be calculated. Our study demonstrated the feasibility of 13C NMR for measuring bio‐synthesis rates of ornithine to spermine enzymatic reactions in rat prostates. The current study established a foundation upon which future investigations of protocols that differentiate prostate cancer growth rates according to the measure of ornithine to spermine bio‐synthetic rates may be developed. [ABSTRACT FROM AUTHOR]

Background: Ubiquitin‐mediated degradation of the Mas‐related G protein‐coupled receptor C (MrgC) reduces the number of receptors. However, the specific deubiquitinating enzyme antagonize this process has not been reported. In this study, we investigated the effect of ubiquitin‐specific protease‐48 (USP48) on bone cancer pain (BCP) and its effect on MrgC. Methods: A mouse model of BCP was established. BCP behaviours of mice were assessed after intrathecal injection of adeno‐associated virus (AAV)‐USP48. USP48 and MrgC interactions were studied by immunoprecipitation. Overexpression and knockdown of USP48 were conducted in N2a cells to investigate the effect of USP48 on MrgC receptor number and ubiquitination. Results: Spinal cord level USP48 expression was reduced in mice with BCP. Intrathecal injection of AAV‐USP48 increased paw withdrawal mechanical threshold and reduced spontaneous flinching in mice. In N2a cells, there were increased number of MrgC receptors after overexpression of USP48 and decreased number of MrgC receptors after knockdown of USP48. USP48 interacted with MrgC and overexpression of USP48 altered the level of ubiquitination of MrgC. Conclusion: USP48 antagonizes ubiquitin‐mediated autophagic degradation of MrgC and alleviates BCP in a murine animal model. Our findings may provide a new perspective for the treatment of BCP. Significance: Our finding may provide an important theoretical basis as well as an intervention target for clinical development of drugs for BCP. [ABSTRACT FROM AUTHOR]

Automatic parameter extraction of RPI Model for Polysilicon Thin‐Film Transistors is achieved by genetic algorithm(GA) and Particle swarm optimization(PSO) algorithm, and the solution of two algorithms are compared. Furthermore, mutual learning particle swarm optimization (MLPSO) algorithm is proposed, which simplifies the complex manual processes and the empirical calibration, and achieves accurate parameters extraction. [ABSTRACT FROM AUTHOR]

The clinical efficacy of personalized cancer vaccines still needs to be improved due to their insufficient immune effect. The development of innovative adjuvants and lymph node‐targeted delivery systems is the key to improving the clinical efficacy of personalized vaccines. However, there is still a lack of an adjuvant delivery system that is simple in preparation and capable of mass production and integrates adjuvant and lymph node targeted delivery functions. Here, this work reports that a simple dendrimer polypeptide (KK2DP7) nanoparticle enhances the immune efficacy of an OVA/neoantigen‐based vaccine. Due to its multiple functions as a delivery vehicle, immune adjuvant, and facilitator of dendritic cell migration, KK2DP7 efficiently increases the efficiency of antigen uptake and cross‐presentation by antigen‐presenting cells (APCs) and delivers antigens to lymph nodes via APCs. Strikingly, the antitumor effect of KK2DP7/OVA is superior to that of commonly used adjuvants such as poly(I:C), CpG, and aluminum adjuvant combined with OVA. Furthermore, KK2DP7/OVA combined with anti‐PD‐1 antibody is able to prevent tumor recurrence in a postoperative recurrent tumor model. Thus, KK2DP7‐based cancer vaccines alone or in combination with immune checkpoint blockade therapies to treat tumors or postoperative tumor recurrence are a powerful strategy to enhance antitumor immunity. [ABSTRACT FROM AUTHOR]

The development of integrated circuits for displays and other applications requires semiconductor device models and appropriate parameter extraction techniques to predict and understand the circuit behavior. These techniques are paramount in reducing design errors and shortening the product development cycle. This paper presents an algorithm that employed swarm intelligence in exploring an automated and accurate parameter extraction technology. First, an automatic parameter extraction of Rensselaer Polytechnic Institute (RPI) Model for polysilicon thin-film transistor (Poly-Si TFT) is achieved by genetic algorithm (GA) and particle swarm optimization (PSO) algorithm. Compared with the best solution of the GA algorithm for automatic parameter extraction, the PSO outperformed the GA. However, it still prematurely converges to the suboptimal solution henceforth cannot obtain the expected solution accuracy. Second, the mutual learning particle swarm optimization (MLPSO) algorithm is proposed that introduces the concept of "mutual learning." The new algorithm aims to find the global optimum in getting suitable trade-off between exploration and exploitation. In addition, the MLPSO algorithm implemented the novel random initialization and fitness function in simplifying the complex manual processes and the empirical calibration, and it led to achieving automatic and accurate parameters extraction. [ABSTRACT FROM AUTHOR]

The detection of ultraviolet (UV) radiation with effective performance and robust stability is essential to practical applications. Metal halide single‐crystal perovskites (ABX3) are promising next‐generation materials for UV detection. The device performance of all‐inorganic CsPbCl3 photodetectors (PDs) is still limited by inner imperfection of crystals grown in solution. Here wafer‐scale single‐crystal CsPbCl3 thin films are successfully grown by vapor‐phase epitaxy method, and the as‐constructed PDs under UV light illumination exhibit an ultralow dark current of 7.18 pA, ultrahigh ON/OFF ratio of ≈5.22 × 105, competitive responsivity of 32.8 A W−1, external quantum efficiency of 10867% and specific detectivity of 4.22 × 1012 Jones. More importantly, they feature superb long‐term stability toward moisture and oxygen within twenty‐one months, good temperature tolerances at low and high temperatures. The ability of the photodetector arrays for excellent UV light imaging is further demonstrated. [ABSTRACT FROM AUTHOR]

Objective: Therapy of very severe osteoporotic compression fractures (VSOVCF) has been a growing challenge for spine surgeons. Opinions vary regarding the optimal surgical procedure for the treatment of VSOVCF and which internal fixation method is more effective is still under debate, and research on this topic is lacking. This retrospective study was conducted to compare the efficacy and safety of various pedicle screw fixation methods for treating VSOVCF. Methods: This single‐center retrospective comparative study was conducted between January 2015 and September 2020. Two hundred and one patients were divided into six groups according to different surgical methods: 45 patients underwent long‐segment fixation (Group 1); 39 underwent short‐segment fixation (Group 2); 30 received long‐segment fixation with cement‐reinforced screws (Group 3); 32 received short‐segment fixation with cement‐reinforced screws (Group 4); 29 had long‐segment fixation combined with kyphoplasty (PKP) (Group 5); and 26 cases had short‐segment fixation combined with PKP (Group 6). The clinical records were reviewed and the visual analogue scale (VAS) score and the Oswestry Disability Index (ODI) score were used for clinical evaluation. The vertebral height (VH), fractured vertebral body height (FVBH), and Cobb's angle were objectively calculated and analyzed on lateral plain radiographs. Student's t‐tests and one‐way ANOVA among groups were conducted to analyze the continuous, and the chi‐squared test was used to compare the dichotomous or categorical variables. The difference was considered statistically significant when the P‐value was less than 0.05. Results: The six groups had similar distributions in age, gender, course of the disease, follow‐up period, and injured level. In the postoperative assessment of the VAS score, the surgical intervention most likely to rank first in terms of pain relief was the short‐segment fixation with cement‐reinforced screws (Group 4). For the functional evaluation, the surgical intervention that is most likely to rank first in terms of ODI score was a short‐segment fixation with cement‐reinforced screws (Group 4), followed by long‐segment fixation (Group 1). The long‐segment fixation with cement‐reinforced screws was the first‐ranked surgical intervention for the maintenance of Cobb's angle and vertebral height, whereas the short‐segment fixation performed the worst. The highest overall complication rate was in Group 6 with an incidence of 42.3% (11/26), followed by Group 2 with an incidence of 38.5% (15/39). Conclusion: For the treatment of VSOVCF, the short‐segment fixation with cement‐reinforced screws is the most effective and optimal procedure, and should be used as the preferred surgical method if surgeons are proficient in using cemented screws; otherwise, directly and unquestionably use long‐segment fixation to achieve satisfactory clinical results. [ABSTRACT FROM AUTHOR]

This article investigates the robust secure synchronization control of multiple neural networks (MNNs) systems with external random disturbances in the presence of actuator and sensor attacks. First, the types of attacks are analyzed in detail. Actuator attacks refers to the damage of control input signals transmitted through the network layer, and sensor attacks refers to the damage of communication channels between neural networks (NNs). Then, for the attacked NNs system, by introducing a novel neighborhood synchronization error, two novel integral sliding mode (ISM) functions with the event‐triggered mechanisms are designed. Based on this, a distributed event‐triggered adaptive ISM secure synchronization control scheme is proposed. It is worth noting that the control signal and adaptive parameters in the proposed scheme are only updated at the triggering time instants, which further saves the energy and resources consumed by the system. Next, the sufficient conditions for secure synchronization of MNNs system are obtained by constructing Lyapunov function and a positive lower bound of the internal execution time is ensured. Finally, a numerical example is given to demonstrate the effectiveness of the proposed secure synchronization control strategy. [ABSTRACT FROM AUTHOR]

Objective: Prevention of fragility fractures is one of the public health priorities worldwide, whilst the incidence of osteoporotic vertebral compression fractures (OVCF) continues to rise and lacks the corresponding accurate prediction model. This study aimed to screen potential causes and risk factors for primary non‐traumatic osteoporotic vertebral compression fractures (NTOVCF) in the elderly by characterizing a patient population with NTOVCF and comparing it with a population of osteoporotic patients. Methods: Between January 2013 and January 2022, 208 elderly patients with unequivocal evidence of bone fragility manifested as painful NTOVCF were enrolled, and compared with 220 patients with osteoporosis and no fractures. The demographic data, bone turnover markers, blood routine, serum biochemical values, and radiological findings were investigated. Differences between the fracture and non‐fracture groups were analyzed, and variables significant in univariate analysis and correlation analysis were included in the logistic analysis to build the risk prediction model for osteoporotic vertebral fractures. Univariate analysis using student's t‐tests for continuous variables or a chi‐squared test for categorical variables was conducted to identify risk factors. Results: No significant differences were revealed regarding age, gender, BMI, smoking, alcohol consumption, blood glucose, propeptide of type I procollagen (P1NP), and N‐terminal middle segment osteocalcin (N‐MID) (P > 0.05). Parathyroid Hormone (PTH), 25(OH)D, serum albumin (ALB), hemoglobin (HB), bone mineral density (BMD), and cross‐sectional area (CSA) of the paraspinal muscle in the fracture group were significantly lower than those in the control group; however, b‐C‐terminal telopeptide of type I collagen (β‐CTX), total cholesterol (TC), high‐density lipoprotein cholesterol (HDL‐C), non‐prostatic acid phosphatase (NACP), and fatty degeneration ratio (FDR) were significantly higher than those in the control group (P < 0.05). Logistic regression analysis showed that ALB, HB, CSA, and BMD were negatively correlated with NTOVCF, while β‐CTX, HDL‐C, NACP, and FDR were positively correlated with NTOVCF. Conclusion: Decreased physical activity, anemia, hypoproteinemia, imbalances in bone metabolism, abnormal lipid metabolism, and degenerative and decreased muscle mass, were all risk factors for OVCF in the elderly, spontaneous fractures may be the consequence of cumulative declines in multiple physiological systems over the lifespan. Based on this risk model, timely detection of patients with high OVCF risk and implementation of targeted preventive measures is expected to improve the effect of fracture prevention. [ABSTRACT FROM AUTHOR]

Background: Postoperative pulmonary oedema is an outstanding postoperative complexity brought about by numerous etiological variables and which can be effectively recognized through careful control during the postoperative period. Lung ultrasound (LUS) was utilized for the non‐obtrusive recognition of pulmonary oedema. Semi‐quantitative visual LUS scores (visual LUS [V‐LUS]) in light of B‐lines correspond decently with pulmonary capillary pressure (PCWP) and extravascular lung water (EVLW). Methods: Seventy‐eight patients with pulmonary resection and pulmonary ultrasound at the time of treatment were examined. Cardiopulmonary echocardiography was performed on the first day before and after the operation, and the oxygenation index (PaO2/FiO2) was measured after the operation. B‐lines from B‐score were measured through lung ultrasound. Each region was classified as "B0" if fewer than three B‐lines were identified in the entire intercostal space. "B1" if there were at least three B‐lines in at least one intercostal space, "B2" in the presence of the "white lung field". B‐score were recorded at baseline (T0, before operation), after 1 day (T1), after 2 days (T2), after 3 days (T3), after 5 days (T5), after 7 days (T7), after 9 days (T9). Statistical software was used for the measurement of statistical correlations. Results: (1) The total number of B‐lines is negatively correlated with oxygen and the index (r = −0.50, p < 0.001). (2) The B‐score appeared significantly with 86% of T1 to T3 and disappeared in 83% from T7 to T9 existed in 17% (3). The logistic regression analysis showed that the surgical method influenced the total number of B‐lines. Conclusions: LUS optimizes treatment by identifying subclinical pulmonary oedema, which facilitates early detection of pulmonary oedema and improves the prognosis. [ABSTRACT FROM AUTHOR]

Lithium metal batteries are highly desired for durable and high‐power energy storage devices due to high theoretical capacity and lowest redox potential. Nevertheless, high activity of Li, large volume change, and Li dendrite formation during cycling severely hinder their further application. Herein, an inventive Cu collector decorated with holey MoO2‐Mo3N2 heterojunction nanobelts‐coated reductive graphene oxide (G‐MoO2‐Mo3N2, GMM) for high‐performance Li metal batteries is reported. The collector features synergistic functions of remarkable lithiophilicity, a built‐in electric field formed by splendid interfacial contact, and dense lithiophilic‐enriched solid electrolyte interphase layer. They facilitate robust charge transfer and ionic diffusion, and meliorate inhomogenous Li‐ion flux for inhibiting the growth of dendrites. In addition, the incorporation of flexible graphene layer enhances the structural integrity and electron transport kinetics. Remarkably, it is demonstrated that GMM significantly enhances Coulombic efficiency of ≈99.5% over 1566 cycles (0.5 mA cm−2/0.5 mAh cm−2). Furthermore, excellent cycling and rate capability of full cells with the GMM@Cu anode and high areal loading of LiFePO4 cathode (22.2 mg cm−2) are also realized. This work illustrates the superiority of synergetic design of lithiophilic sites plus electron transport kinetics for the current collector of Li‐metal anode to seek the high energy density. [ABSTRACT FROM AUTHOR]

Two‐dimensional (2D) materials have attracted extensive attention due to their important prospects in electronics and optoelectronics. Synthesizing new 2D materials, characterizing their properties, and developing their applications are still important topics. Herein, the synthesis of α‐GeTe nanoplates on different substrates via the chemical vapor deposition process and the systematical investigation of their structure and electrical properties, is reported. By controlling the synthesis temperature and carrier gas, α‐GeTe nanoplates, with a lateral dimension up to 30 µm and a thickness down to 1.2 nm, which corresponds to the thickness of one unit cell, can be obtained on 2D WSe2 substrate. Electrical transport studies show 2D α‐GeTe nanoplates have an excellent conductivity (9.33 × 105 S m−1) and an extraordinary breakdown current density (6.1× 107 A cm−2). Compared with traditional WSe2 transistors with deposited metal electrodes, the WSe2 transistors with the metallic α‐GeTe nanoplates as van der Waals metal electrodes achieved much better performance, such as higher on‐state current (from 7.83 to 23.23 µA µm−1) and electron mobility (from 16.5 to 75.0 cm2 V1 S1). This study demonstrates an effective pathway to achieve ultrathin 2D materials and provides an accessible strategy to improve the performance of 2D electronic devices. [ABSTRACT FROM AUTHOR]

Soil organic carbon (SOC) dynamics is regulated by a complex interplay of factors such as climate and potential anthropogenic activities. Livestocks play a key role in regulating the C cycle in grasslands. However, the interrelationship between SOC and these drivers remains unclear at different soil layers, and their potential relationships network have rarely been quantitatively assessed. Here, we completed a six‐year manipulation experiment of grazing exclusion (no grazing: NG) and increasing grazing intensity (light grazing: LG, medium grazing: MG, heavy grazing: HG). We tested light fraction organic carbon (LFOC) and heavy fraction organic carbon (HFOC) in 12 plots along grazing intensity in three soil layers (topsoil: 0–10 cm, mid‐soil: 10–30 cm, subsoil: 30–50 cm) to assess the drivers of SOC. Grazing significantly reduced SOC of the soil profile, but with significant depth and time dependencies. (1) SOC and SOC stability of the topsoil is primarily regulated by grazing duration (years). Specifically, grazing duration and grazing intensity increased the SOC lability of topsoil due to an increase in LFOC. (2) Grazing intensity was the major factor affecting the mid‐soil SOC dynamics, among which MG had significantly lower SOC than did NG. (3) Subsoil organic carbon dynamics were mainly regulated by climatic factors. The increase in mean annual temperature (MAT) may have promoted the turnover of LFOC to HFOC in the subsoil. Synthesis and applications. When evaluating the impacts of grazing on soil organic fraction, we need to consider the differences in sampling depth and the duration of grazing years. Our results highlight that the key factors influencing SOC dynamics differ among soil layers. Climatic and grazing factors have different roles in determining SOC in each soil layer. [ABSTRACT FROM AUTHOR]

Triplet loss is widely used as the objective function in image‐text retrieval tasks. However, as all the triplets are treated equally, triplet loss has a bottleneck problem of slow convergence and other unsatisfactory performances. In this article, we propose solutions by appropriately weighting triplets according to the relative similarities among the training samples. Specifically, we present three weighting functions to assign an appropriate weight for the selected informative triplets to accelerate the convergence. We evaluate our approach on two widely used benchmark datasets: Flickr30k and MSCOCO, with results outperforming the previous methods, which demonstrates its superiority. [ABSTRACT FROM AUTHOR]

Neuroblastoma (NB) is the most common solid tumor of the sympathetic nervous system (SNS) arising in childhood less than 15 years age. Licochalcone (Lic) is known to show inhibitory effects in cancer growth, and there has evidence suggested that Lic A inhibits hypoxic induced NB SK‐N‐SH cell proliferation. However, it is unclear whether LicE exerts similar effects in NB and the associated molecular mechanism of Lic in neuroblastoma is still unclear. In the current study, we found that LicE at the concentration 2, 4 and 6 μM all induced a profound reduction in cell viability, colony formation and cell proliferation. Next, LicE treatment effectively promoted cell apoptosis, inhibited cell migration and invasion. LicE significantly suppressed trxR1 expression, activated Nrf2 expression and inhibited STAT6 expression in SH‐SY5Y and SK‐N‐BE(2) NB cells. We further identified that trxR1, STAT6 overexpression or Nrf2 silence reversed the antitumor effects of LicE in human SH‐SY5Y and SK‐N‐BE(2) NB cells. Finally, LicE treatment significantly inhibited tumor growth in nude mice carrying a SK‐N‐SH cell xenograft. These results provide new insights into the effects and highlighting a novel mechanism of LicE through regulating trxR1/Nrf2/STAT6 signal pathway in NB. [ABSTRACT FROM AUTHOR]

Since the complexity nonlinearities generated by discontinuous control and event‐triggered scheme, fixed‐time formation in event‐based framework is a more challenging issue compared with the continuous‐time control. This paper focuses on fixed‐time leaderless formation problem for multi‐agent systems with undirected topology. We propose a distributed robust event‐triggered control strategy for the fixed‐time formation where predictor‐based state transformation is employed to deal with input delay and sliding mode technology is implemented to solve bounded disturbances. We also obtain that the upper bound of the formation settling time is only determined by delay time, control design parameters, network connectivity, and independent of the initial conditions. In addition, the lower bound for the interexecution time is calculated to ensure that there is no Zeno behavior occurs. Finally, some numerical simulations are presented to show the effectiveness of the strategies. [ABSTRACT FROM AUTHOR]

Due to the short course and high mortality of acute myocardial infarction (AMI) which will cause irreversible myocardial necrosis to induce cardiac arrest, its early diagnosis within minutes is always a challenge in clinical emergency. In this work, an ultrafast and ultrasensitive aptasensor is designed to achieve quantitatively detection of cardiac troponin I (cTnI) which is proved as a highly specific and sensitive biomarker to AMI, and within only 4 min, the cTnI concentration can be accurately reported. This aptasensor is constructed via an in situ growth of the oriented Pt‐polyaniline (PANI) needle‐like nanoarrays providing both high electrocatalysis and abundant active sites as the signal magnifier and DNA carrier. A target‐induced strand release strategy is proposed to remarkably accelerate the recognition process of cTnI through the specific design of DNA stand for binding. The as‐prepared aptasensor can exhibit an ultrawide linear detection range of cTnI from 1 pg mL−1 to 100 ng mL−1 satisfying the clinical demand for AMI diagnosis, together with excellent selectivity among various biomarkers. Based on its fast recognition ability, this aptasensor presents a high accuracy in the practical detection of human serum to prove its promising ability in the early and on‐site diagnosis of AMI. [ABSTRACT FROM AUTHOR]

The Western Land Data Assimilation System (WLDAS) is a custom instance of the NASA Land Information System that combines land surface parameters, meteorological forcing data, and satellite products within a land surface model to produce daily estimates of the water and energy budget variables for the western United States. WLDAS was configured through discussions with partners, with the goal of groundwater sustainability planning for the state of California in mind. The publicly available output dataset has a 1-km grid resolution and spans 1979--present, which makes it suitable for water resources assessments. The data are also able to contextualize the recent drought events in California. Assimilation of Leaf Area Index, which is demonstrated herein to improve simulation over agricultural areas in California, specifically in terms of evapotranspiration in irrigation regions, will be included along with other data assimilation in subsequent releases of WLDAS. [ABSTRACT FROM AUTHOR]

Background: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. Methods: The present study aimed to identify the genetic etiologies of a three‐generation family with postaxial polydactyly and a four‐generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. Results: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly‐Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly‐Ala position is highly conserved. Hypothetical three‐dimensional (3‐D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short β‐strand (residues 63‐68 or residues 64‐68), thereby forming a conformational change. Conclusions: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management. Key Findings: Hereditary limb malformation, whole‐exome sequencing, HOXD13 gene, nonframeshifting indel [ABSTRACT FROM AUTHOR]

A naphthalene‐containing dicarboxylic ligand, 4‐(carboxymethoxy)‐6‐methyl‐1‐(p‐tolyl)‐2‐naphthoic acid (Hcmtna), is synthesized and used to construct a coordination compound, Co(H2O)4(cmtna)2 (Co‐cmtna), through the hydrothermal strategy. The moderate rigidity and flexibility of the organic molecule result a low coordination number of cobalt ion with the ligand and provide more possibilities for potential applications. Experimental results show that the fluorescence of Co‐cmtna can be quenched by multiple objects, including antibiotics, pesticides, and metal ions, which make it possible as a multifunctional sensor. More interestingly, Co‐cmtna has interactions with human serum albumin in the phosphate‐buffered saline solution, which are detailed studied by the site binding model formula, thermodynamic formula, and Föster nonradiative energy transfer mechanism. [ABSTRACT FROM AUTHOR]

Nerve injury‐induced maladaptive changes of gene expression in dorsal root ganglion (DRG) neurons contribute to neuropathic pain. Long non‐coding RNAs (lncRNAs) are emerging as key regulators of gene expression. Here, a conserved lncRNA is reported, named DRG‐specifically enriched lncRNA (DS‐lncRNA) for its high expression in DRG neurons. Peripheral nerve injury downregulates DS‐lncRNA in injured DRG due, in part, to silencing of POU domain, class 4, transcription factor 3, a transcription factor that interacts with the DS‐lncRNA gene promoter. Rescuing DS‐lncRNA downregulation blocks nerve injury‐induced increases in the transcriptional cofactor RALY‐triggered DRG Ehmt2 mRNA and its encoding G9a protein, reverses the G9a‐controlled downregulation of opioid receptors and Kcna2 in injured DRG, and attenuates nerve injury‐induced pain hypersensitivities in male mice. Conversely, DS‐lncRNA downregulation increases RALY‐triggered Ehmt2/G9a expression and correspondingly decreases opioid receptor and Kcna2 expression in DRG, leading to neuropathic pain symptoms in male mice in the absence of nerve injury. Mechanistically, downregulated DS‐lncRNA promotes more binding of increased RALY to RNA polymerase II and the Ehmt2 gene promoter and enhances Ehmt2 transcription in injured DRG. Thus, downregulation of DS‐lncRNA likely contributes to neuropathic pain by negatively regulating the expression of RALY‐triggered Ehmt2/G9a, a key neuropathic pain player, in DRG neurons. [ABSTRACT FROM AUTHOR]

Cardiac Troponin I (cTnI) is a preferred biomarker to diagnose acute myocardial infarction which is one of the leading risks to health globally due to its short term. However, clinical analyzers are difficult to achieve its on‐site quantitative detection. A novel label‐free aptasensor was constructed to realize ultrasensitive and rapid recognition of cTnI. A nanocubic AuNPs/In2O3 composite was designed to provide synergistic effects of abundant active sites and signal magnification for aptamers grafting. Relying on a conductance‐dependence strategy, this aptasensor can achieve the quantitative detection within 10 min, which is much faster than state‐of‐the‐art analyzers, as well as exhibiting an ultrawide linear range of 0.1–1000 ng/mL and a low detection limit of 0.06 ng/mL with an excellent selectivity in the analysis of human serum. [ABSTRACT FROM AUTHOR]

Separating oil and water remains a serious challenge because various oil/water mixtures are generated in large quantities by industrial processes, unexpected accidents, and daily life. Various systems containing materials with specific structures and wettabilities have been investigated as possible solutions to this issue. As a sustainable biological material, wood and its derivatives have many advantageous properties for practical applications. The present review mainly focuses on recent progress in using wood‐derived systems for sustainable oil/water separation. Various types of materials that can be produced from wood are briefly introduced. Strategies for constructing wood‐derived separation materials based on direct use and integration, modification, and carbonization are then highlighted. Next, the use of wood‐derived systems for separating oil/water layered mixtures and oil/water emulsions by filtration and absorption methods are systematically discussed. The review concludes with a brief summary of some of the remaining challenges to be overcome. [ABSTRACT FROM AUTHOR]

Web behaviour analysis of a collective user has provided a powerful means for studying the collective user interests on the Internet. However, the existing research merely analyses the behaviour of a single user who accesses multiple applications or multiple users who access one application. The authors propose a web behaviour classification model for collective user, in which the title fields in HTTP flows are extracted from the mirrored network traffic that has been already captured for any given period of time. The title fields, considered as the short abstract of the whole web pages browsed by the users, are vectorized by natural language processing technologies. Specifically, the Latent Dirichlet allocation (LDA) algorithm is used to calculate the topic distribution probability matrix. Afterward, the multi‐class classifiers are trained and tested using the manually labelled probability distribution matrix from the output of the LDA algorithm to classify the user behaviour topics. The experiments demonstrate that the highest classification accuracy of the model reaches 81.2% by combing the LDA algorithm with Random Forest classifiers under the classification model. [ABSTRACT FROM AUTHOR]

Facial expression recognition (FER) is a significant research task in the computer vision field. In this paper, we present a novel network FaceCaps for facial expression recognition with the following novel characteristics: an embedding structure based on a Capsule network which encodes relative spatial relationships between features; incorporates the feature polymerization property of FaceNet, thus offering a more efficient approach to discriminate complex facial expressions; a target reconstruction loss as a better regularization term for Capsule networks. Experimental results on both lab‐controlled datasets (CK+) and real‐world databases (RAF‐DB and SFEW 2.0) demonstrate that the method significantly outperforms the state‐of‐the‐art. [ABSTRACT FROM AUTHOR]

Hepatocellular carcinoma (HCC) is one of the most lethal cancers in humans. The inhibition of peptidyl‐prolyl cis/trans isomerase (Pin1) gene expression may have great potential in the treatment of HCC. N‐Acetylgalactosamine (GalNAc) was used to target the liver. Cholesterol‐modified antimicrobial peptide DP7 (DP7‐C) acts as a carrier, the GalNAc‐siRNA/DP7‐C complex increases the uptake of GalNAc‐siRNA and the escape of endosomes in hepatocytes. In addition, DP7‐C nanoparticles and hydrogel‐assisted GalNAc‐Pin1 siRNA delivery can effectively enhance the stability and prolong the silencing effects of Pin1 siRNA. In an orthotopic liver cancer model, the GalNAc‐Pin1 siRNA/DP7‐C/hydrogel complex can potentially regulate Pin1 expression in hepatocellular carcinoma cells and effectively inhibit tumor progression. Our study proves that Pin1 siRNA is an efficient method for the treatment of HCC and provides a sustainable and effective drug delivery system for the suppression of liver cancer. [ABSTRACT FROM AUTHOR]

In this paper, an adaptive multivariable continuous terminal sliding mode (CTSM) controller with robust input shaper (RIS) is proposed for flexible spacecraft under model uncertainty and external disturbance. Firstly, for the problem of flexible vibration introduced by flexible appendage, the RIS based on disturbance observer is designed. The proposed input shaper can eliminate the flexible vibration effectively even if there are some disturbances in flight. Then, an adaptive multivariable CTSM controller is proposed for attitude tracking of flexible spacecraft, using only information about the output and its first derivative. The features of the developed methods are that it is continuous multivariable controller which attenuates the chattering effectively and the attitude tracking can be achieved in finite time. The stability and robustness properties of the system are proven using Lyapunov function. Finally, some numerical simulations are performed to validate the efficiency of the developed algorithm. [ABSTRACT FROM AUTHOR]

This paper considers a supply chain consisting of one supplier and one retailer who jointly invest in item‐level radio frequency identification (RFID) by considering their demands and inventories. Since the supplier can be negative to adopt RFID, the main objective of this study is to design an effective mechanism that maximizes the profits of both players and the whole supply chain by implementing item‐level RFID. For this objective, we propose a novel revenue‐cost‐sharing (RCS) contract based on the bargaining game as the incentive to encourage the implementation, and numerical results show that the RCS contract is considerably more effective than the wholesale‐price contract for supply chain coordination. Moreover, we show that the retail supply chain can be coordinated perfectly under the RCS contract when the thresholds of the revenue/cost sharing rates are set appropriately. This study provides significant managerial insight into the incentive and coordination strategy to implement item‐level RFID in the retail supply chain. [ABSTRACT FROM AUTHOR]

Background Information: In many cellular processes including cell division, the synergistic dynamics of actin filaments and microtubules play vital roles. However, the regulatory mechanisms of these synergistic dynamics are not fully understood. Proteins such as formins are involved in actin filament–microtubule interactions and Arabidopsis thaliana formin 14 (AtFH14) may function as a crosslinker between actin filaments and microtubules in cell division, but the molecular mechanism underlying such crosslinking remains unclear. Results: Without microtubules, formin homology (FH) 1/FH2 of AtFH14 nucleated actin polymerisation from actin monomers and capped the barbed end of actin filaments. However, in the presence of microtubules, quantitative analysis showed that the binding affinity of AtFH14 FH1FH2 to microtubules was higher than that to actin filaments. Moreover, microtubule‐bound AtFH14 FH1FH2 neither nucleated actin polymerisation nor inhibited barbed end elongation. In contrast, tubulin did not affect AtFH14 FH1FH2 to nucleate actin polymerisation and inhibit barbed end elongation. Nevertheless, microtubule‐bound AtFH14 FH1FH2 bound actin filaments and the bound actin filaments slid and elongated along the microtubules or elongated away from the microtubules, which induced bundling or crosslinking of actin filaments and microtubules. Pharmacological analyses indicated that AtFH14 FH1FH2 promoted crosslinking of actin filaments and microtubules in vivo. Additionally, co‐sedimentation and fluorescent dye‐labelling experiments of AtFH14 FH2‐truncated proteins in vitro revealed the essential motifs of bundling actin filaments or microtubules, which were 63–92 aa and 42–62 aa in the AtFH14 FH2 N‐terminal, respectively, and 42–62 aa was the essential motif to crosslink actin filaments and microtubules. Conclusions and Significance: Our results aid in explaining how AtFH14 functions as a crosslinker between actin filaments and microtubules to regulate their dynamics via different manners during cell division. They also facilitate further understanding of the molecular mechanisms of the interactions between actin filaments and microtubules. [ABSTRACT FROM AUTHOR]

Long non‐coding RNAs (lncRNAs) are a novel class of regulators in multiple cancer biological processes. However, the functions of lncRNAs in pancreatic ductal adenocarcinoma (PDAC) remain largely unknown. In this study, we identified PWAR6 as a frequently down‐regulated lncRNA in PDAC samples as well as a panel of pancreatic cancer cell lines. Down‐regulated PWAR6 was associated with multiple clinical outcomes, including advanced tumour stage, distant metastasis, and overall survival of PDAC patients. In our cell‐based assays, ectopic expression of PWAR6 dramatically repressed PDAC cells proliferation, invasion and migration, accelerated apoptosis, and induced cell cycle arrest at G0/G1 phase. In contrast, depletion of PWAR6 mediated by siRNA exhibited opposite effects on PDAC cell behaviours. In vivo study further validated the anti‐tumour role of PWAR6 in PDAC. By taking advantage of available online sources, we also identified YAP1 as a potential PWAR6 target gene. Negative correlation between YAP1 and PWAR6 expressions were observed in both online database and our PDAC samples. Notably, rescue experiments further indicated that YAP1 is an important downstream effector involved in PWAR6‐mediated functions. Mechanistically, PWAR6 could bind to methyltransferase EZH2, a core component of Polycomb Repressive Complex 2 (PRC2) in regulating gene expression, and scaffold EZH2 to the promoter region of YAP1, resulting in epigenetic repression of YAP1. In conclusion, our data manifest the vital roles of PWAR6 in PDAC tumorigenesis and underscore the potential of PWAR6 as a promising target for PDAC diagnosis and therapy. [ABSTRACT FROM AUTHOR]

Fabricating proton exchange membranes (PEMs) with high ionic conductivity and ideal mechanical robustness through regulation of the membrane microstructures achieved by molecular‐level hybridization remains essential but challenging for the further development of high‐performance PEM fuel cells. In this work, by precisely hybridizing nano‐scaled bismuth oxide clusters into Nafion, we have fabricated the high‐performance hybrid membrane, Nafion‐Bi12‐3 %, which showed a proton conductivity of 386 mS cm−1 at 80 °C in aqueous solution with low methanol permeability, and conserved the ideal mechanical and chemical stabilities as PEMs. Moreover, molecular dynamics (MD) simulation was employed to clarify the structural properties and the assembly mechanisms of the hybrid membrane on the molecular level. The maximum current density and power density of Nafion‐Bi12‐3 % for direct methanol fuel cells reached to 432.7 mA cm−2 and 110.2 mW cm−2, respectively. This work provides new insights into the design of versatile functional polymer electrolyte membranes through polyoxometalate hybridization. [ABSTRACT FROM AUTHOR]

In the present study, corrosion‐protective microarc oxidation (MAO) coatings were prepared on AZ31B, AZ80, and ZK60 cast magnesium alloy substrates in an alkaline silicate electrolyte. The corrosion performances of the uncoated and MAO‐coated alloys were investigated using electrochemical and salt spray chamber corrosion tests. The microstructure characterization and experimental results show that among the three alloys studied, the ZK60 Mg alloy exhibited the best and AZ31B the least corrosion resistance under the salt spray conditions. The MAO coating provided robust corrosion protection of the Mg substrates and resulted in a significant decrease in the corrosion rate of the alloys by 3–4 orders of magnitude. The MAO coating on ZK60 alloy showed better corrosion protectiveness than that on the AZ series alloys due to the incorporation of different alloying elements in the coating, especially the Zn and Al elements, which are from the Mg substrate. The corrosion performances and mechanisms of the uncoated and MAO‐coated Mg alloys are interpreted in terms of the microstructure and phase/chemical compositions of both the substrates and coatings. [ABSTRACT FROM AUTHOR]