Search

Presents upcoming research papers on biochemistry to be published in "European Journal of Biochemistry." Discussion of the molecular cloning and sequencing of a cDNA encoding the acyl carrier protein; Exploration of the primary structure of human thyroglobulin; Examination of the reversible activation of hydrogenase from Escherichia coli.

Presents a list of forthcoming papers to be published in 1980 issues of the "European Journal of Biochemistry." Subjects; Authors.

Lists the research studies concerning biochemistry that will be published following December 1987. Titles of the articles; Authors of the studies; Focus of the studies.

The article provides a list of forthcoming papers to be published in "European Journal of Biochemistry." Some of the papers mentioned are: "Isolation and characterization of cDNAs from Atlantic cod encoding two different forms of trypsinogen," "Molecular analysis of chicken embryo SPARC (osteonectin),"

This article presents a list of some of the forthcoming papers in biochemistry to be published in this journal. Some of the papers listed are "The Organization of the Chloroplast DNA in wheat and maize in the region containing the LS Gene," by B. Koller, H. Delius and T.A. Dyer, "Effect of Carbamination on the Buffering Power of Purified Human Hamoglobins A Solutions At Two Temperatures," by M. Castaing, E. Bursaux and C. Poyart, "The Complete Nucleotide of the Chicken Ovotransferrin mRNA," by J.M. Jeltsch and P. Chambon, "The Primary Structure of Hen Ovotransferrin," by J. Williams, T.C. Elleman, I.B. Kington, A.G. Wilkins and K.A. Kuhn.

Lists forthcoming papers to be featured in the "European Journal of Biochemistry."

Presents a list of papers scheduled to be published in the "European Journal of Biochemistry," as of August 15, 1992. Topics; Authors.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Lists research papers scheduled for publication in the "European Journal of Biochemistry," in 1989. Topics; Authors; Data presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers scheduled to be pubilshed in the "European Journal of Biochemistry," in 1988. Subjects; Authorship.

Presents a list of forthcoming papers scheduled for publication in the "European Journal of Biochemistry," in 1988. Topics; Authors; Studies and data to be presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Presents several research papers related to biochemistry published in the September 1983 issue of the "European Journal of Biochemistry." "Intracellular Forms of Transferrin Oligosaccharide Chains in Rat Liver," by H. Nakada, H. Kohno, T. Kawasaki and Y. Tashiro; "Primary Structure of Protamine From the Northern Pike Esox lucius," by W. Speckert, B. Kennedy, St. L. Daisley and P. Davies; "ATP-AMP phosphotransferase From Paracoccus denitrificans," by S. -S. Yeh, A. G. Tomasselli and L. H. Noda.

Presents forthcoming papers published on the February 1, 1980 issue of the "European Journal of Biochemistry." "The Interaction of Bovine Pancreatic Deoxyribonuclease I and Skeletal Muscle Actin," by H. G. Mannherz, R. S. Goody, M. Konrad and E. Nowak; "The Hexokinases From Wild-Type and Morphological Mutant Strains of Neurospora crassa," by R. Lagos and T. Ureta; "The Kinetic Mechanism of Xanthine Dehydrogenase and Related Enzymes," by M. P. Coughlan and K. V. Rajagopalan.

Lists the coming articles that will be published in the periodical "European Journal of Biochemistry". Topics of the articles; Authors who wrote the articles; Implication of the research studies on biochemistry.

Lists articles that are scheduled for inclusion in forthcoming issues of the "European Journal of Biochemistry." "Synthesis and Characterization of Neurotensin Analogues for Structure Activity Relationship Studies," by C. Granier et al; "Enhanced Breakdown of Arylsulfate A in Multiple Sulfatase Deficiency," by A.Waheed et al; "An Extracellular polysaccharide Produced by Zoogloea ramigera," F. Ikeda et al.

Lists titles of research papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers on biochemistry which appeared in the January 1983 issue of the "European Journal of Biochemistry."

The article provides information regarding the requirements in submitting manuscripts for publication, intended for authors who have interests in the fields of chemistry, biochemistry, mineralogy, pharmacology, physics and materials science. Guidelines about submission requirements, publication requirements, data requirements, diagram requirements, nomenclature, and references are presented.

The deoxyoctanucleotide (5′-3′)d(A-A-G-G-A-G-G-T), which is complementary to the 3′ end of 16-S RNA, inhibits the formation of the complex between the 30-S subunit and MS2 RNA described in the preceding paper. If the complex is preformed, the octanucleotide cannot prevent entry of the complex into the ribosome cycle upon supplementation with the components for protein synthesis. The subunit · MS2-RNA complex is unable to bind the octanucleotide. It is concluded that in the subunit · phage-RNA initiation precursor the 16-S terminus is base-paired with a complementary MS2 RNA sequence. Edeine, aurintricarboxylic acid and antibodies against ribosomal protein S1 prevent the association of phage RNA with 30-S subunits. These compounds do not, however, inhibit the binding of (5′-3′)d(A-A-G-G-A-G-G-T) to 30-S subunits. It is concluded that the formation of the complex between MS2 RNA and 30-S subunits does not depend solely on the Shine and Dalgarno base-pairing reaction. [ABSTRACT FROM AUTHOR]

With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]

Adult bovine aortic endothelial (ABAE) cells, exposed to serum-free medium, specifically bind 125I-labeled human high-density lipoprotein (125I-HDL). Addition of human lipoprotein-deficient serum (LPDS) reduces the specific binding of 125I-HDL in a concentration-dependent manner, such that LPDS at a concentration of 6 mg protein/ml almost completely inhibits the specific binding of 125I-HDL. ABAE cultures exposed to 125I-labeled LPDS (125I-LPDS) specifically bind two peptides, which appear as minor iodinated components in 125I-LPDS. The binding of these two components is abolished in the presence of excess amounts of unlabeled LPDS or HDL. Preincubation of ABAE cells with 25-hydroxycholesterol (25-HC) results in an increase in the binding of the two 125I-LPDS components, similar to the increase observed in 125I-HDL binding in the presence of 25-HC. These two LPDS components comigrate on sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) with apolipoproteins A-I and A-IV of molecular masses 28 kDa and 43 kDa respectively. Furthermore, these two proteins were transfered from the SDS gel to nitrocellulose paper and interacted specifically with anti-(A-I) and anti-(A-IV) sera respectively. When ABAE cultures, pretreated with 25-HC in the presence of LPDS, are subjected to cell-surface iodination, the A-IV appears as one of the major proteins on the cell surface accessible to iodination. The interaction of A-IV with the cell surface of 25-HC-treated cells is not specific to ABAE cells and appears also in human skin fibroblasts. Analysis of the relative amounts of various apolipoproteins in the 125I-HDL bound to ABAE cells demonstrates a decrease in the relative amount of iodinated A-II concomitant with increase in the relative amounts of the other iodinated apolipoproteins, when compared to the composition of the native 125I-HDL. These changes are similar whether the binding is done in the presence or absence of LPDS. It indicates that the decrease in 125I-HDL binding in the presence of LPDS is not due to displacement of the iodinated apolipoproteins A-I and A-IV in the 125I-HDL by unlabeled A-I and A-IV present in LPDS. The results indicate that free apolipoproteins A-I and A-IV, present in LPDS, can displace HDL on the cell surface of ABAE cells. Thus, free A-I and A-IV, present in plasma, control the binding of HDL to endothelial cells and may regulate the process of cholesterol removal from the cells performed by HDL. [ABSTRACT FROM AUTHOR]

On mild acid hydrolysis of lipolysaccharide from Shigella dysenteriae type 3 the O-specific polysaccharide (hapten) was obtained which appeared to be acidic branched hexosaminoglycan. The repeating unit of this polysaccharide represents a pentasaccharide composed of two D-galactose residues, N-acetyl-D-galactosamine, D-glucose and unidentified acidic component. On the basis of methylation analysis, periodate oxidation, partial acid hydrolysis and chromic anhydride oxidation it is concluded that the structure of the chemical repeating unit of polysaccharide is -3)β-D-GalNAcp(1-3)α-D-Galp(1-6)-D-Galf(1- ↑ 14A(1-6)α-D-Glcp. where Glcp is glucopyranose, Galp is galactopyranose, Galf is galactofuranose, GaiNAcp is 2-acetamido-2-deoxygalactopyranose and where the configuration of galactofuranoside glycosidic linkage and the structure of the acidic monosaccharide A are not known. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]

A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]

1. The action of insulin on [14C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]

Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]

Background and Purpose: With the emergence of extensively drug-resistant tuberculosis, there is a need for new anti-tubercular drugs that work through novel mechanisms of action. The meta cleavage product hydrolase, HsaD, has been demonstrated to be critical for the survival of Mycobacterium tuberculosis in macrophages and is encoded in an operon involved in cholesterol catabolism, which is identical in M. tuberculosis and M. bovis BCG.Experimental Approach: We generated a mutant strain of M. bovis BCG with a deletion of hsaD and tested its growth on cholesterol. Using a fragment based approach, over 1000 compounds were screened by a combination of differential scanning fluorimetry, NMR spectroscopy and enzymatic assay with pure recombinant HsaD to identify potential inhibitors. We used enzymological and structural studies to investigate derivatives of the inhibitors identified and to test their effects on growth of M. bovis BCG and M. tuberculosis.Key Results: The hsaD deleted strain was unable to grow on cholesterol as sole carbon source but did grow on glucose. Of seven chemically distinct 'hits' from the library, two chemical classes of fragments were found to bind in the vicinity of the active site of HsaD by X-ray crystallography. The compounds also inhibited growth of M. tuberculosis on cholesterol. The most potent inhibitor of HsaD was also found to be the best inhibitor of mycobacterial growth on cholesterol-supplemented minimal medium.Conclusions and Implications: We propose that HsaD is a novel therapeutic target, which should be fully exploited in order to design and discover new anti-tubercular drugs.Linked Articles: This article is part of a themed section on Drug Metabolism and Antibiotic Resistance in Micro-organisms. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v174.14/issuetoc. [ABSTRACT FROM AUTHOR]

Background and Purpose: The transient receptor potential melastatin-3 (TRPM3) channel forms calcium-permeable, non-selective, cationic channels that are stimulated by pregnenolone sulphate (PregS). Here, we aimed to define chemical requirements of this acute steroid action and potentially reveal novel stimulators with physiological relevance.Experimental Approach: We used TRPM3 channels over-expressed in HEK 293 cells, with intracellular calcium measurement and whole-cell patch-clamp recording techniques.Key Results: The stimulation of TRPM3 channels was confined to PregS and closely related steroids and not mimicked by other major classes of steroids, including progesterone. Relatively potent stimulation of TRPM3-dependent calcium entry was observed. A sulphate group positioned at ring A was important for strong stimulation but more striking was the requirement for a cis (beta) configuration of the side group, revealing previously unrecognized stereo-selectivity and supporting existence of a specific binding site. A cis-oriented side group on ring A was not the only feature necessary for high activity because loss of the double bond in ring B reduced potency and loss of the acetyl group at ring D reduced efficacy and potency. Weak steroid stimulators of TRPM3 channels inhibited effects of PregS, suggesting partial agonism. In silico screening of chemical libraries for non-steroid modulators of TRPM3 channels revealed the importance of the steroid backbone for stimulatory effects.Conclusions and Implications: Our data defined some of the chemical requirements for acute stimulation of TRPM3 channels by steroids, supporting the existence of a specific and unique steroid binding site. Epipregnanolone sulphate was identified as a novel TRPM3 channel stimulator. [ABSTRACT FROM AUTHOR]

Background and purpose:As baclofen is active in patients with anxiety disorders, GABAB receptors have been implicated in the modulation of anxiety. To avoid the side effects of baclofen, allosteric enhancers of GABAB receptors have been studied to provide an alternative therapeutic avenue for modulation of GABAB receptors. The aim of this study was to characterize derivatives of (R,S)-5,7-di-tert-butyl-3-hydroxy-3-trifluoromethyl-3H-benzofuran-2-one (rac-BHFF) as enhancers of GABAB receptors.Experimental approach:Enhancing properties of rac-BHFF were assessed in the Chinese hamster ovary (CHO)-Gα16-hGABAB(1a,2a) cells by Fluorometric Imaging Plate Reader and GTPγ[35S]-binding assays, and in rat hippocampal slices by population spike (PS) recordings. In vivo activities of rac-BHFF were assessed using the loss of righting reflex (LRR) and stress-induced hyperthermia (SIH) models.Key results:In GTPγ[35S]-binding assays, 0.3 μM rac-BHFF or its pure enantiomer (+)-BHFF shifted the GABA concentration–response curve to the left, an effect that resulted in a large increase in both GABA potency (by 15.3- and 87.3-fold) and efficacy (149% and 181%), respectively. In hippocampal slices, rac-BHFF enhanced baclofen-induced inhibition of PS of CA1 pyramidal cells. In an in vivo mechanism-based model in mice, rac-BHFF increased dose-dependently the LRR induced by baclofen with a minimum effective dose of 3 mg kg−1 p.o. rac-BHFF (100 mg kg−1 p.o.) tested alone had no effect on LRR nor on spontaneous locomotor activity, but exhibited anxiolytic-like activity in the SIH model in mice.Conclusions and implications:rac-BHFF derivatives may serve as valuable pharmacological tools to elucidate the pathophysiological roles played by GABAB receptors in the central and peripheral nervous systems.British Journal of Pharmacology (2008) 154, 797–811; doi:10.1038/bjp.2008.135; published online 21 April 2008 [ABSTRACT FROM AUTHOR]

Background and Purpose: The human organic cation transporter-1 (hOCT1) is a polyspecific transporter that plays a role in drug distribution, metabolism and excretion. Previous studies have demonstrated that hOCT1 binding can be stereoselective, but the mechanism for stereochemical recognition has not been described. The purpose of this study was to develop a pharmacophore model to describe stereoselective binding to hOCT1.Experimental Approach: A set of 22 compounds including 8 pairs of enantiomers and five pairs of diastereomers was used to develop a pharmacophore model. The pharmacophore modeling was carried out using Catalyst version 4.11 and HypoGen and was based upon the correlation of the structures and activities (K(i) values) of the compounds used in the study.Key Results: The resulting model contained a positive ion, hydrophobic and two hydrogen-bond acceptor interaction sites. The relative enantioselectivity of 8/8 enantiomeric pairs and diastereoselectivity of 5/5 diastereomers was described by mapping to a combination of at least 3 of the 4 functional feature sites of the model.Conclusions and Implications: The pharmacophore model describes stereoselective interactions with hOCT1 at one of the binding sites on the molecule. [ABSTRACT FROM AUTHOR]

A mathematical description was made of an autocatalytic zymogen activation mechanism involving both intra- and intermolecular routes. The reversible formation of an active intermediary enzyme–zymogen complex was included in the intermolecular activation route, thus allowing a Michaelis–Menten constant to be defined for the activation of the zymogen towards the active enzyme. Time–concentration equations describing the evolution of the species involved in the system were obtained. In addition, we have derived the corresponding kinetic equations for particular cases of the general model studied. Experimental design and kinetic data analysis procedures to evaluate the kinetic parameters, based on the derived kinetic equations, are suggested. The validity of the results obtained were checked by using simulated progress curves of the species involved. The model is generally good enough to be applied to the experimental kinetic study of the activation of different zymogens of physiological interest. The system is illustrated by following the transformation kinetics of pepsinogen into pepsin. [ABSTRACT FROM AUTHOR]

Why are there so many dimeric proteins and enzymes? While for heterodimers a functional explanation seems quite reasonable, the case of homodimers is more puzzling. The number of homodimers found in all living organisms is rapidly increasing. A thorough inspection of the structural data from the available literature and stability (measured from denaturation–renaturation experiments) allows one to suggest that homodimers can be divided into three main types according to their mass and the presence of a (relatively) stable monomeric intermediate in the folding–unfolding pathway. Among otherexplanations, we propose that an essential advantage for a protein being dimeric may be the proper and rapid assembly in the cellular milieu. [ABSTRACT FROM AUTHOR]

Lignins, which result from the dehydrogenative polymerization of cinnamyl alcohols, are complex heteropolymers deposited in the walls of specific cells of higher plants. Lignins have probably been associated to land colonization by plants but several aspects concerning their biosynthesis, structure and function are still only partially understood. This review focuses on the modern physico-chemical methods of structural analysis of lignins, and on the new approaches of molecular biology and genetic engineering applied to lignification. The principles, advantages and limitations of three important analytical tools for studying lignin structure are presented. They include carbon 13 nuclear magnetic resonance, analytical pyrolysis and thioacidolysis. The use of these methods is illustrated by several examples concerning the characterization of grass lignins, 'lignin-like' materials in protection barriers of plants and lignins produced by cell suspension cultures. Our present limited knowledge of the spatio temporal deposition of lignins during cell wall differentiation including the nature of the wall components associated to lignins during cell wall differentiation including the nature of the wall components associated to lignin deposition and of the cross-links between the different wall polymers is briefly reviewed. Emphasis is placed on the phenylpropanoid pathway enzymes and their corresponding genes which are described in relation to their potential roles in the quantitative and qualitative control of lignification. Recent findings concerning the promoter sequence elements responsible for the vascular expression of some of these genes are presented. A section is devoted to the enzymes specifically involved in this synthesis of monolignols: cinnamoyl CoÁ reductase and cinnamyl alcohol dehydrogenase. The recent characterization of the corresponding cDNAa/genes offers new possibilities for a better understanding of the regulation of lignification. Finally, at the level of the synthesis, the potential involvement of proxidases and laccases in the polymerization of monolignols is critically discussed. In addition to previously characterized naturally occurring lignin mutants, induced lignin mutants have been obtained during the last years through genetic engineering. Some examples included plants transformed by O-methyltransferase and cinnamyl alcohol dehydrogenase antisense constructs which exhibit mofidied lignins. Such strategies offer promising perspectives in gaining a better understanding of ligning metabolisms and functions and represent a realistic way to improve plant biomass. [ABSTRACT FROM AUTHOR]

Cell lines resistant to growth inhibition by 10 μM DL-p-fiuorophenylalanine (PFP) have been isolated from a stock cell suspension culture line of Acer pseudoplatanus L. One of the lines (Xs) retained its resistance when serially subcultured in the absence of PFP. X[SUB8] could not be distinguished from the parent line in growth rate and biomass yield but in mixed cultures of the two lines, X8 cells progressively declined as a fraction of the cell population during serial subculture in the absence of PFP. The X[SUB8] line could be recovered from such mixed cultures by subculture to medium containing 10 μM PFP. Line X[SUB8] resembled the parent cell line in phenylalanine (PA) pool size and in showing no evidence of discrimination between PA and PFP in protein synthesis. It differed from the parent line in exhibiting lower uptake of PFP and PA; at an appropriate level PA almost completely suppressed PFP uptake. X[SUB8] cells had a higher content of phenols and higher extractable activity of phenylalanine ammonia lyase (PAL); they actively degraded absorbed PFP. The problem of isolation of biochemical mutants from plant cell cultures is discussed. [ABSTRACT FROM AUTHOR]

Examines the biochemical properties of the putative new profilm isoform by expressing both profilin 1 and profilin II in Escherichia coli. Comparison of interactions with actin; Isoform showing similar affinity for poly(L-proline) and PtdIns with similar effects on nucleotide exchange from actin.

Assesses a possible role of the two glycosylation sites wild-type and glycosylation-deficient (GLAST-1) expressed in Xenopus oocytes. Characterization of function by using the whole-cell voltage-clamp technique; Results proving that the N-glycosylation has no impact on the transport activity of GLAST-1.

Investigates the oxidized iron-compound ferredoxin from the thermophilic bacterium, Thermatoga maritima to characterize its hyperfine-shifted resonances originating from the cysteinyl cluster ligands. Analysis of the chemical shift and relaxation time pattern of the signals; Formation of at least two elements of secondary structure of the polypeptide chain.

Studies the expression and characterization of Geotrichum candidum (GC) lipase I gene. Sequence variation within the nitrogen-terminal 194 amino acids of the GC lipase; Comparison of the specificity profile with lipase II.

Presents a reinvestigation of the structure of the lantibiotic actagardine. Properties of lantibiotics; Biosynthetic pathway of lantibiotics consists in the ribosomal synthesis of a prepeptide; Dehydration of serine and threonine residues.

We describe a rapid purification of protein kinase C from rat brain cytosol employing a specific substrate, protamine-coupled to agarose. Sequential chromatography on DEAE-Sephacel, phenyl-Sepharose CL-4B, and protamine-agarose columns resulted in a 1500-fold purification of protein kinase C. SDS-PAGE analysis of the purified enzyme resolved a doublet protein of 77–80 kDa. This doublet was recognized by a polyclonal antiserum against protein kinase C. Proteolytic digestion of each protein band generated similar peptide fragments. The underlying principle of the protamine sulfate purification method was also clarified. Protamine can serve as a Ca2+/phospholipid-independent substrate. We demonstrate phosphorylation of protamine on the column; phosphorylated protamine did not bind the enzyme with the same affinity and this covalent modification was most probably responsible for releasing the bound enzyme from the column after addition of Mg2+ and ATP. The C kinase inhibitor, H7, inhibits protamine phosphorylation in a dose-dependent fashion but does not prevent binding of the enzyme to a protamine-agarose column. We therefore conclude that protamine interacts with the active center of the enzyme enabling it to be phosphorylated, upon which it loses its binding affinity for C kinase. [ABSTRACT FROM AUTHOR]

Calmodulin contains several binding sites for hydrophobic compounds. The apparent specificity of various ‘calmodulin antagonists’ for these sites was investigated. The Ki values for the inhibition of calmodulin-activated cyclic-nucleotide phosphodiesterase and myosin light-chain kinase was determined. In addition, the Kd values of the same compounds for binding to calmodulin were measured. The compounds could be separated into four. groups. Group I and II compounds inhibited competitively the activation of the phosphodiesterase and myosin light-chain kinase by calmodulin. Group I compounds inhibited the activation of the phosphodiesterase and myosin light-chain kinase at identical concentrations. In contrast, group II compounds inhibited the activation of the phosphodiesterase at 5–10-fold lower concentrations than that of myosin light-chain kinase. Group III compounds inhibited the activation of these enzymes by an uncompetitive mechanism. Group IV compounds inhibited the activation of the phosphodiesterase with Ki values above 10 μM and did not affect the activation of myosin light-chain kinase. Binding of [3H]bepridil to calmodulin under equilibrium conditions yielded one high-affinity site (apparent Kd 0.4 μM) and four low affinity sites (apparent Kd 44 μM). Group I compounds interfered with the binding of bepridil to the high and low-affinity sites in a competitive manner. Group II compounds interfered in a non-competitive manner with the high-affinity site and apparently competed only with one of the low-affinity sites. Group III compounds did not compete with any of the bepridil-binding sites. Nimodipine, a group III compound, bound to one site on calmodulin with a Kd value of 1.1 μM. Other dihydropyridines competed with [3H]nimodipine for this site. The group I and II compounds, trifluoperazine and prenylamine, did not affect the binding of [3H]nimodipine. These data show that ‘calmodulin antagonists’ can be differentiated into at least three distinct groups. Kinetic and binding data suggest that the three groups bind to at least three different sites on calmodulin. Selective occupation of these sites may inhibit specifically the activation of distinct enzymes. [ABSTRACT FROM AUTHOR]

The sterols and sterol precursors of two amoebae of the genus Naegleria, Naegleria lovaniensis and Naegleria gruberi were investigated. Cycloartenol, the sterol precursor in photosynthetic organisms, is present in both amoebae. In N. lovaniensis, it is accompanied by lanosterol and parkeol, as well as by the 24,25-dihydro derivatives of these triterpenes. One of the most striking features of these amoebae is the accumulation of 4α-methylsterols which are present in similar amounts as those of 4,4-desmethylsterols (3–5 mg/g, dry weight). 4α-Methylergosta- 7,22-dienol was identified as a new compound. Ergosterol was the major 4,4-desmethylsterol, accompanied by small amounts of C27 and other C28 sterols. Treatment of N. lovaniensis with fenpropimorph modified the sterol pattern of this amoeba and inhibited its growth. This fungicide, known to inhibit steps of sterol biosynthesis in fungi and plants, induced the disappearance of 4α-methyl-Δ7-sterols and the appearance of the unusual Δ6,8,22-ergostatrienol as in A. polyphaga. These results might be explained by a partial inhibition of the Δ8 → Δ7 isomerase, the small amounts of Δ7-sterols formed being converted into ergosterol which is still present in fenpropimorph-exposed cells. De novo sterol biosynthesis in N. lovaniensis was shown by incorporation of [1-14C]acetate into sterols and sterol precursors, especially cycloartenol. Lanosterol and parkeol were not significantly labelled. Furthermore, [3-3H]squalene epoxide was efficiently cyclized by a cell-free system of this amoeba into cycloartenol, and again no significant radioactivity was detected in lanosterol and parkeol. This shows that cycloartenol, the sterol precursor in plants and algae, is also the sterol precursor in Naegleria species, and that these amoebae, like A. polyphaga, are related by some biosynthetic pathways to photosynthetic phyla. Lanosterol, the sterol precursor in non-photosynthetic phyla (animal and fungi) and parkeol are more likely dead-ends of this biosynthetic pathway. The peculiar phylogenetic position of these protozoa was further emphasized by the action of indole acetic acid and other auxine-like compounds on their growth. Indeed amoebic growth was enhanced in the presence of these higher plant growth hormones. The differences in the sterol composition of the protozoa we have hitherto examined is related to their sensitivity toward polyene macrolide antibiotics. The growth of A. polyphaga, containing mainly the C29 stigmasta-5,7,22-trienol was not affected by nystatin, and only slightly by amphotericin. Both antibiotics inhibited however the growth of the ergosterol-containing amoeba N. lovaniensis and trypanosome Crithidia fasciculata. [ABSTRACT FROM AUTHOR]

The hepatic subcellular distribution of apolipoprotein B (apo B) was studied quantitatively by using an enzyme immunoassay developed for apo B and by immunoadsorption-precipitation of [3H]leucine-labelled apo B. Over 50% (of 0.59 μg/ms protein) of the apo B was located in the microsomal fraction. Further subfractionation of the microsomes revealed that 47% of the microsomal apo B was in the Golgi apparatus, while another 43% was associated with the rough endoplasmic reticulum. The smooth endoplasmic reticulum accounted for only 4% of the total. When rat livers were labelled with [3H]leucine for 10 min, the rough endoplasmic reticulum accounted for 80% of the total immunoadsorbed precipitable apo B radioactivity while the smooth accounted for 20%, with no contribution from the Golgi However, only 8.7% of the total radioactive immunoadsorbed precipitable apo B was lipoprotein-associated, the remainder being membrane-bound. Lipoprotein-associated apo B radioactivity in the smooth endoplasmic reticulum accounted for 40%, with the rough contribution attributed at 50% and the Golgi at 9%. We concluded that (a) there are two major pools of apo B in rat liver microsomes; (b) although the apo B mass may be negligible in the smooth endoplasmic reticulum, the latter does play a role in lipoprotein biogenesis. The possible function of apo B associated with membranes of the microsomes is also discussed. [ABSTRACT FROM AUTHOR]