Search

Summary Background The genetic basis of variation in the progression of primary tauopathies has not been determined. We aimed to identify genetic determinants of survival in progressive supranuclear palsy (PSP). Methods In stage one of this two stage genome-wide association study (GWAS), we included individuals with PSP, diagnosed according to pathological and clinical criteria, from two separate cohorts: the 2011 PSP GWAS cohort, from brain banks based at the Mayo Clinic (Jacksonville, FL, USA) and in Munich (Germany), and the University College London PSP cohort, from brain banks and the PROSPECT study, a UK-wide longitudinal study of patients with atypical parkinsonian syndromes. Individuals were included if they had clinical data available on sex, age at motor symptom onset, disease duration (from motor symptom onset to death or to the date of censoring, Dec 1, 2019, if individuals were alive), and PSP phenotype (with reference to the 2017 Movement Disorder Society criteria). Genotype data were used to do a survival GWAS using a Cox proportional hazards model. In stage two, data from additional individuals from the Mayo Clinic brain bank, which were obtained after the 2011 PSP GWAS, were used for a pooled analysis. We assessed the expression quantitative trait loci (eQTL) profile of variants that passed genome-wide significance in our GWAS using the Functional Mapping and Annotation of GWAS platform, and did colocalisation analyses using the eQTLGen and PsychENCODE datasets. Findings Data were collected and analysed between Aug 1, 2016, and Feb 1, 2020. Data were available for 1001 individuals of white European ancestry with PSP in stage one. We found a genome-wide significant association with survival at chromosome 12 (lead single nucleotide polymorphism rs2242367, p=7·5 × 10−10, hazard ratio 1·42 [95% CI 1·22–1·67]). rs2242367 was associated with survival in the individuals added in stage two (n=238; p=0·049, 1·22 [1·00–1·48]) and in the pooled analysis of both stages (n=1239; p=1·3 × 10−10, 1·37 [1·25–1·51]). An eQTL database screen revealed that rs2242367 is associated with increased expression of LRRK2 and two long intergenic non-coding RNAs (lncRNAs), LINC02555 and AC079630.4, in whole blood. Although we did not detect a colocalisation signal for LRRK2, analysis of the PSP survival signal and eQTLs for LINC02555 in the eQTLGen blood dataset revealed a posterior probability of hypothesis 4 of 0·77, suggesting colocalisation due to a single shared causal variant. Interpretation Genetic variation at the LRRK2 locus was associated with survival in PSP. The mechanism of this association might be through a lncRNA-regulated effect on LRRK2 expression because LINC02555 has previously been shown to regulate LRRK2 expression. LRRK2 has been associated with sporadic and familial forms of Parkinson's disease, and our finding suggests a genetic overlap with PSP. Further functional studies will be important to assess the potential of LRRK2 modulation as a disease-modifying therapy for PSP and related tauopathies. Funding PSP Association, CBD Solutions, Medical Research Council (UK).

Background The HLA-DRB*1501 haplotype influences the risk of developing multiple sclerosis (MS), but it is not known how it affects grey matter pathology. Aim To assess HLA-DRB * 1501 effects on magnetic resonance imaging (MRI) cortical grey matter pathology. Methods Whole and lesional cortical grey matter volumes, lesional and normal-appearing grey matter magnetization transfer ratio were measured in 85 people with MS and 36 healthy control subjects. HLA-DRB * 1501 haplotype was determined by genotyping (rs3135388). Results No significant differences were observed in MRI measures between the HLA-DRB * 1501 subgroups. Conclusions The HLA-DRB * 1501 haplotype is not strongly associated with MRI-visible grey matter pathology.

IntroductionMadras motor neuron disease (MMND), MMND variant (MMNDV) and Familial MMND (FMMND) have a unique geographic distribution predominantly reported from Southern India. The characteristic features are onset in young, weakness and wasting of limbs, multiple lower cranial nerve palsies and sensorineural hearing loss. There is a considerable overlap in the phenotype of MMND with Brown–Vialetto–Van Laere syndrome (BVVL) Boltshauser syndrome, Nathalie syndrome and Fazio–Londe syndrome. Recently a number of BVVL cases and families have been described with mutations in two riboflavin transporter genes SLC52A2 and SLC52A3 (solute carrier family 52, riboflavin transporter, member 2 and 3 respectively).Methods and resultsWe describe six families and four sporadic MMND cases that have been clinically characterized in detail with history, examination, imaging and electrophysiological investigations. We sequenced the SLC52A1, SLC52A2 and SLC52A3 in affected probands and sporadic individuals from the MMND series as well as the C9ORF72 expansion. No genetic defects were identified and the C9ORF72 repeats were all less than 10.ConclusionsThese data suggest that MMND is a distinct clinical subgroup of childhood onset MND patients where the known genetic defects are so far negative. The clinico-genetic features of MMND in comparison with the BVVL group of childhood motor neuron diseases suggest that these diseases are likely to share a common defective biological pathway that may be a combination of genetic and environmental factors.

To the Editor: Primary immunodeficiencies are a highly heterogeneous group of genetic disorders caused by Mendelian mutations in more than 150 immune-related genes1. Primary immunodeficiencies manifest as severe and/or disseminated recurrent infections and may also have autoimmune manifestations. We studied a female patient P1 of Pakistani origin who presented at the age of 4 years with a generalized lymphadenopathy, splenomegaly, neutropenia (0.05-0.28 ×109/L) and thrombocytopenia (platelet counts 20-40 ×109/L). A lymph node biopsy showed reactive changes, bone marrow aspirate was unremarkable and anti-neutrophil antibodies were present. She also had chronic diarrhea associated with an autoimmune enteropathy, characterized by duodenal villous atrophy and large bowel lymphocytic infiltration on biopsy. Her initial immunology work up revealed only raised IgG levels (22.6 g/L), raised inflammatory markers and a low number of NK cells (0.00-0.02). Lymphocyte subsets, double negative T-cells, T-cell proliferation assays, IgA (1.33 g/L), IgM (1.43 g/L), tetanus vaccine responses and a nitroblue tetrazolium (NBT) test were normal (Table 1). P1 had no significant history of infections except for a psoas abscess associated with chronic neutropenia. Over time she manifested growth failure and developed new autoimmune features including an episode of erythema nodosum, transient arthritis of both feet and recurrent haemolytic anaemia. As a result, she received several courses of steroids, rituximab (with prophylactic immunoglobulin replacement) and mycophenolate mofetil. Five years after initial presentation, following multiple courses of rituximab, she developed recurrent infections (Streptococcus pneumoniae facial cellulitis, Streptococcus pneumoniae sepsis and Haemophilus influenzae empyema) after withdrawal of immunoglobulin therapy. Although both her CD19+ B-cells and IgG level were normal, further investigation revealed a new-onset antibody deficiency with absent vaccine responses (Table 1). Due to further chest symptoms, despite recommencing immunoglobulin replacement, a chest CT scan was performed that showed extensive lung infiltration. Lung biopsy showed a florid diffuse lymphoid interstitial infiltrate consisting of a mixture of CD3+ T and CD20+ B cells, with scattered lymphoid follicles particularly around airways. No granulomata were seen and stains for bacteria, fungi and mycobacteria, as well as in-situ hybridisation for EBV, were negative. Table 1 Serial immunology assessments Patient P1 was born to a consanguineous marriage of first cousins. Therefore, we hypothesized that her disease is caused by a homozygous mutation. To identify the causative mutation we used exome sequencing. Patient’s blood sample was obtained with informed consent from the parents in accordance with the Declaration of Helsinki and with approval from the ethics committees (04/Q0501/119 and 06/Q0508/16). Library preparation, exome capture and sequencing have been done according to the manufacturers instructions. For exome target enrichment the Agilent SureSelect 38 Mb kit was used. Sequencing was done using Illumina HiSeq with 94 bp paired-end reads. In the exome data we found 17,280 single nucleotide variants and small insertions/deletions, including 424 very rare ones, i.e. those not seen in the 1000 Genomes database (May 2011 data release). However, we found no homozygous loss-of-function mutations. To identify larger deletions and duplications we used a new software tool, ExomeDepth2 (available to download at http://cran.r-project.org/web/packages/ExomeDepth/index.html). We found a large homozygous deletion that removed exons 1 to 30 of the 58-exon LPS-responsive vesicle trafficking, beach and anchor containing (LRBA) gene (Figure 1A). This deletion is novel and not present in the Database of Genomic Variants (DGV, http://projects.tcag.ca/variation/). We validated it using a custom comparative genomic hybridization (CGH) array containing 270 probes in a 288 kb region defined around the LRBA gene (Figure 1B). We then sequenced the exact boundaries of this 252,396-nucleotide deletion (chr4: 151,748,856 - 152,001,251; Figure 1C). Figure 1 Homozygous deletion in the LRBA gene region We established an EBV-transformed B cell line of the patient and studied LRBA expression. We stimulated cells with 0, 1, 10 or 100 ng/ml of LPS for 16 hours. Then we extracted RNA, generated cDNA and amplified a part of the LRBA gene using primers 5′GCAGAAGTCATGCTTGGACA3′ and 5′TTTCGAAGTAGGGTCGCAAT3′. An expected 218 bp product from the LRBA exons 19-21 was present in control, but not in patient P1 (Figure 2A). From the LPS-stimulated cells we also extracted proteins and separated them using SDS PAGE. For Western blotting we used anti-LRBA (Sigma HPA019366) and anti-actin antibodies. We found the LRBA protein with the expected mass of approximately 319 kDa in control cells, but not in cells of patient P1 (Figure 2B). We also used immunofluorescence analysis and again found that LRBA protein is expressed in the cytoplasm of cells from a healthy control, but not from patient P1 (Figure 2C).. Figure 2 LRBA mRNA and protein are expressed in the EBV-transformed B cell line from a healthy control, but are absent in patient P1 The LRBA gene encodes a large broadly expressed protein of unknown function that is involved in intracellular vesicle trafficking3. Recently Lopez-Herrera et al. reported five patients with different homozygous mutations in the LRBA gene that also abolished its expression4. These patients had idiopathic thrombocytopenic purpura, lymphoid interstitial pneumonia and autoimmune enteropathy, as well as hypogammaglobulinemia. Reduced levels of IgG and IgA were found in all five patients and reduced IgM was recorded in four of those. Accordingly, all five patients have been diagnosed with childhood-onset common variable immunodeficiency (CVID). Patient P1 that we report here had many similar clinical features. However, hypogammaglobulinemia was not seen at presentation but occurred as a later event, and may have been secondary to rituximab therapy, as has previously been described5. Thus, our results show that deficiency caused by mutations in the LRBA gene may initially present as an autoimmune syndrome without CVID. Therefore, a possibility of LRBA gene mutations should be considered for a broad spectrum of patients with primary immunodeficiencies and autoimmunity.

Summary Background Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease of motor neurons that results in progressive weakness and death from respiratory failure, commonly within about 3 years. Previous studies have shown association of a locus on chromosome 9p with ALS and linkage with ALS–frontotemporal dementia. We aimed to test whether this genomic region is also associated with ALS in an independent set of UK samples, and to identify risk factors associated with ALS in a further genome-wide association study that combined data from the independent analysis with those from other countries. Methods We collected samples from patients with sporadic ALS from 20 UK hospitals and obtained UK control samples from the control groups of the Depression Case Control study, the Bipolar Affective Case Control Study, and the British 1958 birth cohort DNA collection. Genotyping of DNA in this independent analysis was done with Illumina HumanHap550 BeadChips. We then undertook a joint genome-wide analysis that combined data from the independent set with published data from the UK, USA, Netherlands, Ireland, Italy, France, Sweden, and Belgium. The threshold for significance was p=0·05 in the independent analysis, because we were interested in replicating a small number of previously reported associations, whereas the Bonferroni-corrected threshold for significance in the joint analysis was p=2·20×10 −7 Findings After quality control, samples were available from 599 patients and 4144 control individuals in the independent set. In this analysis, two single nucleotide polymorphisms in a locus on chromosome 9p21.2 were associated with ALS: rs3849942 (p=2·22×10 −6 ; odds ratio [OR] 1·39, 95% CI 1·21–1·59) and rs2814707 (p=3·32×10 −6 ; 1·38, 1·20–1·58). In the joint analysis, which included samples from 4312 patients with ALS and 8425 control individuals, rs3849942 (p=4·64×10 −10 ; OR 1·22, 95% CI 1·15–1·30) and rs2814707 (p=4·72×10 −10 ; 1·22, 1·15–1·30) were associated with ALS. Interpretation We have found strong evidence of a genetic association of two single nucleotide polymorphisms on chromosome 9 with sporadic ALS, in line with findings from previous independent GWAS of ALS and linkage studies of ALS–frontotemporal dementia. Our findings together with these earlier findings suggest that genetic variation at this locus on chromosome 9 causes sporadic ALS and familial ALS–frontotemporal dementia. Resequencing studies and then functional analysis should be done to identify the defective gene. Funding ALS Therapy Alliance, the Angel Fund, the Medical Research Council, the Motor Neurone Disease Association of Great Britain and Northern Ireland, the Wellcome Trust, and the National Institute for Health Research Dementias and Neurodegenerative Diseases Research Network (DeNDRoN).

It is known that Alzheimer's disease (AD) presents at an early age in people with Down syndrome (DS). The trisomy 21 in DS provides an opportunity to study the effect of duplicated genes in AD. APP and BACE2 are 2 genes located in chromosome 21 and related to AD. We looked into our cohort of 67 DS cases with dementia for the effect of BACE2 variants in age of onset of dementia. Of the 83 single-nucleotide polymorphisms (SNPs), 6 were associated with age of onset and another 8 SNPs were borderline associated. Our finding also replicated a previous study showing association of rs2252576 with AD.

A hexanucleotide repeat expansion in the chromosome 9 open reading frame 72 gene (C9orf72) was recently identified as the most common genetic cause of frontotemporal dementia/amyotrophic lateral sclerosis. Here we describe the clinical, pathologic, and genetic features of a Finnish C9orf72 expansion carrier, who developed a dysplastic gangliocytoma (Lhermitte-Duclos disease), a rare hamartoma/overgrowth syndrome of cerebellar granule cells associated with mutations in the phosphatase and tensin homolog gene. In addition to the dysplastic gangliocytoma, the patient showed typical transactive response DNA-binding protein with Mr 43 kD (TDP-43) pathology mainly in the cortex and the substantia nigra and numerous p62-positive/TDP-43-negative inclusions in the cerebellar granule cells. His sister carried the same gene defect and showed a similar type of TDP-43/p62 pathology in her brain. Our findings confirm that the clinical and pathologic picture of C9orf72 mutation carriers is more heterogeneous than originally thought and warrants further studies on the possible involvement of phosphatase and tensin homolog gene pathway in the specific cerebellar granule cell pathology associated with C9orf72 expansion.

It is known that individuals with Down syndrome develop Alzheimer’s disease with an early age at onset, although associated genetic risk factors have not been widely studied. We tested whether genes that increase the risk of late-onset Alzheimer’s disease influence the age at onset in Down syndrome using genome-wide association data for age at onset of dementia in a small sample of individuals (N = 67) with Down syndrome. We tested for association with loci previously associated with Alzheimer’s disease risk and, despite the small size of the study, we detected associations with age at onset of Alzheimer’s disease in Down syndrome with PICALM (β = 3.31, p = 0.011) and the APOE loci (β = 3.58, p = 0.014). As dementia in people with Down syndrome is relatively understudied, we make all of these data publicly available to encourage further analyses of the problem of Alzheimer’s disease in Down syndrome.

An intronic expansion of a hexanucleotide GGGGCC repeat in the C9ORF72 gene has recently been shown to be an important cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) in familial and sporadic cases. The frequency has only been defined in a small number of populations where the highest sporadic rate was identified in Finland (21.1%) and the lowest in mainland Italy (4.1%). We examined the C9ORF72 expansion in a series of 146 Greek ALS cases, 10.95% (n = 16) of cases carried the pathological expansion defined as greater than 30 repeats. In the 10 familial ALS probands, 50% (n = 5) of them carried a pathologically large expansion. In the remaining 136 sporadic ALS cases, 11 were carriers (8.2%). None of the 228 Greek controls carried an expanded repeat. The phenotype of our cases was spinal (13/16) or bulbar (3/16) ALS, the familial cases were all spinal ALS and none of our cases had behavioral frontotemporal dementia. Expansions in the C9ORF72 gene therefore represent a common cause of ALS in Greece and this test will be diagnostically very important to implement in the Greek population. The frequency is higher than other populations with the exception of Finland and this may be due to Greece being a relatively isolated population.

Frontotemporal dementia (FTD) as an important clinical entity was rediscovered in Lund and Manchester in the early 1990s. Here we show that the large Lund pedigree with behavioral variant of frontotemporal dementia previously described with this disorder has an expansion in the recently described C9ORF72 locus on chromosome 9.