Search

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

The submucosal injection of cyclophosphamide, permitting to shorten the terms of diagnosis establishment comparing with such in a control group, was used to rise the differential diagnosis efficacy in 60 patients with chronic gastritis, gastric ulcer disease and cancer.

Reactivity of the amide-lactam function of nucleic bases under various conditions, methods of its activation, protection, deprotection and modification have been considered. Expediency of the function's protection in oligonucleotide synthesis is discussed.

The interaction of alkylating derivatives of deoxyribonucleotides whose 5'-terminal phosphate group contains a 4-[(N-2-chloroethyl-N-methyl)amino]benzylamine residue with serum proteins has been studied. Incubation of whole human sera with various concentrations of the alkylating derivative, p(T)16, resulted in affinity modification of several proteins, among which albumin as well as IgM and IgG were the most readily detectable ones. The type of dependence of the degree of modification of these proteins on oligonucleotide concentration suggests that the oligonucleotides display a higher affinity for IgM than for IgG and albumin. Binding of reactive oligomer derivatives to serum proteins was inhibited by polyanions of different oligomeric composition, two-chain DNA and heparin, the latter being the strongest inhibitor of the immunoglobulins. These data point to a role of nonspecific ion-to-ion interactions in the IgG-oligonucleotide complex formation. Oligonucleotide interaction with murine monoclonal antibodies GI was inhibited by a specific antigen which suggests that oligonucleotides may interact with immunoglobulin either at or near a site where the antigen is recognized by the antibody.

2',3'-O-[4-(N-2-chloroethyl-N-methylamino)]benzylidene derivatives of oligoribonucleotides (Up)5U[32P]pC and (Up)11U[32P]pC were used for affinity labeling of 80S ribosomes from human placenta in the presence of cognate Phe-tRNA(Phe). The derivatives retained the ability of tRNA(Phe)-dependent binding with 80S ribosomes and within the corresponding complexes were cross-linked to 40S subunits (preferentially to 18S rRNA). Sites of the mRNA analogs attachment were identified by blot-hybridization of the modified rRNA with restriction fragments of corresponding rDNA. They are located within positions 1610-1747 and 1748-1865 for both analogs. These fragments are situated at the 3'-end region of 18S rRNA in a highly conserved part of eukaryotic small subunit rRNA secondary structure.

Polyalkylating derivatives of single-stranded polynucleotides (30-200-mers) complementary to the long E1 oncogene sequences of simian adenovirus SA7 cause inherited normalization of SH2 and G11 cells transformed with adenovirus SA7; certain deletions in the integrated proviral E1A oncogene were observed in several cases during this process. The transformed cells are indifferent to reagents noncomplementary to the E1 region. Thus polyalkylating derivatives of single-stranded 30-200-mers act as addressed mutagenes which react in a specific way with the integrated complementary DNA sequences of E1 oncogene in transformed rodent cells and realize oncogene-directed mutagenesis in vivo. During this treatment temporary normalized cells reverting to the initial transformed phenotype are also produced.

Tri-, tetra-, penta- and hexanucleotides bearing a reactive 4-(N-methylamino-N-2-chloroethyl)benzylamide group can effectively and selectively modify a single-stranded DNA fragment (302 nucleotides) in the presence of effectors, N-(2-hydroxyethyl)phenazinium derivatives of oligonucleotides complementary to DNA sequences adjacent to the binding site of the reagent. The reagents investigated modify not only single-stranded but also secondary-structured DNA regions. The modification extent depends on the length of oligonucleotide parts of the reagent and effector. A gap between the two stretches associated with the target DNA prevents the effector from functioning. The substitution of an octanucleotide effector by two tetranucleotide ones only slightly reduces the modification extent with a hexanucleotide reagent. A very efficient and specific modification can be achieved by using two effectors flanking the reactive oligonucleotide derivative. The approach leads to the modification extent of up to 89% with a hexanucleotide reagent.

Effectors for increasing the efficiency of DNA modification with the alkylating methylphosphonate analogues of oligodeoxyribonucleotides (MFAO) were suggested. Oligodeoxyribonucleotide d(pC5A8ACAATG) used as a target DNA treated with alkylating derivatives of octathymidylate having alternating methylphosphonate and phosphodiester internucleotide bonds (both Rp- and Sp-individual diastereoisomers of MFAO were used) and bearing alkylating 4-(N-methyl-N-2-chloroethylamino)benzyl phosphoramide residue at the 3'-end. The reactions were carried out in the presence of an effector, hexadeoxyribonucleotide derivative PhnNH(CH2)2NHpCATTGTpNH(CH2)2NHPhn bearing two N-(2-hydroxyethyl)phenazinium (Phn) residues at the 3'- and 5'-ends and being complementary to the part of the target DNA neighbouring with octaadenylate. It was shown that Tm of the duplex formed by the target DNA, octathymidylate and effector is by 7-13 degrees C higher than in the absence of the effector, thus considerably increasing the efficiency of the intracomplex alkylation of the target (e.g., at 40 degrees C, the increase for the reagent based on the Rp-isomer is sixfold). Specificity of the target DNA modification by the MFAO alkylating derivatives in the presence of effector is same as with reagents based on oligodeoxyribonucleotides with natural internucleotide bonds.

It has been shown that dipin in combination with partial hepatectomy (model of dipin hepato-carcinogenesis) induces massive oval cell proliferation. The main stages of oval cells development examined by means of light microscopy of half-thin slices are the following: 1) appearance around portal tracts--1-3 weeks; 2) migration into parenchyma along terminal branches of portal vessels--3-8 weeks; 3) maximum development--8-10 weeks; 4) induction focuses of growth of new formed hepatocytes around portal tracts--8-10 weeks; 5) forcing of oval cells towards the centre of liver lobules and their elimination. There was close correlation between oval cells development, fibrosis and inflammation. Oval cells remained around portal tracts until the development of numerous hepatomas in 10 months after treatment.

The data on the dose dependencies of the induction of sister chromatid exchanges (SCE) and chromosomal aberrations during exposure of mouse bone marrow cells in vivo to 5 alkylating substances are provided. The efficacy of SCE induction was found to be higher than that of chromosomal aberrations. It was established that SCE induced by chemical mutagens in vivo and in vitro are more sensitive and stable tests than chromosomal aberrations.

Modification of a single-stranded DNA fragment 303 nucleotides long with addressed reagents d(pTGACCCTCTTCCC) A greater than CHRCl (I), d(pACCCTCTTCCC) A greater than CHRCl (II), d(CCTCTTCCC) A greater than CHRCl (III) and d(TCTTCCC) A greater than CHRCl (IV) complementary to the sequence 261-274 has been studied. It was shown that not only G258 residue, located near to the above sequence, but also G179 residue is modified. The latter can be explained by the vicinity of G179 and the alkylating group in the three-dimensional structure of the complex. Some modification of fragment 19-24 was observed due to non-complementary binding of the reagent. Association constants of the reagents (I)-(IV) with 261-274 sequence of the fragment were calculated using the dependence of the modification extent of G258 and G179 on the reagent concentration. The constants at 25 and 35 degrees C were found to be 260 and 31 (I), 0,5 and 2 (II), 0,46 and 0,13 (III), 0,0020 and 0,0023 (IV) microM-1.

The kinetics of the affinity modification of phenylalanyl-tRNA synthetase from E. coli MRE-600 with chb-tRNA was used for investigation of copling between the binding sites of tRNA and other ligands. It was shown that ATP, phenylalanine and their mixture do not change the efficiency of complex formation but decrease specifically the rate of enzyme alkylation. L-Tyrosine and L-valine do not influence the enzyme alkylation. ATP is more effective protector than L-phenylalanine. In the presence of both ATP and phenylalanine the enzyme alkylation is excluded. The possibilities of this method for studying the coupling between binding sites are discussed.

N-methyl-N-nitrosourea is metabolised by mouse liver microsomes yielding highly reactive product(s) capable of alkylating cellular macromolecules. Based on cofactor requirement (NADPH, oxygen), inhibition (NaN3) and induction by phenobarbital, 3,4-benz(a)pyrene, and MNU, the reaction is cytochrome P-450-dependent. Analysis of the kinetics and dose dependence of alkylation in vivo and in tissue homogenates confirms the fact that MNU must undergo metabolic activation in vivo.

It is shown that in slightly acidic solution (pH approximately 5.3) reagent CIRCH2NHpT(CT)6 (RCl = -C6H4-N(CH3)CH2CH2Cl) modifies a double-stranded DNA fragment (120 b. p.) containing A(GA)6.T(CT)6 sequence at a single nucleotide residue, viz. G29 located near to this sequence in the DNA chain. The location of this modification point suggests formation of a triple-stranded reactive complex with parallel orientation of the pyrimidine oligonucleotide moiety of the reagent and pyrine sequence of the target DNA. Analysing the modification extent dependence of the reagent concentration the association constant Kx between the reagent and DNA was calculated (Kx = (0.95 +/- 0.03).10(5) M-1, 25 degrees C, pH = 5.3, [NaCl] = 0.1 M). The modification by the reagent ClRCH2NHpT(m5CT)6 has the same quantitative characteristics as in the case of ClRCH2NHpT(CT)6.

The complex [promoter A2 X E. coli RNA polymerase] was treated with phosphoamides, derivatives of 4-[N-methyl, N-(2-chloroethyl)]-aminobenzylamine and guanosine-5'-mono-, di-, and triphosphates with the alkylating group attached to the terminal phosphates. After this, [alpha-32P]CTP was added. Residues of the affinity reagents bound covalently at the first stage were elongated by radioactive -pC residues due to the catalytic action of the active centre of RNA polymerase. Affinity labelled were beta-and sigma-subunits of the enzyme, and the promoter. The affinity label was localized on -pGpC residues. A guanine residue was alkylated in the promoter as suggested by radioactivity elimination kinetics. As the data obtained and the previously known length of the reagent (maximum distance between the alpha-phosphorus atom of the reagent and the point of alkylation is less than 0.6 nm) indicate, there is a direct rather than protein-mediated contact between the template and the substrate within the complex [promoter X RNA polymerase].

The authors have analysed clinico-cytological findings to estimate the efficacy of the preparation No 31 therapy in 18 primary patients with ascites forms of malignant epithelial tumors of the ovary. This preparation was found to be a highly effective chemotherapeutic agent possessing a marked cytolytic effect on tumor cells. The method of cytological assay of the serous cavities exudates may be utilized to determine the tumor sensitivity to the agent under test at early terms of the treatment, while being correlated with clinical data the former may be used to estimate the effectiveness of the chemotherapy.

Yeast tRNAlVal alkylation with 2',3'-0-[4-(N-2-chloroethyl-N-methylaminobenzylidene]dpCdpGrpA proceeds within complementary complexes that are formed due to attachment of the reagent to three sequences of tRNAlVal. The acetal bond of the initial product of alkylation has been hydrolyzed to yield beta-[N=methyl-N-(4-formylphenyl) amino]ethyl-tRNAlVal (R-tRNA) that contains from 1 to 3 residues of the specifically modified nucleosides: alkyl adenosine (R-A), R-I and probably R-psi. Individual alkylated oligonucleotides were isolated from R-tRNAlVal pyrimidyl-RNAse digest. The alkylated oligonucleotides correspond to 93% of all modified products. The major component is beta-[N-methyl-N(4-formylphenyl)aminoA1ethyl-A53-G-Tp. This indicates that the reagent is attached to complementary psi-C-G-sequence in the T-loop of tRNAlVal and that alkylation of the third nucleotide counting from the 5'-terminus of the sequence which binds the reagent completely takes place within the complementary complexes. This site of the tRNAlVal is modified quantitatively at 20 degrees and 19-fold excess of the reagent. The alkylation of two other sites of tRNA reaches 50% under these conditions.

Addressed chemical modification of double-stranded DNA unwound with the specific protein has been demonstrated. 4(N-2-chloroethyl-N-methylamino)benzyl-5'-phosphoamides of oligonucleotides d(CG)rC, d(ATCG)rC, d(AATCG)rC, which can serve as primers in the RNA polymerase-catalyzed transcription, alkylated A2 promoter region of pSK-A2 plasmid in its "open" complex with E. coli RNA polymerase.

To affect definite preselected regions of DNA, complementary denaturated DNA fragments carrying alkylating groups were used. The residues of polyfunctional alkylating agent N',N'N'-tri(beta-chloroethyl)-N'-(p-formylphenyl)propylenediamine-1,3 were attached covalently to 4-5% of bases of the T7 phage DNA (T7 DNA) restriction fragment. The alkylating DNA derivatives was found to be stable under hybridisation conditions. It was shown that the DNA fragment carrying alkylating groups is capable of highly specific interaction with complementary DNA. Thus, the alkylating derivative of the T7 DNA restriction fragment retains its capacity to hybridise with T7 DNA, however, it does not interact with the noncomplementary DNA from chick erythrocytes, it was established that the alkylating derivative of DNA fragment efficiently alkylates only the complementary DNA.

Kinetics of DNA alkylation with 2',3'-o-[N-2-chloroethyl-N-methylamino)benzylidene]uridine (UCHRCL), uridine-5'-methylphosphate (MepUCHRCL) and 4-(N-2-chloroethyl-N-methylamino)benzylamine (NH2CH2RCl) and kinetics of elimination of alkylated bases have been studied. Efficiency of DNA alkylation (p/s-ratio of rate constant of alkylation to the sum of rate constants of by-reactions of an active intermediate formed from the reagent) increases with an increase of the positive charge of the reagents as well as efficiency of tRNA alkylation. Alkylated bases are eliminated from DNA; rate of elimination depends on the structure of the reagent; it decreases in the series NH2CH2R- greater than greater than UCHR-greater than MepUCHR-. Bases alkylated by NH2CH2RCl and UCHRCl are eliminated from DNA during alkylation; therefore plots of DNA alkylation by NH2CH2RCl have a maximum. DNA alkylated by MepUCHRCl is rather stable; alkylated bases are not eliminated during alkylation. Effect of temperature and pH on elimination has been studied.

Nitrous yperite supressed division of E. coli cells; as a result, filaments and giant abnormal cells appeared. Apparently, giant forms were caused by defects in the cell wall induced by nitrous ypertie due to a mutation in the mon gene of the strain. These cells gave rise to normal cells as well as to small bacteria resembling mini-cell.

DNA dependent RNA polymerase from E. coli was methylated with dimethylsulfate. After the methylation the enzymatic activity was lost. Addition of two methyl groups per enzyme monomer completely inactivated enzyme with respect to RNA synthesis but couldn't prevent enzyme binding to DNA. Methylated enzyme was able to form tight complexes with DNA and to compete with the native enzyme for the formation of rifampicin resistant complex with DNA. The ratio of the binding constants of the native and methylated enzymes to DNA was determined to be equal to 3. Methylated enzyme was not able to form the first phosphodiester bound as revealed from pyrophosphate exchange reaction studies.

Properties of oligonucleotide reagents containing an alkylating group of regulated reactivity (nitrogen mustard residue activatable upon mild borohydride reduction of the aromatic formyl group) have been studied. It was shown that these reagents can also be activated by irradiation with nitrogen laser light (lambda 337 nm). Activation of the reagent in complex with a target polydeoxyribonucleotide resulted in the addressed chemical modification of the target. The positional direction of the modification depended on the way of the activation (borohydride reduction or laser irradiation).