Search

A pregnant woman living in Fujian Province, southeastern China, presented due to a risk of having a baby with β-thalassemia major, during her second pregnancy, since she and her husband were suspected as β-thalassemia carriers and their affected daughter was a transfusion-dependent patient. Using the common α-thalassemia and β-thalassemia genotypes test, the pregnant woman was diagnosed as a β-thalassemia carrier with β IVS-2 - 654 (C→T) /β N genotype and her daughter had a homozygosity for IVS - 2 - 654 (C→T) mutation, however, no abnormalities were detected in her husband. SMRT identified a Filipino β 0 -deletion in her husband, and MLPA also revealed an unknown deletion in the HBB gene. Electrophoresis showed approximately 350 bp of the PCR product, and the β-Filipino genotype presented novel fracture fragments ranging from 5,112,884 to 5,231,358 bp, and lacked a 118,475 bp fragment relative to the wild-type sequence. The daughter was therefore diagnosed with the β IVS-2 - 654 (C→T) /β Filipino genotype. Prenatal diagnosis with umbilical cord blood at 27th week of gestation showed heteroztgosity for IVS - 2 - 654 (C→T) mutation in the fetus and continued pregnancy was recommended. In conclusion, we identified the Filipino β 0 -deletion in a Chinese family, from Fujian area, for the first time, during prenatal screening.

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered., Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed β CD59 ) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed β CD128-134 ) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β 0 -thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major., Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis., (© 2023. The Author(s).)

Background: To evaluate the value of the real-time PCR-based multicolor melting curve analysis (MMCA) with an automatic analysis system used in a mass thalassemia screening and prenatal diagnosis program., Methods: A total of 18,912 peripheral blood samples from 9456 couples and 1150 prenatal samples were detected by MMCA assay. All prenatal samples were also tested by a conventional method. Samples with unknown melting peaks, unusual peak height ratios between a wild allele and a mutant allele, or a discordant phenotype-genotype match were further studied by using multiplex ligation-dependent probe amplification (MLPA) or Sanger sequencing. All MMCA results were automatically analyzed and manually checked. The consistency between MMCA assay and conventional methods among prenatal samples was investigated., Results: Except for initiation codon (T > G) (HBB:c.2T > G), all genotypes of thalassemia inside the scope of conventional methods were detected by MMCA assay. Additionally, 27 carriers with 10 rare HBB variants, 13 with α fusion gene, 1 with a rare deletion in α globin gene, and 1 with rare HBA variant were detected by using MMCA assay., Conclusion: MMCA can be an alternative approach used in routine thalassemia carrier screening and prenatal diagnosis for its high throughput, sufficient stability, low cost, and easy operation., (© 2023 University College London (UCL) and John Wiley & Sons Ltd.)

Thalassemia is a major public health concern in India. The thalassemic burden in India is high, with an estimated 100,000 patients diagnosed with β-thalassemia syndrome. However, the exact number is unknown because of the absence of National Registries for patients. India alone contributes to approximately 25% of the global β-thalassemia burden. A possible option to control this burden is to endorse education and awareness programs, compulsory prenatal screening, and develop suitable facilities for genetic counseling, and availability of cost-effective diagnostic tests in India, especially in rural areas. In addition to the various clinical complications associated with thalassemia, lifelong intervention creates mental and physical trauma in patients and their relatives. Government and nongovernment organizations have initiated screening programs to prevent thalassemia. However, prenatal screening is not mandatory, and the reachability of screening programs in rural areas is yet to begin. This review article will discuss the progress in thalassemia research in India, including its prevalence, spectrum of β-thalassemia mutations, preventive and therapeutic measures, and awareness programs. More importantly, we will discuss the need and roadmap to strengthen prevention programs in India.

Objectives: The objective of current genetic research was to verify the genetic basis of ß-thalassemia and its pattern of inheritance in families of Pashtun ethnicity in District Dera Ismail Khan, Pakistan., Methodology: Blood samples from clinically diagnosed five unrelated ß-thalassemia families were collected and target Sanger Sequencing of HBB gene was done. Moreover, in silico analysis including protein modeling and Protein-Protein docking was aslo performed., Results and Discussion: Clinical analysis of patients from family 1,2, 4, and 5 revealed Thalassemia Intermedia, while patient from family 3 was suffering from thalassemia major. The average Hb concentrations between the cases that were severe were found to be a little lower (6.3 mg/dl) than the patients with milder clinical manifestations (7.6 ± 1.4). Genetic analysis in family 1 identified compound heterozygous mutation of HBB (NM_000518) i.e. c.20A>T +c.92 G>A, in family 2 and 4 compound heterozygous mutations c.20A>T + c.27_28insG, in family 3 homozygous mutation c.27_28insG, while in family 5 we identified homozygous mutation c.92 + 5 G>C (IVS-1 + 5 G>C)., Conclusion: This study offers an effective incentive to establish a mutation detection as well as prenatal diagnosis (PND) centers at a larger scale in the Pashtun ethnicity residing in District Dera Ismail Khan, Pakistan.

Background & Objectives: Non-invasive prenatal testing (NIPT) of maternally inherited alleles of β-thalassaemia (MIB) remains to be a challenge. Furthermore, current techniques are not available for use as routine tests. NIPT for β-thalassaemia disease was developed by using a specific droplet digital polymerase chain reaction (ddPCR) assay to analyze the cell-free foetal DNA (cffDNA) derived from maternal plasma., Methods: Pregnant women and their spouses who are at risk of bearing an offspring with β-thalassaemia disease from common MIB mutations (CD 41/42-TCTT, CD17A>T, IVS1-1G>T and CD26G>A) were enrolled. The ddPCR assay sets were constructed for each of the four mutations. All cell-free DNA samples were first screened for the paternally inherited β-thalassaemia (PIB) mutation. The PIB-negative samples were considered as non-disease and were not further analyzed. For PIB-positive samples, DNA fragments of 50-300 base pairs in size were isolated and purified, and further analyzed for MIB mutation. The allelic ratio between the mutant and the wild-type was used to determine the presence of MIB in cffDNA. All cases underwent a prenatal diagnosis by amniocentesis for a definite diagnosis., Results: Forty two couples at risk were enrolled. Twenty two samples were positive for PIBs. Among these 22 samples, there were 10 cases with allelic ratio >1.0 (MIB positive). All foetuses with over-represented mutant alleles were further diagnosed with β-thalassaemia disease; eight with compound heterozygous and two with homozygous mutations. The 20 PIB-negative and 12 MIB-negative foetuses were non-affected., Interpretation & Conclusions: The results of this study suggest that NIPT utilizing the ddPCR assay can be effectively used for the screening and diagnosis of foetal β-thalassaemia in at risk pregnancies., Competing Interests: None

Background: The aim is to evaluate the clinical utility of a long-read sequencing-based approach termed comprehensive analysis of thalassemia alleles (CATSA) in prenatal diagnosis of thalassemia., Methods: A total of 278 fetuses from at-risk pregnancies identified in thalassemia carrier screening by PCR-based methods were recruited from 9 hospitals, and PCR-based methods were employed for prenatal diagnosis. CATSA was performed retrospectively and blindly for all 278 fetuses., Results: Among the 278 fetuses, 263 (94.6%) had concordant results and 15 (5.4%) had discordant results between the 2 methods. Of the 15 fetuses, 4 had discordant thalassemia variants within the PCR detection range and 11 had additional variants identified by CATSA. Independent PCR and Sanger sequencing confirmed the CATSA results. In total, CATSA and PCR-based methods correctly detected 206 and 191 fetuses with variants, respectively. Thus, CATSA yielded a 7.9% (15 of 191) increment as compared with PCR-based methods. CATSA also corrected the predicted phenotype in 8 fetuses. Specifically, a PCR-based method showed one fetus had homozygous HBB c.52A > T variants, while CATSA determined the variant was heterozygous, which corrected the predicted phenotype from β-thalassemia major to trait, potentially impacting the pregnancy outcome. CATSA additionally identified α-globin triplicates in 2 fetuses with the heterozygous HBB c.316-197C > T variant, which corrected the predicted phenotype from β-thalassemia trait to intermedia and changed the disease prognosis., Conclusions: CATSA represents a more comprehensive and accurate approach that potentially enables more informed genetic counseling and improved clinical outcomes compared to PCR-based methods., (© American Association for Clinical Chemistry 2023.)

The procedures commonly used for prenatal diagnosis (PND) of thalassemia are villocentesis or amniocentesis, respectively, at the 11th and 16th weeks of gestation. Their main limitation is essentially due to the late gestation week in which diagnosis is performed. The celomic cavity is accessible between the 7th and 9th weeks of gestation and it has been demonstrated that it contains embryonic erythroid precursor cells as a source of fetal DNA for earlier invasive PND of thalassemia and other monogenic diseases. In this study, we report the use of celomatic fluids obtained from nine women with high-risk pregnancies for Sicilian (δβ) 0 -thalassemia [(δβ) 0 -thal] deletion (NG_000007.3: g.64336_77738del13403) and β-thalassemia (β-thal). Fetal cells were isolated by a micromanipulator, and nested polymerase chain reaction (PCR) and short tandem repeats (STRs) analysis were performed. Prenatal diagnosis was successfully performed in all examined cases. One fetus was a compound heterozygote for (δβ) 0 - and β-thal, three fetuses were found to be carriers of β-thal, four fetuses carriers of a Sicilian δβ deletion, and one fetus without parental mutations. Accidentally, a rare case of paternal triploidy was observed. The genotypic analysis, carried out both by amniocentesis and on abortive tissue or after birth, showed concordance with results obtained on fetal celomic DNA. Our results unequivocally show that fetal DNA can be obtained by nucleated fetal cells present in the celomatic fluid and demonstrate, for the first time, that PND of Sicilian (δβ) 0 -thal and β-thal is feasible at an earlier time in pregnancy than other procedures.

Hemoglobinopathies are the most common monogenic disorders in the world with an ever increasing global disease burden each year. As most hemoglobinopathies show recessive inheritance carriers are usually clinically silent. Programmes for preconception and antenatal carrier screening, with the option of prenatal diagnosis are considered beneficial in many endemic countries. With the development of genetic tools such as Array analysis and Next Generation Sequencing in addition to state of the art screening at the hematologic, biochemic and genetic level, have contributed to the discovery of an increasing number of rare rearrangements and novel factors influencing the disease severity over the recent years. This review summarizes the basic requirements for adequate carrier screening analysis, the importance of genotype-phenotype correlation and how this may lead to the unrevealing exceptional interactions causing a clinically more severe phenotype in otherwise asymptomatic carriers. A special group of patients are β-thalassemia carriers presenting with features of β-thalassemia intermedia of various clinical severity. The disease mechanisms may involve duplicated α-globin genes, mosaic partial Uniparental Isodisomy of chromosome 11p15.4 where the HBB gene is located or haplo-insufficiency of a non-linked gene SUPT5H on chromosome 19q, first described in two Dutch families with β-thalassemia trait without variants in the HBB gene., (© 2022 The Authors. International Journal of Laboratory Hematology published by John Wiley & Sons Ltd.)

Non-invasive prenatal testing (NIPT) is based on the detection and characterization of circulating cell-free fetal DNA (ccffDNA) in maternal plasma and aims to identify genetic abnormalities. At present, commercial NIPT kits can detect only aneuploidies, small deletions and insertions and some paternally inherited single-gene point mutations causing genetic diseases, but not maternally inherited ones. In this work, we have developed two NIPT assays, based on the innovative and sensitive droplet digital PCR (ddPCR) technology, to identify the two most common β thalassemia mutations in the Mediterranean area (β + IVSI-110 and β 0 39), maternally and/or paternally inherited, by fetal genotyping. The assays were optimized in terms of amplification efficiency and hybridization specificity, using mixtures of two genomic DNAs with different genotypes and percentages to simulate fetal and maternal circulating cell-free DNA (ccfDNA) at various gestational weeks. The two ddPCR assays were then applied to determine the fetal genotype from 52 maternal plasma samples at different gestational ages. The diagnostic outcomes were confirmed for all the samples by DNA sequencing. In the case of mutations inherited from the mother or from both parents, a precise dosage of normal and mutated alleles was required to determine the fetal genotype. In particular, we identified two diagnostic ranges for allelic ratio values statistically distinct and not overlapping, allowing correct fetal genotype determinations for almost all the analyzed samples. In conclusion, we have developed a simple and sensitive diagnostic tool, based on ddPCR, for the NIPT of β + IVSI-110 and β 0 39 mutations paternally and, for the first time, maternally inherited, a tool, which may be applied to other single point mutations causing monogenic diseases.

Background: To evaluate whether the quantification of fetal hemoglobin (Hb) Bart's is useful for differentiation of α-thalassemia syndromes in the fetus and to characterize the fetal anemia associated with fetal α-hemoglobinopathy., Methods: A total of 332 fetal blood specimens collected by cordocentesis were analyzed using capillary electrophoresis and the amount of Hb Bart's was recorded. The result was evaluated against thalassemia genotypes determined based on Hb and DNA analyses. Prenatal Hb and DNA characterization of the fetal anemia observed in two families was done., Results: Among 332 fetuses investigated, Hb and DNA analyses identified 152 fetuses with normal genotypes. The remaining 180 fetuses carried α-thalassemia with several genotypes. Variable amounts of Hb Bart's were identified in all fetuses with α-thalassemia, which could be used for simple differentiation of fetal α-thalassemia genotypes. These included α + - and α 0 -thalassemia traits, homozygous α + -thalassemia and Hb Constant Spring (CS), Hb H disease, Hb H-CS and Hb H-Quong Sze diseases, homozygous α 0 -thalassemia causing the Hb Bart's hydrops fetalis and a remain uncharacterized α-thalassemia defect. The previously undescribed interactions of Hb Queens Park and Hb Amsterdam A1 with Hb E were detected in two fetuses with Hb Bart's of 0.5%. The Hb Queens Park-AEBart's disease was also noted in one pregnant woman. Prenatal analysis of the fetuses with severe fetal anemia and cardiomegaly with Hb Bart's of 9.0% and 13.6% revealed unexpectedly the homozygous Hb CS and a compound heterozygosity of Hb CS/Hb Pakse' with Hb E heterozygote, respectively., Conclusions: The usefulness of detecting and differentiation of fetal α-thalassemia syndromes by quantifying of Hb Bart's was demonstrated. Apart from the fatal condition of Hb Bart's hydrops fetalis associated with homozygous α 0 -thalassemia, homozygous Hb CS and a compound Hb CS/Hb Pakse' could result in severe fetal anemia and fetal complications, prenatal diagnosis is highly recommended. The simple Hb Bart's quantification of fetal blood should prove helpful in this matter., (© 2022. The Author(s).)

Introduction: About 2% of the population in the world are carriers of the thalassemia gene. Thalassemia is highly prevalent in Southern China, and traditional clinical testing methods would cause missed diagnosis of partial static thalassemia. Here, we reviewed and summarized a set of simple and clinically feasible thalassemia detection protocols adopted by the Prenatal Diagnosis and Reproductive Center of our hospital. Methods: From January 1, 2015, to December 31, 2020, 31 512 peripheral blood samples and 3828 prenatal samples were collected in our study. All the peripheral blood samples were performed through thalassemia screening by routine blood tests and hemoglobin electrophoresis and gene detection. The prenatal diagnosis would be implemented for the fetus if the parents were carriers of the same type of thalassemia. Results: A total of 6137 (19.48%) cases were diagnosed as thalassemia, in which 4749 (15.07%) were α-thalassemia, 1196 (3.80%) were β-thalassemia and 192 (0.61%) were co-inheritance of α- and β-thalassemia. For prenatal samples, 3160 (82.55%) cases were diagnosed as thalassemia, in which 2021 (52.80%) were α-thalassemia, 997 (26.05%) were β-thalassemia and 142 (3.71%) were co-inheritance of α- and β-thalassemia. In addition, we also found five novel mutations, including NC_000016.9:g.223681-227492del3812; HBA1: c.301-31_301-24delCTCGGCCCinsG; HBA2: c.95+7C>T for α-thalassemia and HBB: c.263_276delCACTGAGTGAGCTG; HBB: c.315+143G>A for β-thalassemia. Conclusion: The present study updates the epidemiological characteristics and mutation spectrum of thalassemia in Southern China and demonstrated five novel mutations. Our research provides a reference for clinical diagnosis and treatment, prenatal diagnosis, or reproductive genetic counseling for patients with thalassemia in Guangdong.

Introduction: Prenatal diagnosis of thalassemia disease was usually based on invasive technique. Noninvasive diagnosis using cell-free fetal DNA (cff-DNA) was described with various laboratory techniques. The aim of this study was to identify the performance of dPCR for analyzing cff-DNA in maternal plasma to diagnose fetal beta-thalassemia diseases., Methods: Thirty-five couples at risk of fetal beta-thalassemia disease caused by four common mutations of HBB were enrolled at 12-18 weeks. The dPCR assay was designed to detect and quantify paternally inherited beta-thalassemia allele (PIB) and maternally inherited beta-thalassemia allele (MIB) from cff-DNA in maternal plasma., Results: Of 29 couples with different paternal/maternal mutations, all cases who inherited paternal mutation had detectable PIB-M. The MIB-mutant/wild-type (MIB-M/MIB-N) ratio in the mothers whose fetuses did not inherit maternal mutation was 0.87 ± 0.07 which was significantly lower than that of the mothers whose fetuses inherited maternal mutation, 1.01 ± 0.05. The sensitivity and specificity of MIB-M/MIB-N ratio >0.95 in predicting fetus inheriting maternal mutation were 100 and 92.3%, respectively. In four couples with same paternal/maternal mutation, IB-M/IB-N ratio of >0.95 correctly predicted the presence of an inheritance of at least one beta-thalassemia allele. In two couples with paternal Hb E/beta-thalassemia, the presence of PIB-M and the MIB-M/MIB-N ratio of >0.95 correctly predicted the presence of paternal/maternal mutations, respectively., Conclusions: The method of analyzing cff-DNA in maternal plasma by dPCR is efficient for prenatal diagnosis of beta-thalassemia., (© 2022 S. Karger AG, Basel.)

Background: This study focuses on the discovery of protein biomarkers from the maternal serum of β-thalassemic trait mothers carrying the normal fetus and β-thalassemic major fetus., Methods: Serum samples from β-thalassemic trait mothers carrying major (N = 5) and normal fetuses (N = 5) were studied. The IVS1-5 thalassemia mutation was common among β-thalassemic trait mothers who were carrying a homozygous β-thalassemic fetus (IVS1-5/ IVS1-5 mutation) or a normal fetus (no mutation). We employed two-dimensional gel electrophoresis and mass spectrometry analysis to explore differentially expressed maternal serum proteins from thalassemia carrier couples with the same β-thalassemia mutation. Western blotting was performed for one of the identified proteins to validate our data., Results: Ten proteins were identified in the maternal serum of β-thalassemic trait mothers carrying the β-thalassemic major fetus and normal fetus. Among these, serotransferrin, haptoglobin, α-1 anti-trypsin, apo-lipoprotein A1, and the fibrinogen-β chain were found to be upregulated in mothers carrying major fetuses and are known to be associated with pregnancy-related disorders. The expression of α-1 anti-trypsin was validated through western blotting., Conclusions: Proteins identified in the current study from maternal serum are reported to contribute to hereditary disorders. We suggest that these can serve as putative screening markers for non-invasive prenatal diagnosis in β-thalassemic pregnancies., (© 2021 Japan Pediatric Society.)

Thalassemia is a major public health and economical burden in Lao People's Democratic Republic (Lao PDR). This study is aiming to elaborate the current situation of Thalassemia in Laos. α- and β-thalassemia (α- and β-thal) includes the common Hb S ( HBB : c.20A>T) and hemoglobins (Hbs) such as Hb Constant Spring (Hb CS or HBA2 : c.427T>C) and Hb E ( HBB : c.79G>A) that are prevalent in the country. Overall, the prevalence of α-thal in Lao PDR is 26.8%. There was high prevalence of homozygous (12.8%) and heterozygous (39.7%) Hb E among migrant workers from Lao PDR who crossed the border to work in Thailand. Iron chelation, blood transfusion, prenatal screening and diagnosis, comprehensive treatment are still the major problems. Splenectomy is still performed. A national registry has still not been established. This is a national economic burden for the country. Thalassemia prevention and control strategy should be established and advocated by the government in order to reduce morbidity and premature mortality.

The thalassemias are inherited quantitative disorders of hemoglobin synthesis with a significant worldwide burden, which result in a wide spectrum of disease from the most severe transfusion-dependent form to the mildest asymptomatic carrier state. In this article, we discuss the importance of carrier, prenatal, and newborn screening for thalassemia. We examine the rationale for who should be screened and when, as well as the current methodology for screening. Deficiencies in the newborn screening program are highlighted as well. With the advent of inexpensive and rapid genetic testing, this may be the most practical method of screening in the future, and we review the implications of population-based implementation of this strategy. Finally, a case-based overview of the approach for individuals with the trait as well as prospective parents who have a potential fetal risk of the disease is outlined., (Copyright © 2021 by The American Society of Hematology.)

Objective: Prenatal and postnatal diagnosis of hemoglobin E-β 0-thalassemia can be made using polymerase chain reaction (PCR) analysis mostly on purified DNA. We have establihed a direct amplification method without DNA extraction on whole blood (WB) and amniotic fluid (AF) specimens to diagnose the disease., Methods: Three reactions of WB PCR assays and 7 reactions of AF PCR tests were developed for postnatal and prenatal diagnosis, respectively. Assays were validated against routine tests in a blinded trial., Results: The results showed 100% concordance with routine DNA PCR assays. Among 309 β-thalassemia carriers, 191 patients (61.8%) carried common β-thalassemia mutations. Among 448 AF specimens, 116 (25.9%) fetuses were found to be affected, 247 (55.1%) fetuses were carriers, and 85 (19%) fetuses were unaffected., Conclusion: We found that WB and AF PCR assays are simple, rapid, and reliable. The developed techniques could be applicable in routine settings., (© American Society for Clinical Pathology, 2021. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

This study investigated prenatal diagnosis of α-thalassemia and β-thalassemia in 3049 families in 18 regions of Hainan Province. Molecular diagnosis was performed in 3049 couples with thalassemia in Hainan Province. Genomic DNA was extracted from peripheral blood of the couples and villus, amniotic fluid, or cord blood of fetuses. DNA-based diagnosis was performed using polymerase chain reaction. The most commonly detected mutation for α-thalassemia was- SEA/αα (31.53%), followed by - α4.2/αα (11.15%) and - α3.7/αα (11.02%). The most common mutation for β-thalassemia was CD41/42 (30.27%), followed by - 28 (2.56%). Prevalence was highest in the coastal regions and lowest in the Wenchang, Lingao, and Ding'an regions. We also found that the most common gene mutations in Han people and other minority groups were not homogeneous. Prenatal diagnosis showed 556 normal fetuses, 116 with α-thalassemia hydrops, and 134 with β-thalassemia major. Our findings provide important information for clinical genetic counseling regarding prenatal diagnosis for thalassemia major in Hainan Province., (© 2021. Japanese Society of Hematology.)

Thalassemia is a common genetic disorder. We aimed to present thalassemia mutation data that covers a period of 7 years from the Mediterranean region of Turkey by comparing with hemoglobin indices and to contribute to prenatal diagnosis and genetic counseling studies which should be decided very quickly. In this study, in which a retrospective archive was scanned, the cases were first grouped as α and β thalassemia, and then β thalassemia mutations were examined in a total of 5 groups as UTR-Pro, Codon, IVS, β 0 , and β + . We have reached the family of the proband that analyzed their Hb indices and genetic mutation. All mutations were statistically compared with Hb indices, HbF, and HbA 2 . We have identified two new β thalassemia mutations that have the feature of not being defined previously [HBB:C*62 A>G. (3'UTR+1536 A>G) and HBB:C*1 G>A (3'UTR+1475 G>A)]. The most commonly encountered 23 mutations account for 74.7% of all mutations which is unlike the literature. In the β thalassemia group, 73 different mutations were detected. The most common β thalassemia mutation was HBB: c.93-21 G>A (IVS I-110 G>A) with a frequency of 19.72%. A statistically significant difference was found when comparing the mutation groups with Hb indices. We think that it may be useful to evaluate the mutations we have newly identified too together with the Hb indices especially in evaluating the carriers of thalassemia and it will contribute to prenatal diagnosis and genetic counseling studies which should be decided very quickly.

Thalassemias are among the most frequent genetic disorders worldwide. They are an important social and economic strain in high-risk populations. The benefit of β-thalassemia screening programs is growing evident but the capacity to diagnose fetal β-thalassemia exceeds the treatment possibilities and even when treatment before birth becomes feasible, difficult decisions about the relative risks will remain. This paper can be of practical and ethically justified aid when counseling women about screening, diagnosis, and treatment of β-thalassemia. It takes in consideration various social challenges, medical issues such as antenatal screening, preimplantation genetic diagnosis, prenatal diagnosis, non-invasive prenatal testing and prenatal therapy. We also describe the Sardinian experience in applying and promoting high-risk population screening and diagnosis programs and future trends in the management of β-thalassemia., (© 2021 Walter de Gruyter GmbH, Berlin/Boston.)

The β-thalassemias and sickle cell disorders pose a considerable health burden in India. Of the more than 10,000 annual births of children with a severe hemoglobinopathy, only around 10.0% are managed optimally. Thus, genetic counseling and prenatal diagnosis (PND) is a valid option for a large and diverse country. Our center was one of the first to initiate PND and we present our experience over 30 years to evaluate the impact of awareness in changing the trends of PND of hemoglobinopathies. Both second and first-trimester diagnoses were undertaken by fetoscopy/cordocentesis and globin biosynthesis/high-performance liquid chromatography (HPLC) analysis of fetal blood and chorionic villus sampling (CVS) and DNA analysis. Over 30 years, 3478 couples (first trimester: 2475; second trimester: 1003) from all over India were offered PND. The number of couples coming in the first trimester increased significantly over each decade and couples coming prospectively increased from 2.5 to 18.4%. A cost-effective stepwise approach was used for molecular analysis. Eight hundred and one fetuses (23.0%) were affected and all except three couples opted for termination of these pregnancies. Genetic counseling and PND is the only way to reduce the burden of disease. With awareness, there was a shift from second trimester to first trimester PND over each decade, with an increasing number of couples coming during the first pregnancy. There are only 15 to 20 centers in India offering PND. We have compared our study with other reports on PND from different regions in India.

Aim: To investigate the factors influencing decisions concerning prenatal diagnosis (PND) and termination of pregnancy for β-thalassemia in Thai pregnant women., Methods: A total of 142 Thai Buddhist pregnant women waiting for PND were asked to undertake semi-structured interviews regarding their reasons for PND and their decisions and reasoning concerning pregnancy if the fetus was found to be affected. The interviews were analyzed using a thematic content approach., Results: Thai pregnant women accepted PND for three reasons: to know whether their pregnancies were affected, to confirm that their pregnancies were unaffected and to terminate if their pregnancies were affected. Three decisions identified among the women were to terminate the pregnancy, to continue the pregnancy and undecided. The interview analysis identified five themes and nine sub-themes affecting pregnancy-related decision-making: (i) quality of life (suffering or no disability); (ii) burden (difficulty or acceptability); (iii) sense of motherhood (the best way for the child or I cannot hurt my child); (iv) significant others (support to terminate, support to continue or support to wait for the test result) and (v) conflict in deciding., Conclusion: An acceptance of PND in Thai pregnant women was not always associated with pregnancy termination. Multiple factors influenced the decision to terminate, but not their religious affiliation., (© 2021 Japan Society of Obstetrics and Gynecology.)

β-Thalassemia (β-thal), an autosomal recessive hemoglobinopathy, is one of the most common genetic disorders in Pakistan. Awareness of this disease, genetic counseling, extended family carrier screening and prenatal diagnosis (PND) are helpful in prevention and control. Currently, direct DNA sequencing and multiple amplification refractory mutation system-polymerase chain reaction (MARMS-PCR) are the methods used to detect β-thal mutations, the latter being the most widely used. This study aimed to evaluate PCR-high resolution melting (PCR-HRM) analysis for the detection of most common β-thal mutations that are found in Pakistan. This study was designed to identify the β-thal mutations using PCR-HRM analysis in a total of 90 samples [blood and chorionic villus sampling (CVS)]. These samples were first screened for routine mutations by MARMS-PCR and then evaluated by PCR-HRM analysis. The results of PCR-HRM analyses were further confirmed by direct DNA sequencing and all analyses interpreted the same results in all 90 samples. Eleven cases (36.6%) were detected to carry IVS-I-5 (G>C) ( HBB : c0.92 + 5G>C), six cases (20.0%) with frameshift codons (FSC) 41/42 (-TTCT) ( HBB : c.126_129delCTTT), five cases (16.0%) were diagnosed with codon 15 (G>A) ( HBB : c.47G>A), three cases (10.0%) were found with codon 30 (G>C) ( HBB : c.93G>C), one case was diagnosed with FSC 16 (-C) ( HBB : c.51delC), one with IVS-I-1 (G>T) ( HBB : c0.92 + 1G>T) and one with codon 5 (-CT) ( HBB : c.17_18delCT). The PCR-HRM analysis represents a less tedious and more useful method for the detection of β-globin gene mutations.

Beta thalassemia in Pakistan is a serious health concern with an estimated 5-8% carrier frequency and birth of 5000 major children every year in the country. The treatment of beta thalassemia major patients poses a great economic burden; hence, the ideal approach towards this disease should encompass effective prevention services. At present only one government funded project "Punjab Thalassemia Prevention Programme" existed in Punjab province, and providing free of cost services for beta thalassemia screening and prenatal diagnosis. Complete blood count and haemoglobin electrophoresis remains the preliminary test for screening, while chorionic villi sampling and amplification refractory mutation system method have been most widely used for molecular diagnosis of beta thalassemia. Modern molecular techniques, non-invasive prenatal diagnosis, and pre-implantation diagnosis are in trial phases. In this review we have discussed the available diagnostic facilities and status of prevention programmes for beta thalassemia in Pakistan as well as future perspectives.

Background: Hemoglobin H (Hb H) disease can be caused by compound heterozygosity for two different mutations or from homozygotes for mutations, and conventional genetic methods may lead to misdiagnosis when Hb H disease is combined with a rare β-thalassemia., Methods: Hematology parameters and hemoglobin electrophoresis analysis, gap-polymerase chain reaction (gap-PCR) and reverse dot-blot hybridization (RDB-PCR) were employed to identify common α-thalassemia and Hb H disease. Rare β-thalassemia mutations were detected by DNA sequencing., Results: Hematological analysis and hemoglobin electrophoresis revealed a mild anemia α 0 -thalassemia trait (Hb 90 g/L, MCV 71 fL, and MCH 22.7 pg) compound with β + -thalassemia trait (MCV 71 fL, MCH 22.7 pg, and HbA2 5.51%) for the pregnant woman. DNA sequencing for the β-globin gene revealed rare a －90 (C>T) (HBB: c.-140 C>T) mutation for the woman. DNA analysis identified that the fetus inherited the α 0 -thalassemia mutation [-- SEA (Southeast Asian)] and a rare β + -thalassemia mutation －90 (C>T) (HBB: c.-140 C>T) from the mother, and the α + -thalassemia mutation [-α 4.2 (leftward)] from the father., Conclusion: We reported a rare －90 (C>T) (HBB: c.-140 C>T) mutation combined with the -- SEA /-α 4.2 in a family. This finding enriched the mutation spectrum of thalassemia molecular characteristics in China and emphasized the significance in DNA sequencing in mutation screening for the families with thalassemia., (© 2020 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.)

Objective: Invasive biopsy during the pregnancy is associated with an abortion risk of approximately 1% for the fetus. Free fetal DNA in maternal plasma is an excellent source of genetic material for prenatal molecular diagnoses. This study was conducted to investigate beta-thalassemia mutation in the fetus through maternal blood with multiple polymorphisms as haplotypes in the beta-globin gene., Methods: In this study, a total of 33 beta-thalassemia carrier (minor) couples were genotyped by ARMS-PCR for IVSII-IG>A mutation. During pregnancy, 10mL of blood was collected from pregnant women, and DNA was extracted by the magnetic bead-based extraction, and fetal DNA was enriched with AMPure XP kit. Five polymorphisms in 4 haplotype groups were evaluated by the Sanger Sequencing method. Finally, results were compared with those of the invasion method., Results: Participants in study were 33 couples, mean age of the men was 26±5 years, and mean age of women was 23±4 years, and mean MCV, MCH, HbA2 blood parameters were 62.4±5.3, 19.6±3.1, 4.2±2.1 respectively. A total of 33 fetuses were genotyped for IVSII-IG>A mutation. Nine fetuses were affected, 10 fetuses were normal and 14 fetuses were carrier of beta-thalassemia. Sensitivity and specificity of Sanger Sequencing were equal to 88.8% and 91.6% respectively. Positive and negative predictive values were obtained as 80% and 95.6%, respectively., Conclusion: Mutational status of the fetus can be assessed by determining inheritance of paternally-derived alleles based on detection of haplotype-associated SNP in maternal plasma. Magnetic-based DNA extraction and fetal DNA enrichment are very simple and easy to perform and have satisfactory accuracy., (Copyright © 2020. Published by Elsevier Masson SAS.)

A retrospective study was conducted for prenatal diagnosis and selective foetal reduction, which included 41 beta thalassemia carrier couples with twin pregnancy. Chorionic villi sampling was carried out at 12-14 weeks of gestation. Thirty-three couples presented with dizygotic while eight had monozygotic twins. Molecular analysis for beta thalassemia revealed similar results in both the twins in 27 cases, while different results were obtained in 14 cases. Selective foetal reduction was offered to couples with discordant results. One miscarriage occurred due to the procedure. The results of prenatal molecular analysis were confirmed by postnatal molecular analysis. This series of trans-abdominal Chorionic villi sampling in twin pregnancies with the option of selective foetal reduction of the affected foetus was found to be useful as well as acceptable by the at-risk couples.

Introduction: The hemoglobinopathies are the commonest group of single gene disorders in the Indian subcontinent. Although genetic modifiers are known to have a remarkable effect on phenotypic expression, the effects of the possible co-inheritance of different modifiers are not taken into account during prenatal diagnosis. The present study was undertaken to look for the frequency of globin gene modifiers like the types of β-globin gene mutations, α thalassemia, α gene triplication, and the Xmn1 polymorphism in fetuses during antenatal diagnosis of hemoglobinopathies., Materials and Methods: A total of 580 fetuses with different diagnoses were screened for the presence of genetic modifiers., Results: Twenty-two different β-globin gene mutations were identified of which 3.5% were milder mutations. Among the affected fetuses, 29.6% of the β-thalassemia major and 52.9% of the sickle cell anemia (SCA) fetuses had one genetic modifier while 3.7% of the β-thalassemia major and 41.1% of the SCA fetuses had co-inherited two modifiers. α-gene triplication was detected in 16 (3.5%) β-thalassemia/sickle cell heterozygous and normal fetuses of which 5 babies (2 β-thalassemia heterozygous and 3 normal) could be followed up. Of the 2 β-thalassemia heterozygous babies, one had a severe clinical presentation., Conclusion: Many fetuses had one or two gene modifiers. However, the impact of these on ameliorating the severity of the disease could not be evaluated as all the fetuses with β thalassemia major or sickle cell disease were terminated. Parents having heterozygous fetuses with α gene triplication should be followed up periodically after birth for better management of these babies., (© 2020 John Wiley & Sons Ltd.)

We report our work on prenatal diagnosis of α-thalassemia, β-thalassemia and other hemoglobinopathies in southern Thailand. DNA-based diagnosis was offered to 1906 pregnancies at risk for thalassemia using a combination method of multiplex-PCR and reverse dot blot analysis to detect seven α-globin and 47 β-globin mutations. The most commonly detected mutation of α 0 -thalassemia was a South-East Asian deletion (98%), followed by a Thai deletion (2%). Twenty-eight β-globin mutations were identified. Fourteen common mutations, including cod 19 A-G (18.6%), cod 41/42 -TCTT (14.4%), IVS1#5 G-C (13.2%), 3.5 kb deletion (9.2%), cod 17 A-T (7.7%), -28 A-G (7.3%), IVSI#1 G-T (7.1%), 12.5 kb deletion (δβ) 0 (5.7%), HPFH6 (4.2%), IVS2#654 C-T (2.7%), 45 kb deletion (1.9%), Asian Indian-inversion-deletion Gγ(Aγδβ) 0 (1.6%), cod 41 -C (1.5%) and cod 71/72 +A (1.3%) were detected, accounting for 96.5% of all mutations detected. The most common hemoglobin variant was Hb E, accounting for 97.86%. Prenatal diagnosis of 1906 couples at risk showed 22.0% normal, 51.2% carrier and 26.8% affected. The present study provides important information for diagnosis and control of severe thalassemia diseases.

A female of Chinese origin carried the codon 43 (G>T) ( HBB : c.130G > T) and codons 71/72 (+A) ( HBB : c.216_217insA) mutations of the β-globin gene in cis , identified during prenatal thalassemia screening. The double in cis mutations were inherited from her mother. Both of the two carriers behave as a traditional heterozygote for β-thalassemia (β-thal) with microcytosis and a high Hb A 2 level. This case report indicates that the possibility of multiple mutations in cis in a fetus with thalassemia trait has to be considered in a prenatal screening program.

The inherited disorders of hemoglobin synthesis constitute the most common monogenic diseases worldwide. The clinical severity of β-thalassemia major and the sickle cell syndromes targets them as priority genetic diseases for prevention programs, which incorporates population screening to identify heterozygotes, with the option of prenatal diagnosis for carrier couples. Rapid genotype characterization is fundamental in the diagnostic laboratory, especially when offering prenatal diagnosis. The application of real-time PCR provides a means for rapid and potentially high throughput assays, without compromising accuracy. It has several advantages over end-point PCR analysis, including the elimination of post-PCR processing steps and a wide dynamic range of detection with a high degree of sensitivity. Although there are over 200 mutations associated with the β-thalassemia and sickle cell syndromes, the relatively small size of the β-, HBB gene (less than 2000 base-pairs) and the close proximity of most mutations facilitates the design of a minimal number of real-time PCR assays using the LightCycler™ system, which are capable of detecting the majority of most common β-gene mutations world-wide. These assays are highly appropriate for rapid genotyping of parental and fetal DNA samples with respect to β-thalassemia and sickle cell syndromes.

Hb A' 2 (or Hb B 2 ) ( HBD : c.49G>C) is the most frequent δ chain variant that has been described in Africa but not in Thailand. We report here a 10-month-old Thai infant with compound heterozygosity for β 0 codon 17 (A>T; HBB : c.52A>T) and β + IVS II-654 (C>T; HBB : c.316-197C>T). Under diagnosed β-thalassemia (β-thal) in her father, who carries Hb A' 2 and a heterozygous β 0 codon 17 mutation, and the mother, who carries a heterozygous β + IVS II-654 mutation, was noted. Although Hb A' 2 does not cause any problems, heterozygosity for Hb A' 2 can lead to under diagnosis of β-thal in Hb A' 2 samples. This case highlights the importance of Hb A' 2 in prenatal diagnosis (PND). Thus, molecular analysis for β-thal mutations should be carried out when a small peak presents at the retention time (RT) of 4.71 min. on high performance liquid chromatography (HPLC) and the summation level of this peak and Hb A 2 was equal or higher than 4.0%.

Background: Beta thalassemia is a common disorder with autosomal recessive inheritance. The most prenatal diagnostic methods are the invasive techniques that have the risk of miscarriage. Now the non-invasive methods will be gradually alternative for these invasive techniques., Objective: The aim of this study is to evaluate and compare the diagnostic value of two non-invasive diagnostic methods for fetal thalassemia using cell free fetal DNA (cff-DNA) and nucleated RBC (NRBC) in one sampling community., Methods: 10 ml of blood was taken in two k3EDTA tube from 32 pregnant women (mean of gestational age = 11 weeks), who themselves and their husbands had minor thalassemia. One tube was used to enrich NRBC and other was used for cff-DNA extraction. NRBCs were isolated by MACS method and immunohistochemistry; the genome of stained cells was amplified by multiple displacement amplification (MDA) procedure. These products were used as template in b-globin segments PCR. cff-DNA was extracted by THP method and 300 bp areas were recovered from the agarose gel as fetus DNA. These DNA were used as template in touch down PCR to amplify b-globin gen. The amplified b-globin segments were sequenced and the results compared with CVS resul., Results: The data showed that sensitivity and specificity of thalassemia diagnosis by NRBC were 100% and 92% respectively and sensitivity and specificity of thalassemia diagnosis by cff-DNA were 100% and 84% respectively., Conclusion: These methods with high sensitivity can be used as screening test but due to their lower specificity than CVS, they cannot be used as diagnostic test., (Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.net.)

Over the last 43 years, surveys of over 200,000 subjects in Jamaica have identified β-thalassemia (β-thal) mutations. In most, these genes were detected at birth in patients with sickle cell-β-thal and so the prevalence and distribution would not be influenced by subsequent clinical course. There were two newborn populations, 100,000 deliveries in the corporate area between 1973-1981 and 84,940 in south and western Jamaica between 2008-2016. A third population, which derived from the Manchester Project in central Jamaica, screened 16,612 secondary school children, aged predominantly 15-19 years, and identified 150 students with the β-thal trait and 11 with sickle cell [Hb S (HBB: c.20A>T)]- or Hb C (HBB: c.19G>A)-β-thal. The latter patients may have been subject to symptomatic selection, but this should not have affected those with β-thal trait. Of the 24 different molecular mutations, β 0 -thal genes accounted for 10.0-27.0% of these groups and most common was IVS-II-849 (A>G) (HBB: c.316-2A>G). Of the β + mutations, seven subjects had severe genes with low levels of β chain synthesis but the majority were benign mutations in the promoter region. The -29 (A>G) (HBB: c.-79A>G) mutation dominated in the newborn study in Kingston, similar to experiences in Guadeloupe and African Americans but the -88 (C>T) (HBB: c.-138C>T) mutation was more common among school students in central Jamaica. Caribbean populations are genetically heterogeneous but variations within different parts of Jamaica is of potential importance for prenatal diagnosis and genetic counseling. This information may also be useful among the large Jamaican diaspora.

Objective: The thalassemias is a group of hereditary disorders with impaired production of functional hemoglobin. In this report we described a rare case of compound heterozygous mutation of South-East Asia type hereditary persistence of fetal hemoglobin (SEA-HPFH) and β -thalassemia that allowed prenatal diagnosis to be performed in a subsequent pregnancy in the family., Case Report: The father showed a SEA-HPFH thalassemia trait phenotype, while his genotype revealed that he was heterozygous for the SEA-HPFH deletion; The mother genotype was heterozygote for IVS-II-654 mutation; the second child had co-inherited both parental mutations and was, thus, a compound heterozygote for β-thalassemia (IVS-II-654)/SEA-HPFH deletion. His phenotype was intermediate β-thalassemia. Prenatal genotyping of a fetal sample during the third pregnancy confirmed the fetus was only heterozygote for SEA-HPFH deletion and the parents elected to continue the pregnancy., Conclusion: We described the clinical and molecular characterization of the first detected case of compound β-Thalassemia/SEA-HPFH deletion in Northern Vietnam. The report also highlighted the accuracy and necessity of mutation screening for families with thalassemia to inform accurate genetic counseling and targeted prenatal diagnosis when desired., (Copyright © 2018. Published by Elsevier B.V.)

Background: To date, there has been no systematic study of DNA-based prenatal diagnosis of thalassemia in pregnant Hakka women in southern China., Methods: A total of 279 pregnant Hakka women with confirmed cases of thalassemia who had been treated at the Meizhou People's Hospital in China's Guangdong Province from January 2014 to December 2016 were here enrolled. Genomic DNA was extracted from peripheral blood of couples and villus, amniotic fluid, or fetal cord blood. DNA-based diagnosis was performed on the tissues of fetuses whose parents had tested positive for α- and β-globin gene mutations were found using polymerase chain reaction (PCR) and flow-through hybridization technique. Follow-up visits were performed 6 months after the fetuses were born. Prenatal diagnosis was performed on 279 fetuses in at-risk pregnancies., Results: Here, 211 α-thalassemia fetuses were confirmed, including 41 (19.43%) that tested positive for Bart's hydrops syndrome and 15 (7.11%) for Hb H disease. There were 103 (48.81%) heterozygotes. β-thalassemia was confirmed in 68 fetuses, including 23 (33.82%) with severe thalassemia and 27 (39.71%) heterozygotes. Another 12 cases were confirmed with α+β-thalassemia, including three cases of severe β-thalassemia. DNA-based testing prenatal diagnosis of thalassemia was found to be highly reliable., Conclusions: Our findings provide key information for clinical genetic counseling of prenatal diagnosis for major thalassemia in pregnant Hakka women in southern China., (© 2017 Wiley Periodicals, Inc.)

β-Thalassemia (β-thal) is a monogenic disease characterized by mutations on the HBB gene, affecting the production of globin that results in hypochromic and microcytic anemia. The aim of this study was to determine the prevalence of six common β-thal mutations, and their frequency and inheritance pattern in affected populations of North Waziristan Agency, Pakistan. In this study, 130 blood samples from 37 unrelated β-thalassemic families having a minimum of one transfusion-dependent child with β-thal major (β-TM), were retrieved either from the Thalassaemia Centre for Women and Children Hospital Bannu or their home towns situated in Noth Waziristan Agency. All samples were analyzed by the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) using six allele-specific primers for the presence of the six β-thal mutations common in the Pakistani population. Of the six common mutations, our study demonstrated five HBB mutations comprising HBB: c.27_28insG, HBB: c.92+5G>C, HBB: c.126_129delCTTT, HBB: c.92+1G>T and HBB: c.17_18delCT from the families studied, while mutation HBB: c.47G>A [codon 15 (G>A)] was not detected in any of the studied families. Furthermore, the HBB: c.27_28insG and HBB: c.92+5G>C were noted to be the most common with frequencies of 42.85 and 31.42%, respectively. The findings of the present study may be useful in launching carrier screening and prenatal diagnosis (PND) programs by screening analyzed and other unanalyzed affected families for the possible presence of common mutations through the ARMS-PCR technique that will help to control the disease.

Background: Beta-thalassemia is common in the Mediterranean area as well as the Middle East and India. Official report in Iran revealed the average prevalence rate of carriers about 4%. More than 20 restriction fragment length polymorphisms (RFLPs) are known in the beta-globin gene cluster and used in the prenatal diagnosis (PND) services. Some of these locations may have low allele frequency and are not informative in the prenatal diagnosis. The current study aims to find new haplotypes and polymorphisms with high allele frequency in the local population., Methods: Two thousand three hundred fifty samples (1,321 male and 1,029 female) from the northern Iran, whom suspected to be the carriers either for alpha or beta thalassemia and referred to the local diagnostic laboratory as a routine services were investigated during five years, (2010-2015). The beta-globin gene was sequenced for all samples., Results: Heterozygosity for five SNPs in the beta-globin gene was calculated separately. 383 individuals (16.29%) showed no sign of nucleotide change in the beta-globin gene sequence. In total, codon2 (C/T) 31.72%, IVSII-16 (C/G) 31.72%, IVSII-74 (G/T) 54.71%, IVSII-81 (C/T) 19.47%, and IVSII-666 (T/C) 31.72% were seen respectively. Although all five polymorphisms showed reasonably high heterozygosity, IVSII-74 (G/T) [GG wild type (36.5%), G/T (54.71%) and TT (8.8%)] revealed the highest heterozygosity rate. Four combinations of these five SNPs were defined as new haplotypes named M1 to M4. ARMS-PCR also were designed and applied to detect IVSII-74 (G/T) nucleotide position., Conclusions: This study represents an intragenic polymorphism, IVSII-74, a reliable position with high heterozygosity rates in Iranian population for PND analysis., Trial Registration: Retrospectively registered.

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

Objective: To explore the acceptance of pregnant Chinese women on giving birth to a child with beta-thalassemia major., Materials and Methods: Women's acceptance on having a child with beta thalassemia major was assessed using standard gamble metrics during an interviewer-administered survey on 309 women recruited in the antenatal clinic. Utility scores were determined and the association with sociodemographic factors was assessed., Results: The median utility score for having a child with beta-thalassemia major was 0.5 (0-0.65). Women having either higher educational level or family income had significantly higher utility scores (P < 0.05) corresponding to a higher acceptance. During the interview 59.9% participants indicated that they would elect to undergo a termination of pregnancy if their fetus was diagnosed with beta-thalassemia major but 26.5% participants were unable to decide what action they would take., Conclusion: Many Chinese pregnant women are ambivalent about giving birth to a baby with beta-thalassemia major. Women with higher educational level or higher family income had a higher acceptance towards the condition., (Copyright © 2017. Published by Elsevier B.V.)

The present study was designed to assess the Knowledge, Attitude and Practices (KAP) of the parents of b-thalassaemia children (410) selected from public (73.2%) and private (26.8%) thalassaemia centers of Rawalpindi-Islamabad. Qualitative and quantitative approaches were used to collect the data, which was analyzed by using SPSS. Majority of the respondents (70%) were rural young parents with no knowledge of thalassaemia before marriage. However, now 81.2% were aware about this. Majority of the respondents (89%) had the knowledge about premarital screening, 86.1% were opposed to intermarriages of carrier and 57% believed that if carrier got married then prenatal diagnosis or Chorionic villus sampling test is necessary. About 76.8% of the couples were screened and 42.2% had an experience of Chorionic villus sampling among which 20% abortions were reported. Overall 82% parents had received genetic counselling. The present study suggests that parent's regular visits and genetic counseling at thalassaemia centers have played important role about awareness.

In the present study, an embedded design was applied in order to conduct a one-year cross-sectional audit of chorionic villus sampling (CVS) and foetal outcomes affected by β-thalassemia major (β-TM) in a prenatal diagnosis (PND) setting. In addition, we explored the decisions regarding pregnancy termination among women whose pregnancy (or child) was affected by β-TM. In the quantitative phase, the available data in the clients' medical records were analysed, while the qualitative phase was performed using a grounded theory method. Interviews were performed with nine pregnant women who had decided against pregnancy termination despite positive CVS results, 11 mothers who had admitted their child to the thalassemia ward for blood transfusion, and 19 mothers who had received positive CVS results and had decided against pregnancy termination in the preceding year. Over one year, 18.6 % of women decided against pregnancy termination despite positive CVS results. Two main themes related to decisions against pregnancy termination emerged from the qualitative data: 1) Cognitive factors (questioning the reliability of the tests or doubts about the accuracy of the results, understanding disease recurrence, curability, perceived severity of the disease, and lack of "real-life experiences"); and 2) Sociocultural responsiveness (family opposition, responsibility before God, and self-responsiveness). All of the mentioned factors could intensify fear of abortion in couples due to possible regret, and encourage a decision against pregnancy termination.

A fetus of Chinese descent presented with ultrasound features of anemia at 20 weeks' gestation. Father had low a mean corpuscular volume (MCV) level. Multiplex gap-polymerase chain reaction (gap-PCR) excluded common α-thalassemia (α-thal) deletions and mutations and PCR sequencing of the α1- and α2-globin genes were negative. The fetus had a normal karyotype. Array comparative genomic hybridization (aCGH) showed a single copy loss of 189.87 kb in chromosome 11p15.4, involving the whole β-globin gene cluster, inherited from the father. Multiplex ligation-dependent probe amplification (MLPA) confirmed the deletion included the ε-globin gene, confirming the diagnosis of heterozygous (εγδβ) 0 -thalassemia [(εγδβ) 0 -thal], also inherited from the father. The fetus had a worsening anemic condition in utero and required a transfusion at 26 weeks' gestation, raising the hemoglobin (Hb) level from 5.3 to 12.6g/dL. A cesarean-section was subsequently performed at 32 weeks' gestation because of reduced fetal movements, and a 1650g baby girl with good Apgar scores was delivered. Hemoglobin at birth was 12.8g/dL, gradually dropping to 6.8 g/dL, requiring three neonatal transfusions. Her condition gradually stabilized after 2 months with Hb stable at 8.0 g/dL. Family screening by MLPA showed that the paternal grandmother carried the same deletion. The deletion in this case is distinct and is the reported first case. The deletion transmitted across three successive generations with great phenotypic variation. The final adult phenotype of (εγδβ) 0 -thal is usually mild, therefore, with accurate prenatal diagnosis this condition is salvageable by in utero and early neonatal transfusions, preventing adverse pregnancy and neonatal outcomes.

Thalassemia is the most common monogenic inherited disease worldwide, affecting individuals originating from many countries to various extents. As the disease requires long-term care, prevention of the homozygous state presents a substantial global disease burden. The comprehensively preventive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Invasive prenatal diagnosis refers to obtaining fetal material by chorionic villus sampling (CVS) at the first trimester, and by amniocentesis or cordocentesis at the second trimester. Molecular diagnosis, which includes multiple techniques that are aimed at the detection of mutations in the α- or β-globin genes, facilitates prenatal diagnosis and definitive diagnosis of the fetus. These are valuable procedures for couples at risk, so that they can be offered options to have healthy offspring. According to local practices and legislation, genetic counseling should accompany the invasive diagnostic procedures, DNA testing, and disclosure of the results. The most critical issue in any type of prenatal molecular testing is maternal cell contamination (MCC), especially when a fetus is found to inherit a particular mutation from the mother. The best practice is to perform MCC studies on all prenatal samples. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal testing that is non-invasive for the fetus and result in significant reduction of invasive diagnostic procedures., (Copyright © 2016. Published by Elsevier Ltd.)

Haemoglobinopathies are among the most common inherited monogenic disorders worldwide. Thalassaemia screening for carrier status is recommended for adults of reproductive age if suspected of being at risk. Conventional laboratory methods for screening include the assessment of haematological indices, and high-performance liquid chromatography, capillary electrophoresis or isoelectric focusing to measure the levels of HbA 2 and HbF, and to identify haemoglobin variants. Each screening method has its advantages and disadvantages, the main disadvantage being that none can fully resolve all variants. The complex nature of the genetics of haemoglobinopathies necessitates expertise in the interpretation of screening results to evaluate the most likely genotypes, which must then be confirmed using the DNA diagnosis. This review highlights the limits and pitfalls of each screening technique, and outlines a rational combination of different methods to overcome issues in thalassaemia carrier detection., (Copyright © 2016. Published by Elsevier Ltd.)