Search

ObjectiveTo explore the exposure-lag-response relationship between temperature and risk of varicella incidence,and to provide a scientific evidence for early warning and precise prevention and control of varicella epidemic.MethodsDaily varicella cases and daily meteorological data were collected in Minhang District, Shanghai from 2010 to 2022. A distributed lag nonlinear model was used to determine the exposure-lag-response relationship between temperature and risk of varicella incidence. Furthermore, effect of temperature on the incidence risk was determined across different age groups.ResultsIn 2010‒2022, the total number of notified varicella cases was 26 207 in Minhang District, with the highest incidence in the group aged 3‒14 years (50.35%). The seasonal pattern of daily varicella cases showed a double peak. The large peak was found in November and December, followed by a smaller peak in May and June. Moreover, the distributed lag nonlinear model showed a unimodal curve in the relationship between temperature and varicella incidence. The RR value reached its maximum peak of 1.90 (95%CI: 1.25‒2.87) at 7 ℃. A reverse U-shape was found in the lag-response curves between temperature and varicella incidence. Furthermore, the effect of temperature on the varicella incidence showed a unimodal pattern in the varicella cases aged 3‒14 years. The RR value reached its peak at 11 ℃ (RR=2.89, 95%CI: 1.33‒6.24). In contrast, the effect of temperature on the varicella incidence in the cases aged 15 years and above showed a unimodal pattern, with RR value reaching the peak at 5 ℃ (RR=2.14, 95%CI: 1.33‒3.44).ConclusionThe unimodal curve is found in the relationship between temperature and varicella incidence. Low temperature is associated with increased risk of varicella incidence. Children aged 3‒14 years are more susceptible to the effect of temperature on the varicella incidence.

Background Based on the particularity of children and the adjustment of birth policy in recent years, the development of pediatrician team is becoming more and more important. However, most of the current studies on the shortage of pediatricians are qualitative, lacking of quantitative researches. Objective To establish a multi-perspective demand forecasting model, comprehensively analyze the shortage of pediatricians in Jiangsu, and provide reference for promoting the development of children's health during the "14th Five-Year Plan" period in Jiangsu Province and accelerating the construction of pediatrician team in the new era. Methods According to the relevant indicators of pediatric medical services in Jiangsu Province in 2018 obtained from "2018 Jiangsu Provincial Health Service Survey and Analysis Report", and the basic data of pediatrics in each city of Jiangsu Province was obtained from "2019 Jiangsu Provincial Statistical Yearbook" and the database of the Jiangsu Provincial Health Statistics Information Center. Using SPSS 24.0 analysis software, a multi-perspective demand forecasting model was developed from the perspectives of supply and demand, and a comprehensive analysis of the number of pediatrician shortage in Jiangsu Province was performed. Results The proportion of female physicians in the pediatrician team in Jiangsu is relatively high. The young and middle pediatricians occupy a leading position. The academic backgrounds of the pediatricians are mainly undergraduate. The professional title structure is much reasonable. Most of pediatricians have been working for over 20 years. Combined with the basic situation of the pediatrician team in Jiangsu and the perspective of supply and demand, the shortage number of pediatricians in Jiangsu Province was 18 300 and the average shortage number of physicians in 13 cities was 1 500. Conclusion There is an overdemand of resources for pediatric care and a high workload for physicians with an imbalance in the gender and title structure of the workforce; the special practice environment leads to increased practice risk. It is necessary to strengthen the personnel training and introduction policies, consolidate the professional foundation of personnel, and explore a new management model of "Internet + medical consortium".

【Objective】 Rainfall is the main cause of erosion of loess soil in the arid regions in northwestern China. Understanding the relationship between soil erosion and rainfall characteristics is hence important to ameliorate soil erosion. In this paper, we analyzed individual erosive rainfall and proposed a model to predict rainfall erosivity. 【Method】 The analysis is based on erosive rainfall data measured in five years from two typical runoff fields, one is a hilly small waterhead located in Anjiagou and the other one is a small gully waterhead in Longtan, both in Gansu province. The relationship between soil erosion structure of rainfall (P) × rain intensity (I) and E×I30 was established. 【Result】 Rainfall erosivity above 50 MJ·mm/(hm2·h) was the main cause of rainfall erosivity, accounting for 75% of the total erosivity. Rainfall P and rainfall kinetic energy E was linearly correlated in that E=0.205 7P-1.067 1 (R2=0.763, n=48). Rainfall single factors I30 (30-minute rainfall intensity), I60 (60-minute rainfall intensity) and E significantly impacted soil loss (S) (P0.616 (PP>10 mm. Compared with measurements, the relative error of the predicted results of the two models was less than 16%. The rainfall erosivity was above 50 MJ·mm/(hm2·h), and the relative error of the predicted rainfall erosivity was less than 10%. 【Conclusion】 Both models predicted rainfall erosivity well, and P×I30, P×I60 can be used as index factors to estimate individual rainfall erosivity under 50 mm>P>10 mm in the studied regions.

[Objective] In the context of the inventory of state-owned natural resource assets, we aimed to explore the optimization path of the grassland resource assets inventory pricing system from various aspects, such as the division of homogeneous areas, the indicator system of the inventory price and the price correction system, and finally to construct an optimization framework for the pricing system and verify its scientific value and applicability. [Methods] Indicators such as grassland type, grassland area, hay yield, and grassland grade were selected based on 21 attribute fields of 196892 polygons from the natural grassland resources inventory in Qinghai Province, and the regionalization of provincial grassland homogeneous areas in Qinghai Province were performed based on the regionalization with dynamically constrained agglomerative clustering and partitioning (REDCAP) method. Using the principle of pricing by grade and by type, grassland grade adjustment coefficients and grassland type-specific prices were introduced to form a set of multi-level and top-down “national homogeneous areas-provincial homogeneous areas-townships” grassland resource assets pricing system. [Results] The four national grassland homogeneous areas in Qinghai Province were refined into 23 provincial grassland homogeneous areas, the number of subareas was reasonable and the characteristics of grassland resources of different subareas were significantly different. The grassland prices at the township scale were between the 30% upper and lower bounds of the grassland prices of the national homogeneous areas. [Conclusion] An optimization framework for the inventory pricing system of grassland resource assets driven by the knowledge of natural resource assets and with an intelligent regionalization algorithm as the core is proposed in this study, which can not only support the construction of the technical system, but also aid the value assessment work for the inventory of natural resource assets.

Nowadays, important facilities and equipment using steel structure as the main body are playing more and more important roles in various fields. In order to use the steel structure more widely and safely, the corrosion problem of the steel structure and its connecting parts needs to be solved. The petrolatum tape covering(PTC) technology and oxidizable tape covering(OTC) technology are useful methods to improve the corrosion resistance of steel structure. The PTC technology applys to steel structures in zones with harsh corrosion environment(such as the splash zone), while the OTC technology applys to steel structures with special shapes in atmospheric zone. This paper introduced the corrosion problems of special-shaped steel structures in the splash zone and atmospheric zone, putted forward the solution of wrapping anti-corrosion technology, and then summarized the practical application of wrapping anti-corrosion technology in steel structure engineering and its protection effect. With the continuous improvement of relevant technologies and industries, the PTC and OTC wrapping anti-corrosion technologies would play more important roles in more fields, contribute to marine power and promote high-quality development.

Objective To find the trends and regional differences of the resistance of Helicobacter pylori(Hp) to metronidazole, clarithromycin, levofloxacin, amoxicillin, furazolidone and tetracycline in recent years in the mainland of China. Methods By searching several databases, the literatures on the resistance of Hp to six commonly prescribed antibiotics in mainland of China were collected and analyzed with Stata15 software. The antibiotic resistance in Huaihe Hospital of Henan University was reviewed and compared. Results The investigation results from 2013 to 2020 showed that rate of Hp metronidazole resistance was the highest and the clarithromycin was the second, while the rate of resistance to amoxicillin was the lowest one. The amoxicillin resistance in the south of China was significantly higher than that in the north of China. The resistance to metronidazole, clarithromycin, levofloxacin and amoxicillin reached (or closed to) the highest level from 2019 to 2020. At present, the resistance to amoxicillin and furazolidone was low and the resistance to clarithromycin was the highest in Huaihe Hospital of Henan University. Conclusions The resistance of Hp to antibiotics in the mainland of China was at a relatively high level. The resistance rate to metronidazole and clarithromycin was high, while that to amoxicillin was low. The antibiotic resistance of HP was more popular in the south of China.

Objective To evaluate the biological effect of cinobufagin(Cin) on nasopharyngeal carcinoma (NPC) cells lines(CNE2 and HONE1) and the mechanism of its efficacy. Methods CNE2 and HONE1 cells were treated with different concentrations (0, 5, 15 and 45 mg/L) of Cin for 24, 48 and 72 h respectively and cell viability was detected by CCK-8 assay. After 48 hrs, cell morphology was observed by phase contrast microscopy; cell apoptosis was detected by TUNEL fluorescence staining; the level of reactive oxygen species (ROS) in cells were assessed by DCF fluorescence assay; the expression levels of apoptosis-related proteins were detected by Western blot. Results Cin inhibited the cell activity of NPC cells in a concentration-dependent manner (P＜0.05, P＜0.01 or P＜0.001) and the cells showed filament and sparse morphology. Cin promoted apoptosis and increased intracellular ROS level in NPC cells (P＜0.05, P＜0.01 or P＜0.001). Cin inhibited the expression of Bax and mitochondrial cytochrome c (Cytc) (P＜0.05, P＜0.01 or P＜0.001) but promoted the expression of Bcl-2, cleaved caspase-3 and cytoplasmic Cytc (P＜0.01 or P＜0.001). Conclusions Cin can inhibit cell proliferation and promote apoptosis of NPC cells.

As computer systems grow in scale, complexity, and user demands for higher quality of service, the importance of logging systems has increased significantly. Logs are records of data or events generated during the operation of computer systems, and abnormal data in log entries often indicate performance fluctuations, anomalies, or failures within the system. Existing research on log anomaly detection mostly relies on a single feature, leading to issues such as inefficiency, incompleteness, and high misjudgment rates. This paper proposes a multi-feature-based approach for detecting anomalies in log events. Firstly, we define the multi-dimensional features of logs, including sequential, quantitative, semantic, and temporal features. Secondly, we utilize BERT combined with TF-IDF to obtain semantic feature vectors and integrate these features to form the input for our model. Finally, we establish a Bi- LSTM anomaly detection model based on an attention mechanism. Experiments show that the proposed anomaly detection model achieves a certain improvement in accuracy, providing a valuable reference for assisting in the discovery of log anomalie [ABSTRACT FROM AUTHOR]

Objective To report 3 cases of infratentorial superficial siderosis of central nervous system and analyze its etiology and clinical manifestations. Methods and Results The main clinical symptoms were recurrent headache or epilepsy (3 cases) with obvious hearing loss (2 cases); the appearance of cerebrospinal fluid of lumbar puncture was cloudy and bloody fluid, with increased red blood cell count and protein quantity (2 cases). MRI scan of head or cervical spine showed siderosis deposition on the surface of cerebellum hemisphere, pons and midbrain without enhancement, and occupying lesion at jugular foramen was seen at the same time (Case 1); tortuous vessels on the surface of cervical spinal cord, epidural effusion at the level of C6⁃7 vertebral body, C7 dural defect (Case 2) or paraventricular hemorrhage (Case 3). There were no abnormal findings in angiography of the whole brain. The clinical diagnosis was infratentorial superficial siderosis of central nervous system (type Ⅰ 2 cases, type Ⅱ 1 case). The causes were neurilemmoma, traumatic dural defect or cerebrovascular malformation. According to the cause of the disease, the left C7 dural defect repair (Case 2) or left occipital lobe hematoma removal (Case 3) were performed. The patients' condition improved significantly and the headache disappeared. Conclusions The etiology of infratentorial superficial siderosis of central nervous system is heterogeneous. Detailed auxiliary examination is of great significance in avoiding misdiagnosis or missed diagnosis.

A modified pole-zero matched discretization method is peresented for overcoming performance degradation of the notch filter discreted by currently popular methods when the notch frequency approaching the Nyquist frequency.The frequency characteristic of the discreted notch filter is kept up with that of notch filter in continuous domain by modifying damping ratio of transfer function in continuous domain to a constrained expectation. The numerical solution is obtained by solving a specified constraint equation and the difficulty of solving complex transcendental equation is avoided.The performance of digital notch filter is tested in digital simulation with conditions that the notch frequency with limited uncertainties.The simulation results show that the modified pole-zero matched discretization method presented in this paper is valid to overcome the drawback of currently popular discretization methods when the notch frequency approaching the Nyquist frequency.

Objective To investigate nursing interns' self-efficacy of clinical nursing assessment skills and its influencing factors, both at the middle and the final stages of their internship, so to improve the quality of clinical teaching and students' assessment skills. Methods We used convenience sampling to enroll nursing students who completed their internship in Peking Union Medical College Hospital from January 2016 to December 2017. A self-designed questionnaire was introduced to evaluate their self-efficacy of clinical nursing assessment skills in the middle and the final stages of internship. Differences between the two stages were compared, and influencing factors were analyzed. Results Forty-five students (with junior college diploma or above) were included, with a mean age of (22.0±1.1) years. There were 9 males (18.0%), and the mean interning duration were (6.0±1.4) months in the middle stages of internship and (10.2±1.6) months in the final stage. Scores of self-efficacy at admission were similar between the middle and final stages of internship. However, students at the final stage of internship got significantly higher scores both in total and in therapeutic assessment skills than those in the middle internship stage (77.3±7.9 versus 73.5±11.0, P＜0.05; 38.9±5.9 versus 36.2±7.8,P＜0.05).Gender, age and diploma were related to scores of self-efficacy in the mid-final stage of internship (P＜0.05). Conclusions Clinical teaching played a critical role in the education of nursing students. Targeted teaching measures should be taken to promote their ability of training assessment according to the stages of their internship, their gender, age and diploma, so to further improve the quality of clinical training.

This paper summarized the Traditional Chinese Medicine(TCM) nursing experience of a case of Guillain-Barre syndrome complicated with chronic hepatitis B virus (HBV)infection. Based on the principle of TCM syndrome differentiation, a set of TCM nursing interventions including emotional nursing, dietary care and TCM techniques were carried out, in order to alleviate the patient’s condition and promote the limb function and ability of independent living. (总结1例吉兰-巴雷综合征并慢性乙型病毒性肝炎患者的中医护理。根据辨证施护的原则, 落实中医情志护理、膳食调护、中医适宜技术等中医护理措施, 促进患者病情缓解, 最大程度恢复患者肢体运动功能及独立生活能力。)

Human brain bank is the foundation for neurology and neuroscience, which provides research materials for medical scientists to explore what happen in human brains. Through voluntary postmortem brain tissue donation, brain bank collects, classifies, stores and distributes brain tissue samples for researchers with appropriate research proposals, so as to facilitate researchers to conduct human brain research. History showed that the act of brain only autopsy distinguished neurology as a distinct discipline. The emerges of brain banking accompanied with the advances of neurology and neuroscience. It facilitates the development of neurology from neuropathological examination feedback about the clinical presentations of the brain donor, plays an important role in the definition of novel neurological diseases, and also makes an extraordinary contribution to the disease mechanisms and novel therapeutic discoveries. This manuscript elaborated the history, current situation, and the impacts of human brain banking on current neurology. Furthermore, we discussed about the opportunities and challenges of brain banking in China. DOI:10.3969/j.issn.1672⁃6731.2020.10.012

Objective To summarize the clinical, pathological and genetic features of 10 patients with late ⁃ onset mitochondrial encephalomyopathy with lactic acidosis and stroke ⁃ like episodes (MELAS). Methods and Results The clinical data of 10 patients with late ⁃ onset MELAS were retrospectively analyzed from January 2007 to December 2018. Muscle biopsy was performed in 8 cases. Polymerase chain reaction ⁃ fragment length polymorphism (PCR⁃RFLP) analysis and whole sequencing of mitochondrial DNA (mtDNA) were used to screen mtDNA mutations, and the mutation load of m.3243A > G in blood was detected by pyrophosphate sequencing. The onset age of the first stroke ⁃like episodes were 40-67 years old in all patients. The main manifestations included epilepsy, aphasia, headache, dementia, mental disorder, limb paralysis and visual impairment. Past history revealed 5 cases with diabetes mellitus, 6 with deafness, 3 with hypertension and 2 with stroke. Six patients had a family history of maternally inherited diabetic mellitus, and 2 had a family history of MELAS. Laboratory examination revealed 6 cases with hyperlipidemia, 6 with carotid atherosclerosis, 1 with stenosis of right internal carotid artery and middle cerebral artery. Brain MRI showed cortex lesions involving one or more lobes in all patients, and 4 cases also had multiple infarctions in brainstem and basal ganglia. Muscle biopsy demonstrated ragged red fiber (RRF) and strongly succinate dehydrogenase ⁃ stained vessels (SSVs) in all of 8 patients except one. Genetic analysis identified 9 cases with m.3243A > G, and 1 with m.10191T > C mutation. The blood mutation load of m.3243A > G was 9%-33% in 7 cases. Conclusions The clinical phenotype of patients with late ⁃ onset MELAS was not significantly different from that of typical patients. However, the age of onset in late ⁃ onset MELAS was late, and it could be complicated with a variety of cerebrovascular risk factors and atherosclerosis. The hotspot mutation of this group of late ⁃ onset MELAS patients was m.3243A > G, but the mutation rate in blood was low. DOI：10.3969/j.issn.1672⁃6731.2020.03.015

Objective To investigate the clinical and neuropathological features of N-hexane toxic peripheral neuropathy which was misdiagnosed as chronic inflammatory demyelinating polyradiculoneuropathy (CIDP). Methods and Results Two patients presented with subacute or chronic peripheral neuropathies after close exposure of N-hexane for 6 to 8 months, starting from weakness and numbness of bilateral distal lower limbs and gradually progressing to proximal lower limbs and upper limbs. The worsening of clinical symptoms was delayed after keeping out of toxic working environment. Decreased motor nerve conduction velocity (MNCV) and sensory nerve conduction velocity (SNCV) of all limbs as well as marked decrease of amplitude, with lower extremities predominantly, were detected in both cases. Sural nerve biopsies revealed mild to moderate loss of myelinated fibers, formation of giant axons, Wallerian degeneration and rare regenerating clusters. The giant axons were filled with neurofilaments and granular materials. The patients were required to keep away from toxic working environment and were treated with vitamin B, and the prognosis was good. Conclusions The clinical symptoms and cerebrospinal fluid (CSF) findings of N-hexane toxic peripheral neuropathy are similiar to CIDP. Peripheral nerve biopsy can play a key role in the diagnosis of the disease. DOI: 10.3969/j.issn.1672-6731.2019.06.006

Objective To explore the expression differences of serum muscle enzymes among different types of myopathies and viral hepatitis. Methods This study enrolled 578 patients with myopathies and 51 patients with viral hepatitis from January to September 2018. Serum muscle enzymes [creatine kinase (CK), lactic dehydrogenase (LDH), aspartate aminotransferase (AST), alanine aminotransferase (ALT) and AST/ALT ratio] were detected in all patients, and the expression differences of serum muscle enzymes were compared among different types of myopathies, and between myopathies and viral hepatitis. Results In myopathy patients, there were significant differences on the values of CK (χ2 =107.710, P = 0.000), LDH (χ2 = 36.832, P = 0.000), AST (χ2 = 47.608, P = 0.000) and ALT (χ2 = 31.722, P = 0.000) among different types of myopathies. Patients with muscular dystrophy had significantly higher expression of CK and LDH than inflammatory myopathy (Z = 9.297, P = 0.000; Z = 2.475, P = 0.040) and metabolic myopathy (Z = 6.765, P = 0.000; Z = 5.983, P = 0.000), higher expression of AST than metabolic myopathy (Z = -5.363, P = 0.000), and higher ALT than inflammatory myopathy (Z = 5.619, P = 0.000). The value of LDH in metabolic myopathy patients was significantly higher than that in inflammatory myopathy (Z = 4.590, P = 0.000). Compared with patients with viral hepatitis, myopathy patients had significantly increased CK (Z = -10.975, P = 0.000), LDH (Z = -6.967, P = 0.000) and AST/ALT ratio (Z = -5.605, P = 0.000), and decreased ALT (Z = 3.949, P = 0.000). Receiver operating characteristic (ROC) curve showed the area under the curve (AUC) of CK, LDH, AST, ALT and AST/ALT ratio were 0.943 (95% CI: 0.919-0.966, P = 0.000), 0.818 (95%CI: 0.756-0.881, P = 0.000), 0.446 (95%CI: 0.350-0.542, P = 0.217), 0.323 (95% CI: 0.224-0.422, P = 0.000), 0.745 (95% CI: 0.671-0.819, P = 0.000), respectively. In the differential diagnostic test between myopathies and viral hepatitis, the sensitivity of CK and ratio of AST/ ALT was 0.880 and 0.512, the specificity of which was 0.961 and 0.882, the maximum Youden index of which was 0.841 and 0.394. Conclusions The serum muscle enzymes spectrum in different types of myopathies were different, but there existed some rules, which could provide clues for clinical classification of myopathies. The ratio of AST/ALT had suggestive values in the differential diagnoses between myopathies and viral hepatitis. For patients with increased transaminase of unknown reasons, serum CK should be detected. DOI: 10.3969/j.issn.1672-6731.2019.05.006

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type Ⅱ patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type Ⅱ. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type Ⅱ, and his family was diagnosed as Alexander's disease type Ⅱ pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. DOI: 10.3969/j.issn.1672-6731.2019.03.010

Objective To evaluate the diagnostic value of skeletal muscle biopsy in asymptomatic and pauci-symptomatic hyperCKemia. Methods and Results A total of 146 patients with asymptomatic or pauci - symptomatic hyperCKemia diagnosed in Peking University First Hospital from July 2020 to February 2023 were selected, and skeletal muscle biopsy was performed. About 72.60% (106/146) had histological changes, including muscular dystrophy (n = 73), inflammatory or necrotizing myopathy (n = 16), other myopathy (n = 15), and neurogenic skeletal muscle damage (n = 2). The positive rate of pathological diagnosis was 50.68% (74/146), including muscular dystrophy 82.43% (61/74), inflammatory myopathy 8.11% (6/74) and metabolic myopathy 9.46% (7/74). The positive rate of etiological diagnosis was 85.62% (125/146), including muscular dystrophy 67.20% (84/125), inflammatory myopathy 13.60% (17/125), metabolic myopathy 7.20% (9/125) and other causes 12% (15/125). Compared with different subgroups, the proportion of pathological changes ((χ² = 14.043, P = 0.000; (χ² = 12.740, P = 0.000), the positive rate of pathological diagnosis ((χ² = 10.641, P = 0.001; (χ² = 25.530, P = 0.000) and etiological diagnosis (Fisher's exact probability: P = 0.001; χ² = 10.811, P = 0.001) in the significantly elevated creatine kinase (CK) level group and the adolescent group was significantly higher than those in the mildly elevated CK level group and the adult group. The positive rate of pathological diagnosis in the asymptomatic group was higher than the pauci-symptomatic group (χ² = 4.792, P = 0.029). There were significant differences in the etiological ratio between the mildly elevated CK level group and the significantly elevated CK level group (Fisher's exact probability: P = 0.000), the adolescent group and the adult group (χ² = 86.149, P = 0.000), and the asymptomatic group and the pauci - symptomatic group (χ² = 20.608, P = 0.000). Conclusions Skeletal muscle biopsy was important in etiological diagnosis of asymptomatic and pauci-symptomatic hyperCKemia. Muscular dystrophy is a common cause of asymptomatic and pauci-symptomatic hyperCKemia. [ABSTRACT FROM AUTHOR]

Objective To investigate the clinical manifestations and auxiliary examination features of necrotizing autoimmune myopathy (NAM). Methods According to the inclusion criteria from European Neuromuscular Center (ENMC) International Workshop on idiopathic inflammatory myopathies published in 2004, 57 patients were diagnosed as NAM from 107 patients with necrotizing myopathy (NM). The risk factors, clinical symptoms, laboratory tests, electrocardiography (ECG), electromyography (EMG), skeletal muscle MRI and muscle pathology were retrospectively analyzed. Results There were more female patients than male patients (male∶female = 1.00∶1.59), with the peak onset age during 40 to 59 years old (43.86% , 25/57) in this study. Clinical types included idiopathic NAM, NAM with connective tissue disease, statin-associated NAM and NAM with cancer. Muscle weakness mainly affected proximal muscle, while it may simultaneously affect distal muscle (28.07% , 16/57). Serum creatine kinase (CK) elevated apparently (420-15 320 U/L). Serum anti-signal recognition particle (SRP) antibodies were detected in 24 out of 44 patients (54.55%). A total of 41 in 45 patients (91.11%) were detected myogenic damage on EMG, and 15 patients (33.33%, 15/45) also had spontaneous potentials. Thigh muscle MRI showed edema in 25 out of 27 patients (92.59% ) and fatty infiltration in 16 out of 27 patients (59.26% ). Other than necrotic fibers, major histocompatibility complex-1 (MHC-1) on sarcolemma were positive in 98.25% (56/57) cases, and membrane attack complex (MAC) deposition on capillary walls was detected in 92.98% (53/57) cases. Conclusions NAM can happen in all ages, mainly during 40 to 59 years old. Idiopathic NAM is the main type. Its main manifestation involves weakness of proximal muscle, sometimes with distal muscle. Extra-muscle symptoms are rare. Serum anti-SRP antibodies are common in NAM and edema is prominent change in thigh MRI. DOI: 10.3969/j.issn.1672-6731.2016.10.009

Background Late-onset glycogen storage disease typeⅡ(GSDⅡ, Pompe disease) is an autosomal recessive disease exhibiting progressive proximal skeletal muscle weakness and respiratory muscle involvement, caused by deficiency of the lysosomal enzyme acid α-glucosidase (GAA). Most of patients died of respiratory failure. Methods Eleven patients with late-onset glycogen storage disease type Ⅱ underwent respiratory function evaluation, whose diagnosis was confirmed by muscle pathology, GAA activity assay and gene analysis. Respiratory function evaluation included upright and supine position of forced vital capacity (FVC), forced expiratory volume at the first second (FEV1), maximal inspiratory pressure (MIP), maximal expiratory pressure (MEP) and cough peak flow (CPF). All data were compared with predicted value. The decreased value between upright and supine position FVC ( △ FVC) were calculated. The correlation between respiratory function and the age of onset, disease course, motor function, GAA activity were analyzed. Results All of 11 patients with late-onset glycogen storage disease type Ⅱ showed declined respiratory function compared with predicted value. The upright FVC, upright FEV1, △ FVC, MIP, MEP and CPF declined in 10, 10, 8, 11, 10, and 10 patients, respectively. All patients had normal FEV1/FVC in both upright and supine position. There was no correlation between upright FVC, △ FVC and the onset age, disease course, motor function, GAA activity statistically. Conclusions Pulmonary dysfunction is common in late-onset glycogen storage disease type Ⅱ, with restrictive ventilatory impairment more predominant, which is caused by inspiratory muscle weakness. doi: 10.3969/j.issn.1672-6731.2014.05.007

In order to solve the problems of low surface energy, long microbial attachment time and slow start of membrane hanging in the process of enhanced water purification, an iron carbon fiber-CF artificial water mat was constructed by combining waste iron and carbon fiber water mat. The heavily polluted surface water was used as raw water. Under the condition of stage aeration, the experiment of enhanced membrane hanging was carried out. The results showed that compared with carbon fiber artificial aquatic mat, the adhesion performance of biofilm on iron carbon fiber artificial aquatic mat was significantly improved, the hanging rate of biofilm increased from 125.1% to 133.0%, and the size of biofilm cluster structure was significantly larger. The polysaccharide, protein and protein-to-polysaccharide ratio in the extracellular polymer of biofilm changed from 53,11 mg/gVSS and 1.33 to 39, 106 mg/gVSS and 2.71 at the end of the initiation period (21 d), respectively. The enrichment and screening of Pseudomonas bacteria by iron-carbon materials improved the movement ability of bacteria and promoted the secretion of extracellular polymers by bacteria. In addition' the highly expressed functional genes of microorganisms were highly expressed in ICF, which improved the adhesion performance of microorganisms on the surface of iron-carbon fiber materials. [ABSTRACT FROM AUTHOR]

Objective To summarize the clinical, imaging and genetic characteristics of spinocerebellar ataxia 2 (SCA2) families presenting as Parkinsonism. Methods and Results Two families with autosomal dominant SCA2 with Parkinson's syndrome diagnosed by genetic test in Peking University First Hospital from May 2019 to December 2020 were included. The probands in 2 families manifested as lead-pipe like rigidity and cerebellum ataxia. Electronystagmography (ENG) in proband of family 1 showed gaze nystagmus, understable saccade, decreased smooth tracking ability and disappeared optokinetic nystagmus, proband of family 2 showed slow saccade, decreased smooth tracking ability and decreased optokinetic nystagmus. Head MRI in both probands of 2 families showed slightly enlarged third ventricle, while the proband of family 2 showed atrophy in brain stem and cerebellar. Whole exome sequencing (WES) in 2 probands showed no gene mutations, Sanger sequencing showed dynamic mutation of ATXN2 gene and the copy number of cytosine-adenine-guanine (CAG) with 37 repeats. Two probands were finally diagnosed as SCA2, and two pedigrees were diagnosed as SCA2 pedigrees. Conclusions SCA2 can present as Parkinsonism, which is easily to be misdiagnosed as Parkinson's disease due to the effective treatment of levodopa. ENG is helpful in detecting subclinical cerebellar lesions. For Parkinsonism patients with family history, especially when cerebellar lesions are involved, ATXN2 gene testing is recommended. [ABSTRACT FROM AUTHOR]

Flavonoids are important secondary metabolites in plants and play significant roles in plant growth and development. They have antioxidant activity and are beneficial to human health. Foxtail millet is rich in nutrients, making it a healthy grain and popular among consumers. The crop is gaining more and more attention as a C4 model plant. However, there are few studies on the metabolic regulatory mechanism of flavonoids in foxtail millet. In this study, the panicles of flavonoid-rich variety JG21 and flavonoid-less variety NMB were analyzed on the flavonoid metabolomic profiles. Transcriptome sequencing was performed on the panicles of JG21 at different developmental stages. Transcription factors involved in regulating flavonoid metabolism were identified by weighted gene correlation network analysis (WGCNA). The expression patterns of these genes were verified by qRT-PCR. The results showed that the main flavonoid components enriched in the spikelets of foxtail millet were apigenin, vitexin, and naringenin, accounting for more than 79% of the total flavonoids. The flavonoid-related network of JG21 contained 38,921 genes, which were divided into 32 modules. Among them, the turquoise module, green module, and magenta module were significantly correlated with flavonoid metabolism. A total of 27 transcription factor families related to the regulation of flavonoid metabolism were identified by using differentially expressed genes related to flavonoid metabolism pathway as the hubs, and 11 transcription factors were obtained through promoter binding motif analysis. Pearson correlation analysis showed that 7 out of the 11 transcription factors might be involved in flavonoid metabolism, which were WRKY38, MYB4a, PI, WRKY15, WRKY62, MYB46, and WRKY23, respectively. The above results provide new candidate genes for studying the transcriptional regulation mechanism of flavonoids and lay a foundation for further investigation of the flavonoid metabolism regulation mechanism in foxtail millet. [ABSTRACT FROM AUTHOR]

Objective To report the characteristics of cardiac involvement in a group of patients with mitochondrial encephalomyopathy with lactic academia and stroke-like episodes (MELAS). Methods A total of 113 patients with MELAS who were admitted to Peking University First Hospital from January 2010 to December 2019 were included. The type and severity of heart disease were judged by electrocardiogram (ECG) and echocardiography. Cardiac dysfunction and systolic function were assessed by New York Heart Association (NYHA) classification and left ventricular ejection fraction (LVEF). Results All 113 patients were from 112 families, and the main genotype was m. 3243 A>G (81.42%, 92/113). ECG was performed in 113 cases, among which 14 (12.38%) had abnormal cardiac conduction, including 10 (8.85%) with pre-excitation syndrome, 3 (2.65%) with complete or incomplete right bundle branch block, and one (0.88%) with I° atrioventricular block. Echocardiography was performed in 70 cases, among which 18 (25.71%) had myocardial lesions, including 13 (18.57%) with myocardial damage and 5 (7.14%) with pulmonary hypertension (PH). Only one case had NYHA II with decreased left ventricular systolic function. In 32 patients with cardiac disease, only one patient presented cardiac symptoms in the 7th year of the course of disease. Conclusions MELAS patients may have various manifestations of cardiac involvement, including cardiomyopathy, heart failure, arrhythmia, and so on. Attention should be paid to cardiac-related examinations. [ABSTRACT FROM AUTHOR]

Objective To investigate the endemic fluorosis in drinking water type in Liaoning Province and the control effect of endemic fluorosis area, and we evaluate the implementation of prevention and control measures and the control effect of dental fluorosis according to the division of endemic fluorosis areas (GB17018-2011). Methods The fluoride content in drinking water, dental fluorosis in 8-12 years old children were investigated in all fluorosis areas of drinking water in Liaoning Province in 2019. One peripheral water sample was collected from the village of the improved water disease area for water fluoride content detection. Each one water sample was collected from the drinking water source of the villages in the decentralized water improvement and no water improvement areas according to the five directions of east, west, south, north and central. If there were less than 5 drinking water sources, all of them will be collected. Then the fluorine content of the samples was determined. The prevalence of dental fluorosis in 8-12 years old children born and living in the village were investigated. The inspection rate should not be less than 90%. Results A total of 2 496 villages were monitored, including 2 279 villages with water improvement, accounting for 91.3% of the monitored villages, and 217 villages without water improvement, accounting for 8.7% of the monitored villages. Among the villages in the water improvement area, there were 2 011 normal operation projects, accounting for 88.2% of the water improvement villages, 64 intermittent operation projects, accounting for 2.8% of the water improvement villages, and 204 abandoned water improvement projects, accounting for 9.0% of the water improvement villages. The qualified rate of fluoride in the water improvement area was 91.8%. A total of 36 542 children aged 8 to 12 years old were examined in the province, and 1 713 dental fluorosis patients were detected. The prevalence of dental fluorosis was 4.7%. Conclusions According to the census results, taking counties (cities and districts) as the unit of statistics, 40 sick districts and counties (cities and districts) in the province have achieved fluorosis control, and 15 counties (cities and districts) have not been controlled. Compared with 28 counties (cities and districts) in the self-assessment at the end of the 12th Five Year Plan in 2016, the implementation of water improvement measures has been significantly improved, and the dental fluorosis of children in sick areas has been effectively controlled. However, there are still some problems in some areas that have not been improved and water fluoride in water improvement projects exceeds the standard, which should be paid attention to. [ABSTRACT FROM AUTHOR]

Essential tremor (ET) is a common movement disorder. The phenomenon of familial aggregation suggests genetic factors play important role in its etiology. With the rapid development and wide application of gene sequencing technologies, more and more essential tremor related pathogenic genes and risk/protective genes have been discovered. The express location and cell function of different genes also laid a foundation for the study of the mechanism of essential tremor. In this study, the progress of genes related to essential tremor are reviewed to provide guidance for clinical research. [ABSTRACT FROM AUTHOR]

There are obvious differences in P450 gene polymorphisms between the different races of mankind, and directly affects the metabolism and transformation of about 90% of commonly used clinical drugs in the body. The analysis of the Big Data Institute of the University of Oxford in the United Kingdom suggests that the primaquine drug, which is currently widely used to cure vivax malaria patients, is no longer suitable for clinical use. The reason is that more than 20% of patients with Plasmodium vivax worldwide have impaired CYP2D6 gene metabolism, resulting in ineffective hypnozoite radical cure for patients with incubation period in the liver. At the same time, 14% of vivax malaria patients have glucose 6-phosphate dehydrogenase (G6PD) deficiency, which leads to hemolysis. The two types of patients together exceed 34% of the total number of vivax malaria patients. As a result, the previous view that chloroquine combined with primaquine was not effective in curing vivax malaria patients was mistakenly believed to be due to drug resistance. Shanglin County, Guangxi found that African imported vivax malaria patients still had repeated attacks after repeated eradications with standard doses of chloroquine combined with primaquine, and the test found that the patient was caused by impaired CYP2D6 gene metabolism. After the research team tried to use artemisinin-based drugs and azithromycin for a radical cure, there has been no recurrence for more than 2 years. Therefore, CYP2D6 testing should be carried out for patients with vivax malaria when the effect of conventional radical treatment is not good. At the same time, research and development of new drugs for the eradication of vivax malaria is a major issue facing the world. [ABSTRACT FROM AUTHOR]

According to the latest nationwide survey data of concrete admixture production carried out by the Concrete Admixture Branch of China Building Materials Federation,this paper introduces the overall development of the concrete admixture industry in China in the past five years, analyzes the current market and R & D conditions of two kinds of key concrete admixtures--olycarboxylic acid high-performance water reducer and flash setting admixtures for shotcrete, and discusses the development opportunities and challenges of concrete admixture industry in China during the 14th Five-Year Plan period. [ABSTRACT FROM AUTHOR]

Objective To summarize the clinical phenotypes and genetic mutations of DNAJB6 related myopathies. Methods We retrospectively reviewed the clinical information, laboratory tests, muscle MRIs, electromyography results, muscle pathology examinations and genetic mutations of 2 patients of DNAJB6 related myopathies from one family and reviewed related published literatures of DNAJB6 related myopathies. Results The proband presented with muscle weakness of both proximal and distal limbs, with lower limbs more serious than upper limbs, and proximal more serious than distal. The father of proband presented with abnormal gait, and he could only climb stairs with assistance. Serum creatine kinase (CK) levels of both patients were normal. Muscle MRIs of both patients showed different degrees of fatty infiltration. Muscle biopsies of both patients showed similar changes with dystrophic features, and some muscle fibers with rimmed vacuoles inside, as well as increased internal nuclei and a few regenerating fibers. Genetic tests proved both patients carried the same DNAJB6 gene variant, c.161A>C (p.Glu54Ala), which was the first report in mainland China. The proband was diagnosed as limb - girdle muscular dystrophy D1 (LGMD-D1) type, and the father of proband was diagnosed as distal myopathy. This family was considered as autosomal dominant DNAJB6 related myopathy. Referring to literature, heterogeneities exist in DNAJB6 related myopathies, and different clinical phenotypes could be presented in one single family. Conclusions The phenotypes of DNAJB6 related myopathies include limb - girdle muscular dystrophy and distal myopathy. Muscle pathology shows similar changes of rimmed vacuoles and dystrophic features. This reported family further expands the spectrum of phenotypes of DNAJB6 related myopathies. [ABSTRACT FROM AUTHOR]

The salinization of black land in Northeast China, especially Songnen Plain, is accelerating, greatly challenging the food security in black land. Therefore, the improvement of saline-alkali soil becomes important. The main influencing factors include semi-arid climate, geological conditions, low-lying terrain and groundwater level. The soda saline-alkali lands are well developed in Songnen Plain, with Na+ as the major positive ion, CO32- and HCO3- negative ions in soil salt, characterized by high alkalization. As both the exchanger and adsorbent of ions, zeolite can absorb Na+ and SO42- in saline-alkali soil, reducing soil pH and alkalinity. Moreover, it can increase the capacity of soil to retain NH4+, PO43- and K+, and improve nutrient availability, which is significantly effective in soil improvement. However, due to the uncertainty of zeolite modification, dosage and aging, the future study should pay more attention to the soil improvement in saline-alkali land by zeolite according to local conditions and strengthen the research on zeolite modification and regeneration, so that zeolite can play a greater role in desalination and alkali reduction. [ABSTRACT FROM AUTHOR]

Background Autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction is often misdiagnosed because its main symptoms are syncope and gastrointestinal motility disorder. This study summarized the clinical, electrophysiological and pathological changes of peripheral nerve biopsy of patients of autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction, which could provide reference for diagnosis, differential diagnosis and treatment. Methods and Results The clinical data of 3 patients diagnosied with autoimmune autonomic neuropathy with onset of acute autonomic nerve dysfunction who were hospitalized in Department of Neurology, Peking University First Hospital from February 2016 to February 2019 were collected. All of the 3 patients were young women, presented with onset symptoms as acute orthostatic hypotension and gastrointestinal motility disorder. Two patients had dysuria and dyshidrosis, and 2 patients had pupil changes. Electrophysiology revealed decreased sensory and motor nerve conduction velocity in 2 patients. Abnormal F wave and H reflex were found in 2 patients. The conduction velocity of large myelinated fibers was normal in one patient. In the autonomic function test, 2 patients had decreased Valsalva ratio, decreased heart rate variability of deep breathing. The blood pressure changes during tilt test between lying and upright position of 2 patients in acute stage was more than 30/15 mm Hg. Two patients underwent lumbar puncture, and one patient showed albuminocytologic dissociation. Sural nerve biopsies showed moderate to marked loss of small myelinated fibers and unmyelinated fibers. Two patients in acute stage were treated with immunomodulatory therapy (glucocorticoid combined with intravenous immunoglobulin), and their symptoms improved in varying degrees. Conclusions Autoimmune autonomic neuropathy with acute autonomic nerve dysfunction has unique clinical manifestations. Early consideration of autoimmune autonomic neuropathy followed by diagnostic work-up and prompt immune treatment will help to improve the prognosis. [ABSTRACT FROM AUTHOR]

Objective To investigate the clinical and imaging differences between limb - girdle muscular dystrophy type 2B (LGMD2B) and immune - mediated necrotizing myopathy (IMNM). Methods Forty-five patients with LGMD2B and 45 patients with IMNM from January 2014 to December 2018 were included. Sex, age of onset, age of diagnosis and time of delay in admission were recorded, and serum creatine kinase (CK) level was measured. Cervical flexion, proximal and distal upper limbs, proximal and distal lower limbs were evaluated by Medical Research Council (MRC) Level 6 and muscle strength percentages were calculated. Skeletal muscle fatty infiltration and edema degree on both thighs were evaluated by MRI. Results The onset age (Z = -3.605, P = 0.000) and diagnosis age (Z = -2.757, P = 0.006) of LGMD2B patients were earlier than those of IMNM patients, while the delay time of admission was longer than that of IMNM patients (Z = -4.749, P = 0.000), the serum CK was higher than that of IMNM patients (Z = -2.247, P = 0.025). The muscle strength of neck flexion (Z = -6.320, P = 0.000) and percentage of muscle strength (t = -6.320, P = 0.000), the muscle strengh of proximal upper extremities (Z = -3.528, P = 0.000) and percentage of muscle strength (t = -3.762, P = 0.000) in IMNM patients were lower than those in LGMD2B patients, while the muscle strengh of distal lower extremity (Z = -3.256, P = 0.001) and percentage of muscle strength (t = -2.883, P = 0.004) in LGMD2B patients were lower than those in IMNM patients. LGMD2B patients had higher muscle fatty infiltration degree in anterior group (Z = -3.119, P = 0.002) and posterior group (Z = -2.534, P = 0.011) of thigh muscle than IMNM patients, but IMNM patients had highter thigh muscle edema degree in posterior group than LGMD2B patients (Z = -3.887, P = 0.000). Conclusions Compared with IMNM patients, LGMD2B patients had earlier onset age, longer delay in diagnosis time, worse muscle strength of distal lower extremities, higher serum CK and more obviously thigh muscle fatty infiltration. In IMNM patients, muscle weakness of neck flexion and proximal upper extremities, thigh muscle edema of posterior group were more obvious. These characteristics contribute to the clinical differentiation of the two diseases. [ABSTRACT FROM AUTHOR]

Objective To summarize the clinical, pathological and genetic features of 10 patients with late-onset mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS). Methods and Results The clinical data of 10 patients with late-onset MELAS were retrospectively analyzed from January 2007 to December 2018. Muscle biopsy was performed in 8 cases. Polymerase chain reaction-fragment length polymorphism (PCR-RFLP) analysis and whole sequencing of mitochondrial DNA (mtDNA) were used to screen mtDNA mutations, and the mutation load of m.3243A > G in blood was detected by pyrophosphate sequencing. The onset age of the first stroke-like episodes were 40-67 years old in all patients. The main manifestations included epilepsy, aphasia, headache, dementia, mental disorder, limb paralysis and visual impairment. Past history revealed 5 cases with diabetes mellitus, 6 with deafness, 3 with hypertension and 2 with stroke. Six patients had a family history of maternally inherited diabetic mellitus, and 2 had a family history of MELAS. Laboratory examination revealed 6 cases with hyperlipidemia, 6 with carotid atherosclerosis, 1 with stenosis of right internal carotid artery and middle cerebral artery. Brain MRI showed cortex lesions involving one or more lobes in all patients, and 4 cases also had multiple infarctions in brainstem and basal ganglia. Muscle biopsy demonstrated ragged red fiber (RRF) and strongly succinate dehydrogenase-stained vessels (SSVs) in all of 8 patients except one. Genetic analysis identified 9 cases with m.3243A > G, and 1 with m.10191T > C mutation. The blood mutation load of m.3243A > G was 9%-33% in 7 cases. Conclusions The clinical phenotype of patients with late-onset MELAS was not significantly different from that of typical patients. However, the age of onset in late-onset MELAS was late, and it could be complicated with a variety of cerebrovascular risk factors and atherosclerosis. The hotspot mutation of this group of late-onset MELAS patients was m.3243A > G, but the mutation rate in blood was low. [ABSTRACT FROM AUTHOR]

The application of cool roof or planting roof to top-floor room can improve the indoor hot and humid environment and increase the indoor thermal conform of the building. In order to study the indoor environment, three different roof-setting including cool roof, planting roof and common roof (reference roof) respectively were applied to top-floor room with same function, area, layout, envelope material and orientation in Xiamen. The results show that: Compared with common roof, the cool roof and planting roof can decrease 0.3 °C and 0.6 °C respectively in summer, decrease 0.2 °C and 0.5 °Crespectively in winter, and decrease 0.8 °C and 0.5 °C respectively in transition season. At the same time, the aPMV of cool roof and planting roof can increase 0.23 and 0.59 respectively in the thermal environment category II under non-air conditioned circumstance in summer, and the aPMV of cool roof and planting roof can increase 0.37 and 0.20 respectively in the thermal environment category III in winter. Compare with different roofs, the planting roof for non-air conditioned building in summer can improve the indoor thermal environment better, and the cool roof for non-heating building in winter can augment adverse effect more in hot summer and warm winter zones. [ABSTRACT FROM AUTHOR]

Objective To understand the nursing students' experience of eldercare during their internship, and to provide basis for improving the intention of nursing elderly. Methods A phenomenological research method and semi-structured interviews were conducted to 12 nursing students who practiced in three first-class hospitals in Lanzhou from September to December 2018. The Colaizzi's seven-step analysis method was used to sort, analyze and summarize the collected data. Results The negative experience of nursing students included communication difficulty, the gap between theory and practice, heavy workload and pressure, lack of knowledge and ability. Positive experience mainly included getting along with elderly people, improved various abilities and learning from good examples of teachers. Conclusion Nursing students' experience of eldercare may be influenced by their working place environment, teachers and their own ability. The geriatric nursing teaching can be improved according to the environment of different departments, giving full play to the role of teachers as role models, and improving the communication and independent learning ability of nursing students, in order to change their negative experience and enhance their willingness of eldercare. [ABSTRACT FROM AUTHOR]

Objective To investigate the clinical and neuropathological features of N-hexane toxic peripheral neuropathy which was misdiagnosed as chronic inflammatory demyelinating polyradiculoneuropathy (CIDP). Methods and Results Two patients presented with subacute or chronic peripheral neuropathies after close exposure of N-hexane for 6 to 8 months, starting from weakness and numbness of bilateral distal lower limbs and gradually progressing to proximal lower limbs and upper limbs. The worsening of clinical symptoms was delayed after keeping out of toxic working environment. Decreased motor nerve conduction velocity (MNCV) and sensory nerve conduction velocity (SNCV) of all limbs as well as marked decrease of amplitude, with lower extremities predominantly, were detected in both cases. Sural nerve biopsies revealed mild to moderate loss of myelinated fibers, formation of giant axons, Wallerian degeneration and rare regenerating clusters. The giant axons were filled with neurofilaments and granular materials. The patients were required to keep away from toxic working environment and were treated with vitamin B, and the prognosis was good. Conclusions The clinical symptoms and cerebrospinal fluid (CSF) findings of N-hexane toxic peripheral neuropathy are similiar to CIDP. Peripheral nerve biopsy can play a key role in the diagnosis of the disease. [ABSTRACT FROM AUTHOR]

Objective To explore the expression differences of serum muscle enzymes among different types of myopathies and viral hepatitis. Methods This study enrolled 578 patients with myopathies and 51 patients with viral hepatitis from January to September 2018. Serum muscle enzymes [creatine kinase (CK), lactic dehydrogenase (LDH), aspartate aminotransferase (AST), alanine aminotransferase (ALT) and AST/ALT ratio] were detected in all patients, and the expression differences of serum muscle enzymes were compared among different types of myopathies, and between myopathies and viral hepatitis. Results in myopathy patients, there were significant differences on the values of CK (χ² = 107.710, P = 0.000), LDH (χ² = 36.832, P = 0.000), AST (χ² = 47.608, P = 0.000) and ALT (χ² = 31.722, P = 0.000) among different types of myopathies. Patients with muscular dystrophy had significantly higher expression of CK and LDH than inflammatory myopathy (Z = 9.297, P = 0.000; Z = 2.475, P = 0.040) and metabolic myopathy (Z = 6.765, P = 0.000; Z = 5.983, P = 0.000), higher expression of AST than metabolic myopathy (Z = - 5.363, P = 0.000), and higher ALT than inflammatory myopathy (Z = 5.619, P = 0.000). The value of LDH in metabolic myopathy patients was significantly higher than that in inflammatory myopathy (Z = 4.590, P = 0.000). Compared with patients with viral hepatitis, myopathy patients had significantly increased CK (Z = - 10.975, P = 0.000), LDH (Z = - 6.967, P = 0.000) and AST/ALT ratio (Z = - 5.605, P = 0.000), and decreased ALT (Z = 3.949, P = 0.000). Receiver operating characteristic (ROC) curve showed the area under the curve (AUC) of CK, LDH, AST, ALT and AST/ALT ratio were 0.943 (95% CI: 0.919-0.966, P = 0.000), 0.818 (95%CI: 0.756-0.881, P = 0.000), 0.446 (95%CI: 0.350-0.542, P = 0.217), 0.323 (95% CI: 0.224-0.422, P = 0.000), 0.745 (95% CI: 0.671-0.819, P = 0.000), respectively. In the differential diagnostic test between myopathies and viral hepatitis, the sensitivity of CK and ratio of AST/ ALT was 0.880 and 0.512, the specificity of which was 0.961 and 0.882, the maximum Youden index of which was 0.841 and 0.394. Conclusions The serum muscle enzymes spectrum in different types of myopathies were different, but there existed some rules, which could provide clues for clinical classification of myopathies. The ratio of AST/ALT had suggestive values in the differential diagnoses between myopathies and viral hepatitis. For patients with increased transaminase of unknown reasons, serum CK should be detected. [ABSTRACT FROM AUTHOR]

Objective To report the clinical phenotype and genetic characteristics of an Alexander's disease type II patient with unusual presentation, so as to extend phenotype and gene mutation spectrum of Alexander's disease type II. Methods and Results A 41-year-old male patient suffered from paroxysmal right limb stiffness for 10 years, presenting with spastic hemiparesis on right side and bilateral pyramidal tract sign. Brain MRI showed long T2 signal in bilateral medulla, bulbar-pontine junction and the upper cervical spinal cord, as well as mild demyelination in bilateral periventricular white matter. Steroid pulse therapy was invalid. Antiepileptic drugs (AEDs) were partially effective. Genetic analysis showed one heterozygous deletion of glial fibrillary acidic protein (GFAP) gene [c.del 1044-1079 GTACCAGGACCTGCTCAATGTCAAGCTGGCCCTGGA (p.E348DdelY349-D360)] in the proband and his mother. This mutation has not been reported before. The patient was clearly diagnosed as Alexander's disease type II, and his family was diagnosed as Alexander's disease type II pedigree. Conclusions The novel mutation of GFAP gene expanded the gene mutation spectrum of Alexander's disease. The clinical phenotypes of family members may be variable even in the same family. [ABSTRACT FROM AUTHOR]

The change of urban landscape caused by human activities is one of the most important factors affecting terrestrial ecosystem. The distribution of urban landscape pattern has great impacts on the service function of regional biodiversity. To reveal the variation of landscape pattern and habitat quality in cities and its driving factors, we extracted landscape type information of Wuhan in 2005, 2010, 2015, and analyzed spatial-temporal evolution of landscape pattern using Markov transition model. The CA-Markov model was used to simulate the landscape pattern in 2020 under the natural growth scenario. The driving factor for landscape variation was analyzed using Logistic regression model. Combined with InVEST model, spatial pattern of habitat quality and its variation in three phases were calculated and evaluated. The simulated habitat quality in 2020 was obtained and its distribution characteristics were analyzed. The relationship between variation of landscape pattern and human activities was explored. The results showed that cultivated land and manufactured surface were the landscape types with highest variations between 2005 and 2015. The area of cultivated land continued to decline, with most of the area being transferred into manufactured surface. The area of manufactured surface continued to increase, most of which was transferred from paddy field and dry land. From 2005 to 2015, the habitat quality declined, with a large number of landscapes with high habitat quality level being changed to low habitat quality level. The overall index of habitat quality decreased and the biodiversity service function declined, indicating the degeneration of habitat quality. In 2015-2020, the evolutionary trend of landscape pattern and habitat quality would keep consistent with the past decade, with an increasing area of artificial surface, decreasing index of habitat quality, weakening biodiversity service function, and degenerating habitat quality. The most important factor accounted for the landscape pattern change in the study area was the changes in Gross Domestic Product (GPD) and regional fiscal revenue. Human socio-economic activities were the key driving force for the spatial variation of landscape and degeneration of habitat quality. Urbanization and land reclamation by filling lakes were the main reasons for landscape pattern variation in Wuhan. [ABSTRACT FROM AUTHOR]

Accurate evaluation of typical cropping patterns in faulted basins can provide scientific guidance for planting in the area. The planting modes of marigold, pomegranate, pomegranate+grass+sheep in Mengzi City of Yunnan Province were compared with the traditional corn planting mode. The ecological benefits and economy benefits of these rocky desertification control modes were analyzed by the method of emergy analysis. The environmental loading ratio (ELR) and emergy restoration ratio (ERR) were 13.80 and 0.41 in pomegranate planting mode, respectively, while 0.30 and -2.87 in marigold planting mode. The ecological benefits in pomegranate planting mode and marigold planting mode were lower than that of corn, and ELR and ERR were 1.30 and 4.64, respectively. However, the economic pure benefit per unit (EPBU) in pomegranate planting mode and marigold planting mode were 3.05 and 59.98 times of that in corn mode, respectively, indicating that pomegranate planting mode and marigold panting mode had higher economic benefits than that of corn. Pomegranate+pasture+sheep mode had the highest ecological and economic benefits among the four modes. The plus of forage+livestock subsystem to pomegranate planting mode had high eco-efficiency (ELR of 4.95, ERR of 0.63) and economic benefit (EPBU of 71.38 times than that of corn). Thus, we recommend that the local government should increase technical support for marigold planting mode and pomegranate+pasture+sheep mode, which including optimizing structures of fertilizer input, and crop cultivation and livestock breeding processes. Meanwhile, government could establish short-term labor markets for picking of fruits and flowers. [ABSTRACT FROM AUTHOR]

Objective To investigate the mitochondrial DNA (mtDNA) mutation load in hair follicles from different scalp regions of patients with mitochondrial, encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), compare the mutation load in different scalp regions, and analyze the difference in mutation load between scalp regions with lesion site in the brain and scalp regions without lesion site in the brain. Methods Seven MELAS patients with m.3243A > G mutations were studied. Hair follicles were obtained from 8 scalp regions (bilateral frontal, temporal, parietal and occipital lobes) of all patients and DNA was extracted. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to detect the m.3243A > G mutation. Results The mean value of m.3243A > G mutation load in hair follicles from all patients was (60.57 ± 7.71)%. In different scalp regions, the mean mutation load was (61.30 ± 7.32)% in left frontal, (65.41 ± 5.85)% in right frontal, (59.80 ± 5.58)% in left temporal, (57.59 ± 14.47)% in right temporal, (62.46 ± 5.02)% in left parietal, (60.11 ± 7.11)% in right parietal, (59.70 ± 8.68)% in left occipital and (59.42 ± 6.28)% in right occipital regions, respectively. There was no significant difference in the m.3243A > G mutation load among different scalp regions (F = 0.537, P = 0.802). There was no significant difference in the mutation load between scalp regions corresponding lesion site of the brain and scalp regions incorresponding lesion site of the brain [(60.33 ± 8.70)% vs. (61.02 ± 6.52)%; t = 0.319, P = 0.751)]. Conclusions Hair follicles are convenient and noninvasive sampled tissue for detecting mtDNA mutations. There is no difference in the mutation load among different scalp regions. Furthermore, there is no difference between scalp regions corresponding lesion site of the brain and scalp regions incorresponding lesion site of the brain. [ABSTRACT FROM AUTHOR]