Search

Effects of different nitrogen fertilizer application rates on fruit quality of pitaya under the condition of calcareous soil in karst area were discussed in order to investigate the effects of nitrogen fertilizer application level on fruit quality of pitaya under calcareous soil condition in karst area. The ‘Taiwan Dahong’ pitaya were used as the experiment material. Based on 0.216 kg of phosphorus (P) and 0.324 kg of potassium (K), four nitrogen (N) application levels (CK, T1, T2, T3) were setted. Twenty-one fruit quality indexes were determined, and the quality differences of pitaya with different N application levels (CK, T1, T2, T3) were compared. At the same time, eleven appearance quality indexes were comprehensively analyzed by principal component analysis. The results were as follows: (1) Compared with the control, N application could increase the contents of soluble sugar and soluble solids of fruit, reduce the contents of protein and dietary fiber, and the high nitrogen treatment (T3) was significantly different from other treatments. With the increase of N application, the contents of titratable acid and vitamin C of fruit increased firstly and then decreased, while the solid-acid ratio decreased firstly and then increased. T3 significantly increased the fruit vertical and horizontal diameters, fruit shape index and single fruit weight. (2) Compared with the control, N application treatment reduced the N content of pitaya fruit and increased the P content, and the N and P contents of each treatment were significantly different. The K content of fruit increased with the increase of N application. N application increased fruit boron (B) content and decreased fruit cuprum (Cu) content. The contents of manganese (Mn), ferrum (Fe), calcium (Ca) and magnesium (Mg) in different treatments were ranked as T3 > T1 > CK > T2. The content of zinc (Zn) decreased firstly and then increased with the increase of N application. (3) The principal component comprehensive evaluation score of the high N treatment was the highest, indicating that when selecting brown calcareous soil in Guilin karst area to grow pitaya, supplemented by a certain amount of P and K fertilizers, high N treatment was more conducive to improving the quality of pitaya. Therefore, in actual production, it is necessary to make appropriate adjustments according to the soil fertility status of the plantation.

At present, the demand for heavy-duty hydraulic automatic transmission in engineering machinery and other equipment is increasing. As one of the core components of such kind of transmission, the design of hydraulic torque converters requires better accuracy and efficiency. Due to the difference of scale and torque, the design method of common torque converters is no longer applicable. The torque converter parametric design process is separated from the 3D software model generation process currently, which prolongs the design cycle. Therefore, this study presents a parametric design method for torque converters of the heavy-duty hydraulic automatic transmission and develops the parametric design software. Firstly, the geometric model of torus is established by constructing the middle streamline by two elliptical arcs, the camber line is designed with the quartic B-spline curve, and a method of controlling the shape of the camber line through the two-level inlet and outlet angles and vertex coordinates is proposed. The connection is established between the blade camber line shape control method and the curve control points, and the constraint conditions of camber line control parameters are designed. The automatic design program of torque converters is developed based on the NX Open software, and the central scheduling data processing framework is established with parameter rationality checking as the constraints. The instance results show that the design method can make the torque converter get reasonable shape quickly.

Seriola aureovittata is a long-distance migratory oceanic species belonging to the Carangidae family; it is also known as yellowtail kingfish. It inhabits temperate and subtropical marine waters worldwide. We reached a significant breakthrough in S. aureovittata seedlings production in 2017, enabling current massively juvenile rearing in China, which became a promising candidate for the farming industry, especially for the rapidly growing open ocean aquaculture. However, sudden larvae death caused by environmental changes-related stresses during the early life stages of S. aureovittata leads to great losses. Thus, exploring the physiological mechanism of larvae responses to environmental stresses during seedlings' production under artificial breeding conditions is urgently needed. Heat shock proteins (HSPs) play an important function in the physiological regulation of stress and immune responses in vertebrates, including fish. HSP70 is a member of the HSPs family studied in dozens of fish species, with physiological roles in protein homeostasis, DNA protection, and stress tolerance enhancement, among others. To investigate the possible physiological effects of HSPs on early growth and development of S. aureovittata, we cloned and obtained the full-length cDNA sequence of the hsp70 gene. Furthermore, the structure and spatial and temporal expression patterns of hsp70 during embryonic development, larval and juvenile growth and development of S. aureovittata were determined. The results showed that the full-length cDNA sequence of the hsp70 gene contains 2 332 bp, wherein the 5'-UTR is 187 bp, the ORF is 1 920 bp, and the 3'-UTR is 225 bp in length. A 639 amino acids protein with a molecular weight of 70.1 kDa is encoded by hsp70. The hsp70 spatial expression exhibited a sex dimorphism pattern, with significantly high expression levels in the gill, heart, spleen, and ovary in females, whereas in males, the significantly high expression levels were found in the pituitary, gill, head kidney, and testis. Notably, the highest hsp70 expression levels were observed in the ovary of females and the testis of males. During the S. aureovittata embryonic development, the hsp70 mRNA was detected in fertilized eggs before cleavage, indicating that hsp70 is parentally inherited. Additionally, the hsp70 mRNA could be detected at all stages of embryonic development, wherein the lowest expression levels were observed before the low blastula stage, with a significant increase at the early gastrula stage maintained until the hatching stage. The high levels of hsp70 mRNA were detected in one-day-old larva, which decreased in four-day-old larva, followed by an increase in 15-day-old larva. Remarkably, the hsp70 mRNA level once again decreased in 20-day-old larva, maintaining an average level until 60-day-old juveniles. The results from the present study may provide insights into the origin and physiological function of hsp70 during the early life stages of S. aureovittata.

Objective To evaluate the application of nursing skills competition in teaching of Surgical Nursing. Methods Totally 183 nursing students were divided into the observation group (n=93)and control group (n=90) by lottery method. Conventional teaching method was adopted in the control group, and the nursing skills competition combined with practical teaching was used in teaching of Surgical Nursing in the observation group. The teaching effect, student’s independent learning ability, problem analyzing-solving ability were measured and compared between two groups. Results Students in the observation group achieved higher scores of theoretical test and practice skills assessment compared with those in the control group (P＜0. 01). Higher level of independent learning ability and problem analyzing-solving ability were evaluated in the observation group than those in the control group (P＜0. 01). Conclusion Nursing skills competition is an effective approach of improving the quality of clinical teaching and training. (目的 探讨护理竞赛在《外科护理学》教学中的应用效果。方法 选取某医学院2019级护理专业学生共183名作为研究对象, 采取抽签法分为观察组(n=93)和对照组(n=90)。对照组采用常规教学方法, 观察组在对照组基础上增加护理技能竞赛并结合实践教学分析。对两组学生的教学效果、考试成绩、技能掌握情况进行比较。结果 研究组学生理论考核和技能操作实践考核成绩优于对照组, 差异有统计学意义(P＜0. 01); 观察组学生自主学习能力、分析和解决问题能力评价高于对照组, 差异有统计学意义(P＜0. 01)。结论 在《外科护理学》课程教学中融入护理技能竞赛, 能有效提高教学水平, 提升临床护理人才培养质量, 对改善教学效果具有重要作用。)

Due to the high viscosity and bulk complexity of crude oil samples, it poses a grand challenge to determine hydrogen sulfide (H2S) in them. Although many methods have been developed for the analysis of H2S in complex systems, these methods generally have complex processes, large analysis error and low sensitivity. In the study, based on the reaction between triazine and H2S by generating thiadiazine, a small volume of complex crude oil sample was introduced directly into a triazine solution using acetonitrile as solvent for transferring H2S into detectable species by organic mass spectrometry. The experimental parameters of solution composition, acetic acid content, reaction time and reaction temperature were optimized, and the method of paper spray ionization-mass spectrometry (PSI-MS) was established for rapid analysis of H2S in complex crude oil samples. An optimal performance was achieved when the reaction of triazine and H2S was carried out at 30 ℃ for 2 h with acetonitrile containing 0.1% acetic acid as solvent. The standard curve for the quantitative analysis of H2S was constructed according to the linear relationship between MS signal intensity of resulting thiadiazine and the concentration of H2S, which was applied for actual crude oil samples from different sources. The results showed that the linear range and the limit of detection (LOD) were 0.1-1 000 μg/L and 0.041 μg/L with intra-day precision of 3.04% and inter-day precision of 3.18%, respectively. The PSI-MS was also employed to determine H2S in different actual crude oil samples, and the spiked recovery was 91.7%-103.5% with relative standard deviation (RSD) of 1.2%-4.5%. This method has the advantages of easy operation, low cost, high sensitivity and less contamination to mass spectrometer, which is promising for the direct and fast analysis of H2S in complex crude oil samples.

Objective To investigate the level of emotional exhaustion and its relationship with depression and posttraumatic stress disorder symptoms in intensive care unit (ICU) nurses and explore the moderating effects of mindfulness. Methods From March, 2016 to April 2017, we conducted a survey of the levels of emotional exhaustion, mindfulness, depression and posttraumatic stress disorder among 500 Chinese ICU nurses in 11 provinces and cities using the Dimension of Emotional Exhaustion in Maslach Burnout Inventory-Human Service Survey (MBI-HSS), Five Facet Mindfulness Questionnaire-Chinese Version (FFMQ-CH), Center for Epidemiological Studies Depression Scale (CES-D) and Posttraumatic Stress Disorder Checklist-Civilian Version (PCL-C). Results The mean score of emotional exhaustion was 20.82±9.79 among the ICU nurses participated in this survey. The level of emotional exhaustion differed significantly between male and female nurses (F=1.4, P < 0.05) and among those with different ICU working experiences (F=3.85, P < 0.05). Emotional exhaustion was negatively correlated with mindfulness (r=-0.80, P < 0.01) and positively correlated with depression (r=0.61, P < 0.01) and posttraumatic stress disorder (r=0.42, P < 0.01). Mindfulness moderated the relationship of emotional exhaustion with depression and posttraumatic stress disorder symptoms. Conclusion The level of emotional exhaustion is closely correlated with mindfulness, depression and posttraumatic stress disorder symptoms in ICU nurses. An increased mindfulness level can help the nurses reduce depression and posttraumatic stress disorder symptoms to promote their psychological wellbeing.

For linear time invariant high-order system calculation and analysis model is difficult to directly，so we need to study on reduction of the model According to the basic theory of model order reduction Lyapunov equation model order solution to linear time invariant system completely controllable Gramians matrix considerable considerable decomposition balance of the 丘ature space reduced-order Gramians Gramians by SVD m月tryX completely are ohtained for a linear system，the completely controllable and and matrix Cholesky decomposition， the Cholesky decomposition factor (singular value decomposition)method for Hankel singular value are gmen system which is transformation matrix. The reduced order system is given by based matrix obtained by the controllable and considerable Gramians matrix. The error and the factor to determine the of left and right bound for several models 月re computed by using the method of Hankel SVD. In order to obtain the several reduce-order models，using Mtalb to turn CDPlyer high-order model that stored in SLICOT test library to a low-order system. The results show that the above order reduction method is feasible.

Chlorogenic acid is a compound with a variety of biological activities, which can regulate the relevant signaling pathways of the body, reduce the inflammatory response, improve immunity, control oxidative stress response, inhibit the growth of pathogenic bacteria, improve intestinal microbial flora, and improve animal performance and health. In addition, chlorogenic acid has the advantages of a wide range of sources and high temperature resistance, which can be used in the feed production. This article mainly summarizes the extraction methods, functions, and roles of chlorogenic acid in animal production, to provide a reference for the rational and effective use of chlorogenic acid. [ABSTRACT FROM AUTHOR]

China has become the largest emerging single market in the global rail transit industry. Standards play a strategic, supporting and leading role in the development of the rail transit industry. This article statistically analyzes the details of 558 accumulated editing standards by 22 major standard-setting organizations in the world rail transit field published in 2020. Divided into five areas of basic commonality, engineering construction, operation service and development, equipment and technology, and freight transportation, the equipment and technical standards are statistically the most numerous. Based on international and foreign experience, it is recommended the Chinese rail transit industry standards should be strengthened from five aspects of timely development of new standards, emphasis on timeliness and international interoperability, internationalization of Chinese standards, coordination of railways and urban rail, and strengthening association standards, so as to achieve the goal of a leading transportation nation in the "14th Five-Year" Development Plan. [ABSTRACT FROM AUTHOR]

【Objective】 The purpose of this study was to evaluate the carrying capacity of water resources in the desert steppe irrigation area in Inner Mongolia, in attempts to help optimize water resource while in the meantime sustaining economic and social development in this region. 【Method】 We studied five typical areas including Yaoba Beach, Green Beach, Tonggu Nao'er Beach, Chahar Beach, Xinjing, all in Alxa Zuoqi. For each area, we considered its water resources, ecology and social economy, and established an evaluation index system. The entropy weight-TOPSIS model was used to comprehensively evaluate and calculate the carrying capacity of water resources in each area. 【Result】 In 2018, the water resources carrying capacity of Yaoba, Chahar, Tonggunaoer, Gelin and Xinjing was 0.682, 0.576, 0.213, 0.392, and 0.247, respectively, which was between Grade III and IV. Scenario prediction found that the evaluation index of water resources carrying capacity will peak in 2050 if more farmland is to return forest, combined with slowing down economic growth and reducing irrigated areas. 【Conclusion】 Our results show that the studied areas should consider sustainable development, promoting drip irrigation and other water-saving irrigation technologies, sparing farmlands for forests. Implementing strict water resource management and improving water resources carrying capacity are important to meet the demand for water in these areas.

[Objectives]The propulsion shafting system of large ships usually has the characteristics of long shafting, large span, and small slenderness ratio. Therefore,there is often elastic coupling effect between the bending deformation and longitudinal deformation,which is easy to cause abnormal vibration of the shafting,and affect the safe and stable operation of the shafting system. In order to study the nonlinear vibration characteristics of the shaft under bending-longitudinal coupling effect,[Methods]the nonlinear vibration equations of the propulsion shafting under bending-longitudinal coupling effect were derived by using the principle of variation,and then solved by numerical methods such as Finite Element Method(FEM)and shooting method and by approximate analysis method such as multi-scale method. Then the influence of bending-longitudinal coupling effect on the nonlinear vibration characteristics of shafting was analyzed and compared.[Results]The results show that the bending-longitudinal coupling effect causes complex vibration phenomena such as multi-frequency response,jumping phenomenon and energy transfer in the shafting response,and increases the natural frequencies in the bending and longitudinal direction of the shafting.[Conclusions]The study in this paper can provide reference for engineering design of large ship propulsion shafting.

Objective: To build the rat model of endometriosis by reflux method, observed the preventive effect of reversible oviduct synthetic on endometriosis in rats. Methods: The rats were divided into three groups randomly, experimental group (molding by reflux method and placement reversible oviduct synthetic), negative control group (molding by reflux method), blank control group(no processing). Then tested EmAb and CA125 in serum, and observed the tissue morphological variations in eight weeks after operation. Results: There were difference in EmAb and CA125 in serum between three group (P<0.05), and the negative control group was significantly higher than the experimental group and blank control group (P<0.05). There were also no obvious difference in histomorphology between the experimental group and the blank group. Neither of them developed endometriosis. In histomorphology observation, there is none in blank control group, 8 cases in negative control group, ectopic lesions volume (74.20±6.30)mm³, 1 case in experimental group, volume for the onset of ectopic lesions 1.50 mm³. Conclusions: The reversible oviduct synthetic could prevent endometriosis in rats. [ABSTRACT FROM AUTHOR]

This article describes the process of developing double-sided functional worsted fabric. This kind of worsted fabric has dual functions with waterproof front surface and hydrophilic back surface, making it comfortable to wear and easy to care. Three kinds of processing methods are tested; the first one is two-sided squeegee coating, the second one is hydrophilic finishing by padding, then waterproof squeegee coating on the front surface, the third one is hydrophilic finishing by padding, then waterproof finishing by foam coating on the front surface. The third method is the most suitable method after analyzing the advantages and disadvantages. The foam coating finish can prevent auxiliary penetrate, ensure the difference between both functions, decrease the ash content resulted from thickener, minimize the fabric feel from becoming worse and the declining of fabric: tear strength. [ABSTRACT FROM AUTHOR]

Objective To investigate the diagnostic value of β-catenin and retinol-binding protein in diabetic nephropathy. Methods 131 cases of diabetes were divided into DM group (group A), microalbuminuria group (group B), and proteinuria group (group C), with 54 cases, 42 cases, 35 cases respectively. Cys C, BUN, Cr, and β-catenin, urinary RBP, urinary protein of each group were detected. Results Serum levels of β-catenin, RBP and urinary protein of Group B were significantly higher than those of group A (P < 0.05), while those of group C were significantly different fromgroupsA and B (P < 0.05). Serum levels of Cys C of Group B and group A were significantly different (P < 0.05). Serum levels of Cys C, BUN and Cr of group C showed significant difference compared with group A(P < 0.05), and CysC of group C was significantly different from groups B (P < 0.05). Serum levels of β-catenin protein and urinary CysC showed significant positive correlation (P < 0.05), and RBP and urinary protein were significantly positively correlated (P < 0.05). Conclusion β-catenin and retinol-binding protein are important indicators to monitor the progression of diabetic nephropathy, its level detection can contribute to the early detection of kidney injury and diagnosis. [ABSTRACT FROM AUTHOR]

In order to solve the complicated system fault diagnosis problem, this paper adapted a new kind of particle filter with the relevant noise under unknown statistical properties. This method constructed the statistical model of the relevant noise, and gave the relevant noise statistical properties distribution function in detail. In the framework of the new method, this paper adopted the unknown noise statistics characteristic and the state of the system fault joint estimate recursively, and offered a new idea for the fault diagnosis problems of complex systems. Simulation results show that the method has higher precision and stability. [ABSTRACT FROM AUTHOR]

Six constituents were repeatedly isolated and purified from a soft coral Sinularia sp. by silica gel and Sephadex LH-20 chromatographies. On the basis of spectroscopic data of ID NMR, 2D NMR and EI-MS, their chemical structures were identified as lobocrassolide, lobohedleolide, (7Z)-lobohedleolide, 2-epi-llZ-lobohedleohde, 1, 2-benzenedicarboxylic acid diisobutyl ester, ergosta-5-en-3β-ol. The compounds of cembranoid diterpenes are gained from this organism for the first time. [ABSTRACT FROM AUTHOR]

To predict the buffeting internal forces of bridge components under complex incoming wind, the linear transformation relations between internal force of bridge components and their deformation were discussed in probability and statistics terms. The present paper deduced the multiple linear regressive model between the internal force and its deformation. Verification analysis is also performed to make sure that the regressive model is of great significance and can be applied in the engineering. Using the regressive model, the. internal forces induced by buffeting under complicated incoming wind are predicted. This methodology can directly transform the buffeting displacement of bridge under skew wind achieved from wind tunnel test into internal force of bridge components, without using the complex theory of buffeting analysis under skew wind. [ABSTRACT FROM AUTHOR]

With the arrival of a leisure age, leisure consumption is becoming a new engine of economic growth. It not only creates a substantial amount of job opportunities, which helps relieve employment pressure and maintains social stability, but also functions as a very effective approach to the regeneration of human resources and animation of human capital. The significance of leisure consumption makes it an urgent mission to strengthen the theoretical research in this area. It is against this background that the paper is written, an attempt of a systematic study on leisure consumption structure. Firstly, this paper, having empirically analyzed the low-level of leisure consumption structure in China, points out that the current structure of leisure consumption in China is dominantly characterized by low-standard prosperity in terms of consumption level. In terms of content, the leisure consumption in China has three preferences in consumers' choice: recreational and pleasure leisure over developmental and intellective leisure; conspicuous leisure over spontaneous leisure; and passive consumption over active consumption. Secondly, from the perspective of overall development of leisure economy and satisfying the diverse needs of leisure, the paper explores the need for improvement of leisure consumption. Once again, it analyzes the reality feasibility of improvement of leisure consumption in depth. The continuing decline of the Engel coefficient for leisure consumption provides the basis and space. The larger stock of financial assets and higher level of growth rate and sustaining income growth of urban and rural residents provide a strong basis for the improvement of leisure consumption structure. The formation of income gradient also provides conditions for the transformation of leisure consumption structure and formation of leisure consumption gradient. Finally, it raises countermeasures of optimizing leisure consumption structure in China. These countermeasures include: (1) High-quality leisure consumption subject is to be cultivated to promote leisure consumption knowledgeable and rich. On the one hand, the government should strengthen leisure education, raise consumer spending and leisure skills; on the other hand, it should use scientific values and consumption concept to guide leisure consumption activity, and use high-level spiritual culture to command people's leisure consumption behavior. (2) Spontaneous leisure consumption concept is to be fostered to promote healthy and civilized leisure consumption. The government could consider fostering spontaneous leisure consumption concept from two facets: cultivating and initiating a kind of giving-up ethics which has the sense of obligation, respect consciousnessand self-restraint idea as connotation, namely, limiting and giving up squandering material desire which surpasses boundary of essential leisure consumption; fostering the habit of seeking the reason for leisure consumption behavior in self rather than out of self. (3) Leisure industry is to be promoted wholly to improve leisure supply-demand relationship. The new consumers who are highly personalized, independent and well-informed are rising rapidly, exerting formidable innovation pressure on leisure industry in China. Therefore, to consummate standardized leisure facilities, create the system of diversified and network leisure places, open up the leisure content using modern science and technology, and endow the leisure product and service with some ultra-basic character like individuality and emotion is the key link to optimize the leisure consumption pattern and improve leisure supply-demand relationship. [ABSTRACT FROM AUTHOR]

Active components on promoting blood circulation and removing blood stasis were virtually screened by Discovery Studio with thrombin as receptor and the subjects were determined to be detected the effects on thrombin activities and anti-aggregation in vitro. Experimental data shows that the results of pharmacological effects correspond with that of the virtual screening. The subjects including loureirin A, loureirin B, loureirin C, 7-hydroxy-4'-methoxy flavane, and 4', 7-dihydroxy-homoisoflavane can inhibit the activities of thrombin in vitro effectively. It is hypothesized that they play a crucial role in promoting blood circulation and removing blood stasis. [ABSTRACT FROM AUTHOR]

This paper introduces the characteristics of Australian wool, polyester, T-400 elastic filaments and coolmax moisture absorbing and sweat discharging fibers. The successful development of multi-compostion moisture absorbing and sweat discharging fabrics greatly embodies advantages of various fibers, good elasticity, drape, moisture absorption, good washability and quick drying. During spinning processes, had compared the two T-400 elastic filaments' yarn spinning approaches with each other, we chose twister-assembled yarns which has little affects on fabric face. The fabric smoothness and flatness then is improved. Coolmax fibers and T-400 elastic filaments is sensitive to heat and easy to color change. The finishing process is optimized and typing and steaming processes are adjusted, finally we improved thehydrophilic additives to enhance the fabric moisture absorption performances row colldry capacity. [ABSTRACT FROM AUTHOR]

BACKGROUND At present, research on the extraction separation and enrichment of gallium is mostly biased to the strong acidic system, which brings a safety risk to the operation and needs acid-proof apparatus. Furthermore, the procedure is easily contaminated, resulting in high background values. OBJECTIVES To develop a method for extraction separation and preconcentration of trace Ga under weakly acidic condition. METHODS Solid phase extraction medium for Ga was prepared by using modified large porous adsorption resin with cetyl-trimethyl-ammonium bromide and loading it with 2-ethylhexyl phosphonic acid-2-ethylhexyleste. The separation and enrichment conditions of solid phase extraction were studied in detail. RESULTS Experiments showed that the separation and enrichment of trace gallium was ideal when the extraction conditions were mild. The maximum recovery (99%) of Ga was achieved in sample solution with pH of 2.5. The determination parameters of gallium were optimized for oxygen doped air-acetylene flame atomic absorption spectrometry (FAAS), and the sensitivity was improved on that of the current method. The detection limit of the overall method (3σ) was 2.6ng/mL by IUPAC definition and the relative standard deviation (RSD, n=7) was 2.87%. The recoveries for spiked solution ranged from 95.7% to 102.0%, and a theory enrichment factor of 40 was obtained. CONCLUSIONS This method has been successfully applied to the determination of trace gallium in tap water, Chinese medicine and hydroponic vegetable samples. It is simple, quick and reliable.

The zeta potential of the kaolinite particles at various NaCl concentrations were determined by using the ZetaProbe Analyzer, and the protonation/deprotonation of the kaolinite particle surfaces was analyzed based on Gouy- Chapman theory and the Nernst equation. The results show that the IEPs of the kaolinite particles at the various NaCl concentrations are different, with pH 3.3 and pH 3.0 at 0. 001 and 0. 010 mol/L NaCl, respectively. Once the NaCl concentration becomes higher than or equal to 0. 100 mol/L, the kaolinite particle surface is negatively charged, and no IEP appeared in the entire pH range. There are two common intersection points in the zeta potential curves, appearing at pH 4. 0 and pH 7.5. In a pH range of 4.0 to 7.5, the negative zeta potential increases as NaCl concentration also increases. The protonation of the HD-face is negatively affected at pHpH

This study aims to reveal the effect of acteoside on gouty arthritis(GA) in rats based on liver metabolomics. The ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry(UPLC-Q-TOF-MS) was employed to search for the potential biomarkers and metabolic pathways. SD rats were randomly assigned into blank, model, colchicine(0.3 mg·kg~(-1)), and high-, medium-, low-dose(200, 100, and 50 mg·kg~(-1), respectively) acteoside groups(n=7). The rats were administrated once a day for 7 continuous days. Monosodium urate(MSU) was used to induce GA model in rats during administration. The degree of joint swelling and pathological changes of synovial tissue in rats were observed, and the levels of interleukin(IL)-1β, IL-18 and tumor necrosis factor(TNF)-α in the synovial tissue of rats were measured. UPLC-Q-TOF-MS was employed to collect rat liver data, and Progenesis QI and EZ info were used for data analysis. Human Metabolomics Database(HMDB) and Kyoto Encyclopedia of Genes and Genomes(KEGG) were employed to predict the potential biomarkers and metabolic pathways. The results showed that acteoside alleviated joint swelling, reduced synovial tissue damage, and lowered the levels of inflammatory cytokines in GA rats. A total of 19 common biomarkers were identified, 17 of which can be regulated by acteoside. Seven metabolic pathways were enriched, such as glycerophospholipid metabolism, linoleic acid metabolism, and taurine and hypotaurine metabolism, among which glycerophospholipid metabolism was strongly disturbed. The metabolomics analysis suggested that acteoside may down-regulate the expression of inflammatory cytokines and alleviate the symptoms of GA rats by regulating glycerophospholipid metabolism, linoleic acid metabolism, and taurine and hypotaurine metabolism. The findings provide a reference for future research and development of acteoside.

In this study, we collected precipitation from February 2020 to February 2022 and the surface water and groundwater in the wet (August) and dry (October) periods of 2021 in the Shandian River Basin. Stable isotope technology was used to analyze the temporal and spatial changes in the hydrogen and oxygen stable isotopes of the "three waters" in the basin to explore the relationship between water isomorphs and environmental factors and to reveal the water conversion relationship using the end element mixing model. The results showed that the slope and intercept of the local precipitation line were smaller than the local atmospheric precipitation line. The water vapor mainly came from westerly water vapor, polar air mass, and East Asian monsoon circulation. The precipitation isotope had a significant temperature effect. In terms of time, the isotopes of surface water and groundwater were more enriched in the dry season than those in the wet season, and the d -excess values of surface water and groundwater were lower than the global average, indicating strong local evaporation. Spatially, the δ 18 O value of the rivers had the same change characteristics in the wet and dry seasons, showing gradual enrichment from the upstream to the downstream, and the groundwater δ 18 O high value area was unevenly distributed in space, with groundwater δ 18 O values becoming more depleted with the increase in burial depth. The highest slope of the groundwater water line was 7.87 in the wet season, which was very close to the slope of the local atmospheric precipitation line and river water line, indicating that there was a complex hydraulic connection between the "three waters" in the wet season. The surface water in the study area was mainly supplied by precipitation during the wet season and then by groundwater runoff. These results can provide a theoretical basis for revealing the hydrological cycle in arid and semi-arid areas.

Based on Janus kinase 1/2-signal transducer and activator of transcription 1(JAK1/2-STAT1) signaling pathway, this study explored the immune mechanism of Maxing Shigan Decoction in alleviating the lung tissue and colon tissue damage in mice infected with influenza virus. The influenza virus infection was induced in mice by nasal drip of influenza virus. The normal group, model group, oseltamivir group, antiviral granule group, and Maxing Shigan Decoction group were designed. After intragastric administration of corresponding drugs or normal saline for 3 or 7 days, the body mass was measured, and lung index, spleen index, and thymus index were calculated. Based on hematoxylin-eosin(HE) staining, the pathological changes of lung tissue and colon tissue were observed. Enzyme-linked immunosorbent assay(ELISA) was used to detect serum levels of inflammatory factors interleukin-8(IL-8) and interferon-γ(IFN-γ), Western blot and real-time quantitative polymerase chain reaction(RT-qPCR) to determine the protein and mRNA levels of JAK1, JAK2, STAT1, interferon regulatory factor 9(IRF9), and IFN-γ in lung tissue and colon tissue. The results showed that after 3 and 7 days of administration, the body mass, spleen index, and thymus index were lower(P&lt;0.05 or P&lt;0.01), and the lung index was higher(P&lt;0.01) in the model group than in the normal group. Moreover, the model group showed congestion, edema, and infiltration of a large number of lymphocytes and macrophages in the lung tissue, irregular structure of colon mucosa, ulceration and shedding of epithelial cells, and infiltration of a large number of inflammatory cells. The model group had higher levels of serum IFN-γ(P&lt;0.01), higher protein and mRNA expression of JAK1, JAK2, STAT1, IRF9, IFN-γ in lung tissue(P&lt;0.05 or P&lt;0.01), higher level of JAK2 protein in colon tissue(P&lt;0.01), and higher protein and mRNA levels of STAT1 and IRF9(P&lt;0.05 or P&lt;0.01) than the normal group. Compared with the model group, Maxing Shigan Decoction group had high body mass, spleen index, and thymus index(P&lt;0.05 or P&lt;0.01), low lung index(P&lt;0.05 or P&lt;0.01), and significant alleviation of pathological injury in lung and colon. Moreover, lower serum level of IFN-γ(P&lt;0.05 or P&lt;0.01), protein and mRNA levels of JAK1, JAK2, STAT1, IRF9, and IFN-γ in lung tissue(P&lt;0.05 or P&lt;0.01), JAK2 protein level in colon tissue(P&lt;0.01), and protein and mRNA levels of STAT1 and IRF9(P&lt;0.05 or P&lt;0.01) were observed in the Maxing Shigan Decoction group than in the model group. After 3 days of administration, the level of serum IL-8 in the model group was significantly higher than that in the normal group(P&lt;0.01), and the level in the Maxing Shigan Decoction group was significantly reduced(P&lt;0.01). In conclusion, Maxing Shigan Decoction can significantly up-regulate body mass, spleen index, and thymus index, down-regulate lung index, reduce the levels of IL-8 and IFN-γ, and down-regulate protein and mRNA levels of JAK1, JAK2, STAT1, IRF9, and IFN-γ in lung tissue and protein and mRNA levels of JAK2, STAT1, and IRF9 in colon tissue, and alleviate pathological damage of lung tissue and colon tissue. The mechanism is the likelihood that it inhibits the activation of JAK1/2-STAT1 signaling pathway to alleviate the damage to lung and colon tissue damage.

Objective: To explore the effectiveness on exogenous fever and the characteristics of effective population, as well as the specialties of prescription of acupoint application., Methods: Using the internet electronic diagnosis and treatment platform (Spring Broadcast Wanxiangyun Clinic Database, and the main TCM suitable technology promoted by this platform is acupoint application therapy), from August 24, 2020 to November 5, 2020, the patients complained with fever and diagnosed as common cold, with a record of initial visit and at least one return visit, were included as the subjects. According to whether acupoint application therapy was received or not, the subjects were divided into an exposure group (with acupoint application therapy, 26 664 cases) and a non-exposure group (without acupoint application therapy, 515 cases). Using the propensity score, the mixed factors, e.g. age and sex, were matched between the two groups. The disappearance rate of fever (within 2 days) and the time for the first fever disappearance were taken as the effect indexes. The association rules extraction was adopted to analyze the characteristics of effective population and acupoint application prescription in treatment of exogenous fever., Results: After propensity score matching, there were 1 229 cases in the application group and 423 cases in the non-application group. The disappearance rate of fever in the application group was 1.82 times as high as that in the non-application group ( P <0.05). The time for the first fever disappearance in the application group was shorter than the non-application group ( P <0.01). A total of 5 370 cases were effective with acupoint application therapy, of which, the median age was 2 years old and the proportion of children patients under 6 years old was relatively high. In the effective crowd, the most commonly-used acupoints were Shenque (CV 8), Dazhui (GV 14), Yongquan (KI 1) and Tiantu (CV 22), etc. Shenque (CV 8) and Dazhui (GV 14) were highly associated and the support was 62.57%. The most common herbal materials in the acupoint application therapy included Radix et Rhizoma Rhei , Natrii Sulfas , Radix Scutellariae , Herba Ephedrae and Radix Bupleuri , etc. Radix et Rhizoma Rhei and Natrii Sulfas were most commonly used at Shenque (CV 8) and the supports were 57.49% and 57.21% respectively. Herba Ephedrae was most commonly applied to Shenque (CV 8) and Dazhui (GV 14) and the supports were 48.21% and 43.91% respectively. Radix Bupleuri was the most common herb at Dazhui (GV 14) with the support of 46.61%. Besides, the most commonly combined western drugs included cefixime and keteling in the acupoint application therapy and the supports were 13.07% and 12.72% respectively., Conclusion: Acupoint application is effective on exogenous fever. The common therapy refers to Radix et Rhizoma Rhei and Natrii Sulfas plaster at Shenque (CV 8), while Herba Ephedrae and Radix Bupleuri at Dazhui (GV 14).

Objective: To observe the influence of acupoint application on the use of antibiotics in primary clinic practice, and explore the effect of acupoint application and its influence on the use of antibiotics based on common diseases in primary clinic (fever, cough, diarrhea, sore throat)., Methods: With the help of the internet electronic diagnosis and treatment platform (the main TCM suitable technology promoted by this platform is acupoint application therapy), the diagnosis and treatment data of 1.23 million patients in 2 000 primary clinics from August 24, 2020 to March 31, 2021 were collected. The patients were divided into an application group (acupoint application treatment) and a non-application group (non-acupoint application treatment), and the proportion of antibiotic use in the two groups was compared. The propensity score was used to match age, gender, concomitant symptoms, diagnosed diseases and other confounding factors of treatment, and the disappearance rate of symptoms (fever, cough, diarrhea, sore throat) and the time to first disappearance of symptoms were compared between the two groups., Results: A total of 1 230 923 patients were analyzed, including 1 048 382 cases in the application group, accounting for 85.2%; 182 541 cases in the non-application group, accounting for 14.8%. The most patients who used acupoint application treatment were 0-2 years old, followed by 3-6 years old, and the patients over 15 years old who did not use acupoint application treatment were the most. The proportion of antibiotic use in the application group was 2.4%, lower than that in the non-application group (44.2%, P <0.001). The proportion of antibiotic use in all ages of patients in the application group was lower than that in the non-application group ( P <0.001). Among the common diseases in primary clinic (fever, cough, diarrhea and sore throat), the proportion of antibiotic use in the application group was lower than that in the non-application group ( P <0.01); the disappearance rate of symptoms in the application group was higher than that in the non-application group, and the time to first disappearance of symptoms was shorter than that in the non-application group ( P <0.001)., Conclusion: Acupoint application has a certain influence on the use of antibiotics in primary clinic patients. In the treatment of common diseases, patients treated with acupoint application have better curative effect and lower proportion of antibiotic use.

We examined the characteristics of water use in typical tree species of arbor and shrub in Hunshandake Sandy Land, Populus cathayana and Salix gordejevii , in the different seasons, with the aim to provide theoretical basis for the structural optimization of the artificial shelterbelt. Samples of precipitation, soil water, groundwater and stem water of the two vegetation were collected, and their distribution characteristics of δD-δ 18 O were analyzed by hydrogen and oxygen stable isotope technology. The contribution rate of these potential water source to the arbor and shrub species were calculated using multi-source linear mixing model. The precipitation equation line in the study area was δ D =7.84δ 18 O +9.12, while soil moisture lines in the dry and wet season were δ D =3.56δ 18 O -41.28 and δ D =4.30δ 18 O -42.02, respectively. The δD-δ 18 O of soil water and stem water in the two seasons were lower than the precipitation δD-δ 18 O, indicating that both of them were strongly affected by the evaporation. Soil water contents in the shallow layer were strongly affected by rainfall and evaporation, with substantial fluctuation. With the increases of soil depth, soil water content tended to be stable, and the hydrogen and oxygen isotope in each soil layer showed significant differences. In the dry season, P. cathayana mainly utilized soil water in 0-40 cm and 120-200 cm layers, with contribution rates of 50.2% and 31.5%, respectively. S. gordejevii mainly absorbed soil water in 20-40 cm and 60-100 cm layers, and the contribution rates were 53.2% and 22.9%, respectively. In the wet season, the greatest contribution of soil water to P. cathayana was mainly in the 0-40 cm soil layer, accounting for 72.8%. S. gordejevii was mainly in the 0-20 cm soil water, evenly utilized the deeper soil water and groundwater. Due to the differences in root depth and distribution of the arbor and shrub, their water use strategies differed in different seasons, which was conducive to the stability of the shelterbelt community and tree species coexistence in Hunshandake Sandy Land. We proposed that the mixed planting species with different root depth should be considered in the future planting of artificial shelterbelt, which would help rationally utilize water resources and maintain the stability of sandy land ecosystem.

Objective: To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction., Methods: The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis., Results: The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic., Conclusion: The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.

Objective: To explore the genetic basis for three children patients with CHARGE syndrome., Methods: The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing., Results: All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021&#95;1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo., Conclusion: Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Objective: To study two novel CD36 gene mutations at the CD36 splicing sites found in Guangxi population, as well as the molecular basis and population incidence of them., Methods: DNA sequencing and cDNA clonal sequencing were used to detect CD36 exon sequence and the protein coding region sequence of CD36 mRNA for 2 CD36 deficient individuals (HHC and WGM) found in Guangxi population. Eukaryotic expression cell lines were established for the discovery of CD36 mRNA abnormal transcripts and Western blot assay was used to verify the effect of abnormal CD36 mRNA transcripts on CD36 expression. A DNA PCR-SSP genotyping method was established for the two CD36 novel mutations, and the population distribution was investigated among 110 CD36 deficient individuals in Guangxi region and 296 random individuals in Guangxi population., Results: Novel mutation of c.430 -1G>C was found at the CD36 splicing site in HHC and WGM individuals, and novel mutation of c.1006 +2T>G at the CD36 splicing site was also found in the WGM individual. CD36 cDNA clonal sequencing showed that CD36 c.430 -1G>C could lead to the production of the two CD36 mRNA transcript variants: c.429&#95;430ins［430-17&#95;430-2;C］(p.Ala144fsTer1) and c.430&#95;609del(p.Ala144&#95;Pro203del)(GenBank:HM 217023.1); and CD36 c.1006 +2T>G could lead to the production of CD36 mRNA transcript variant of c.819&#95;1006 del (p.Ser274GlufsTer16) (GenBank: HM217025.1). It was verified that all the three transcript variants could lead to CD36 deficiency by establishment of eukaryotic expression cell lines and Western blot assay. A study of the population incidence of two novel CD36 splicing site mutations found showed that in 110 CD36 deficient individuals and in 296 random individuals in Guangxi region, the mutation rate of CD36 c.430 -1G>C was 10.91% (12/110) and 1.35% (4/296), respectively, while CD36 c.1006 +2T>G was 2.73% (3/110) and 0 (0/296), respectively., Conclusion: This study identifies two novel CD36 mutations at CD36 splicing site, and preliminary clarified their molecular basis for the CD36 deficiency and the distribution characteristics in Guangxi population as well. It provides an experimental and theoretical basis for studying the molecular mechanism and characteristics of CD36 deficiency in Chinese population.

Objective: To verify the effect of the mutant gene vps4b on the expression of tooth development-related proteins, dentin sialophosphoprotein (DSPP) and collagenⅠ (COL-Ⅰ)., Methods: Paraffin tissue sections of the first molar tooth germ were obtained from the heads of fetal mice at the embryonic stages of 13.5, 14.5, and 16.5 days and from the mandibles of larvae aged 2.5 and 7 days after birth. The immunohistochemical method was used to detect the expression and location of DSPP and COL-Ⅰ in wild-type mouse and vps4b knockout mouse., Results: DSPP and COL-Ⅰ were not found in the bud and cap stages of wild-type mouse molar germ. In the bell stage, DSPP was positively expressed in the inner enamel epithelium and dental papilla, whereas COL-Ⅰ was strongly expressed in the dental papilla and dental follicle. During the secretory and mineralized periods, DSPP and COL-Ⅰ were intensely observed in ameloblasts, odontoblasts, and dental follicles, but COL-Ⅰ was also expressed in the dental papilla. After vps4b gene knockout, DSPP was not expressed in the dental papilla of the bell stage and in the dental papilla and dental follicle of the secretory phase. The expression position of COL-Ⅰ in the bell and mineralization phase was consistent with that in the wild-type mice. Moreover, the expression of COL-Ⅰ in the dental papilla changed in the secretory stage., Conclusions: Gene vps4b plays a significant role in the development of tooth germ. The expression of DSPP and COL-Ⅰ may be controlled by gene vps4b and regulates the development of tooth dentin and cementum together with vps4b.

The bitter taste is one of the important properties among five flavors of Chinese materia medica (CMM), characterized by downbearing and discharging, drying dampness, and consolidating Yin. In common CMM, bitter-taste CMM accounts for a large proportion, indicating the importance of it. Through the efficacy of clearing away heat and dampness, reducing fire and removing toxin, bitter-taste CMM has achieved good results in treating diabetes in clinical application, proving their definite therapeutic effect on regulating glucose and lipid metabolism (main features of diabetes). At present, there are many reports about the chemical constituents and pharmacological effects of CMM on diabetes, but there are few reviews on the chemistry and biology of bitter-taste CMM. This study summarized the properties and compatibility characteristics of bitter-taste CMM for treating diabetes, and mainly analyzed the chemistry and biology basis of bitter-taste CMM with function of regulating glycolipid metabolism, laying foundation for further researches on properties theory of CMM., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Chinese Pharmaceutical Association.)

A method for the simultaneous determination of the 11 strobilurin fungicides (coumoxystrobin, tricyclopyricarb, picoxystrobin, fluoxastrobin, trifloxystrobin, E -metominostrobin, kresoxim-methyl, dimoxystrobin, orysastrobin, pyraoxystrobin and fenaminstrobin) in different vegetation types of soil by QuEChERS-ultra performance liquid chromatography-tandem mass spectrometry was developed. The strobilurin fungicides were extracted with 0.1% (volume percentage) acetic acid-acetonitrile, and cleaned-up with 100 mg primary secondary amine (PSA) and 100 mg C 18 . The separation was performed on a C 18 column with methanol and water as the mobile phases. The strobilurin fungicides were determined in the positive ion mode and multiple reaction monitoring mode. The quantification was carried out by the matrix-matched external standard curve. The results showed good linear relationships for all analytes in the range of 0.1-100 μg/kg with the correlation coefficients of 0.9805-0.9999. The mean recoveries of strobilurin fungicides in the spiked soil samples were 65.1%-103.9% and the relative standard deviations were 0.082%-14% ( n =3) at three spiked levels (5, 10 and 50 μg/kg). The limits of quantitation were 0.005-2.0 μg/kg. This method is suitable for the trace determination of the 11 strobilurin fungicides in different vegetation types of soil (black soil, red soil, sandy soil, moisture soil, desert grey soil, and plateau soil).

The protein acetylation by histone acetyltransferases (HATs) and histone deacetylases (HDACs) plays a significant role in the development and maturation of the nervous system. HDAC6, belonging to class II HDACs, by regulating the survival, differentiation and maturation of neural cells, plays an important role in the development of the nervous system and participates in multiple pathological processes of cerebral ischemic injury. In addition, HDAC6 participates in the regulation of cognition and emotion of the brain. This article summarized the latest research results in recent years and expounded that HDAC6 inhibitors could produce a positive and effective neuroprotective effect on ischemic stroke by reducing the neuronal damage induced by excitotoxicity and oxidative stress, depressing the release of inflammatory mediators, inhibiting the apoptosis of neurons and promoting the growth of nerve and blood vessel.

Synergistic effect is main pharmacological mechanism of traditional Chinese medicine(TCM). The research method based on the key targets combination is an important method to explore the synergistic effect of TCM. Peptide transporter 1 (PepT1) is an essential target for drug uptake into the bloodstream, accounting for about 50% of the total transporter protein content from the small intestine. Peroxisome proliferator-activated receptor α(PPARα) is the lipid-lowering target of fibrates, which have a good hypolipidemic effect by activating PPARα. It has been reported that PPARα could activate the gene expression of PepT1s, and PPARα agonists can promote the uptake of PepT1 substrates, indicating their synergistic effect. In this paper, PepT1 substrates and PPARα agonists from TCM were discovered, and their synergistic mechanism was also been discussed based on the target combination of PepT1 and PPARα. The support vector machine(SVM) model of PepT1 substrates was first constructed and utilized to predict potential TCM components. Meanwhile, merged pharmacophore and docking model of PPARα agonists was used to screen the potential active ingredients from TCM. According to the analysis results of two groups, the TCM combination of Panax notoginseng and Ganoderma lucidum, as well as TCM combination of P. notoginseng and Salvia miltiorrhiza were identified to have the synergistic mechanism based on target combination of PepT1 and PPARα. In this study, synergistic mechanism of TCM was analyzed for absorption and hypolipidemic effect based on target combination, which provides a new way to explore the synergetic mechanism of TCM related to pharmacokinetics., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Chinese Pharmaceutical Association.)

To explore the prevention and protection effect of Diosocorea nipponica (DNM)) on acute gouty arthritis (AGA) rats based on liver metabonomics, and find potential biomarkers and related pathways. AGA model rats were induced by monosodium urate crystal suspension. UPLC-TOF-MS coupled with pattern recognition technique was employed to find out the potential biomarkers and related metabolic pathways. Eleven common potential biomarkers were identified. Among the potential intervention targets in normal rats given by DNM, 4 biomarkers were up-regulated, and the other 4 targets were down regulated. Among the potential intervention targets in AGA rats given by DNM, 5 metabolites were up-regulated by MSU and 5 metabolites were down regulated. The abnormal expression levels of adenosine monophosphate, 5-methyltetrahydrofolic acid, oxidized glutathione, hypoxanthine, docosahexaenoic acid, glutathione, uridine diphosphate glucose and inosine could be corrected by DNM extract. Three pathways were founded with greatest correlation, including purine metabolism, starch and sucrose metabolism and glutathione metabolism. Therefore, it could be inferred that D. nipponica has the effect for anti-acute gouty arthritis by intervening endogenous metabolites from the liver under physiological condition and acute gouty arthritis condition., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Chinese Pharmaceutical Association.)

Oligopeptides are one of the the key pharmaceutical effective constituents of traditional Chinese medicine(TCM). Systematic study on composition and efficacy of TCM oligopeptides is essential for the analysis of material basis and mechanism of TCM. In this study, the potential anti-hypertensive oligopeptides from Glycine max and their endothelin receptor A (ETA) antagonistic activity were discovered and predicted based on in silico technologies.Main protein sequences of G. max were collected and oligopeptides were obtained using in silico gastrointestinal tract proteolysis. Then, the pharmacophore of ETA antagonistic peptides was constructed and included one hydrophobic feature, one ionizable negative feature, one ring aromatic feature and five excluded volumes. Meanwhile, three-dimensional structure of ETA was developed by homology modeling methods for further docking studies. According to docking analysis and consensus score, the key amino acid of GLN165 was identified for ETA antagonistic activity. And 27 oligopeptides from G. max were predicted as the potential ETA antagonists by pharmacophore and docking studies.In silico proteolysis could be used to analyze the protein sequences from TCM. According to combination of in silico proteolysis and molecular simulation, the biological activities of oligopeptides could be predicted rapidly based on the known TCM protein sequence. It might provide the methodology basis for rapidly and efficiently implementing the mechanism analysis of TCM oligopeptides., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Chinese Pharmaceutical Association.)

Along with the increase of clinical application, the safety of traditional Chinese medicine gained more and more attentions. In particular, the safety evaluation of Chinese medical injections has become a mandatory task should be completed by pharmaceutical companies under the supervision of China Food and Drug Administration(CFDA). Due to the weak foundation of previous studies, the safety issues of Chinese medical injections have not been fully understood, and lack of scientific and rational risk management programs. Clinical safety centralized monitoring(CSCM) is an important method for post-market safety evaluation of Chinese medicine. Due to the lack of appropriate norms and procedures, the quality of similar research is uneven, and the results vary. Combined with practical experience with experts' suggestions, we developed this expert consensus on the design and implementation of CSCM from three stages (design, implementation and report) with 20 technical points, which will provide technical support for future CSCM studies., Competing Interests: The authors of this article and the planning committee members and staff have no relevant financial relationships with commercial interests to disclose., (Copyright© by the Chinese Pharmaceutical Association.)

Objective: Behcet's disease is a condition characterized by systemic vasculitis liable to thrombosis, and may involve the parenchyma and blood vessels in the brain. We report a case of Behcet's disease that progressed into central neural system involvement rapidly due to failure of tertiary prevention. This case demonstrates the importance of management of the high risk factors of thrombosis and timely prevention of disease progression.