Search

Examination of the role of Escherichia coli dnaG function in different stages of M13 phage DNA synthesis by ultracentrifugal analysis of intracellular phage DNA in a thermosensitive dnaG mutant shows that: (a) the formation of parental double-strand replicative-form DNA (rfDNA) from the infecting virus is independent of dnaG function (b) the synthesis of progeny rfDNA requires dnaG product; (c) after a pool of rfDNA is made up, dnaG function is not required for the progeny single- strand DNA (ssDNA) synthesis. The ssDNAs produced under nonpermissive condition are mostly circular and biologically functional. [ABSTRACT FROM AUTHOR]

The lipopolysaccharides of ampicillin-resistant cell-wall-defective mutants of Escherichia coil K-12 were analyzed. From their lipopolysaccharides the respective core oligosaccharides were obtained. Following dephosphorylation, the core oligosaccharides were methylated and analyzed by gas chromatography/mass spectrometry. From core-defective mutants substructures of the K-12 core were obtained. Analysis of the lipopolysaccharide preparations from wild-type K-12 indicated the presence of several core structures with different degrees of completion. The lipopolysaccharide preparation was degraded and the oligosaccharide mixture was partially resolved by gel filtration chromatography. Methylation, gas chromatography and mass spectrometry of the oligosaccharides permitted the tentative formulation of the K-12 core structure. Alternative interpretations for this heterogeneity are discussed. [ABSTRACT FROM AUTHOR]

Cell-free extracts from Escherichia coli strain number 9, lacking among other enzymes glycerol kinase, are able to incorporate [2-3H]glycerol into phospholipids.The characteristics of this incorporation indicate that it is not taking place through the regular glycerol phosphate pathway of phospholipid synthesis which occurs when this compound is used as a precursor or even when extracts of E. coli strain 7, having a functional glycerol kinase, are incubated with [2-3H]glyceroI. In E. coli strain 9 extracts glycerol is exclusively incorporated into the distal position of phosphatidylglycerol while in the other strains the middle position glycerol is partially labelled. [ABSTRACT FROM AUTHOR]

Incubation of CMP in 2H2O with 0.5 M cysteine methyl ester at p2H 5 and 37°C for 24 h resulted in 43% exchange of 5-H to 5-2H. No deamination of the cytosine nucleus was noted during this treatment. Native and denatured DNA samples from calf thymus were treated in 3H2O with cysteine methyl ester at pH 5 and 37°C for 24 h and incorporation of tritium into each DNA base was determined by enzymic digestion of the treated DNA. The order of the specific radioactivity found was cytosine » guanine > adenine » thymine for denatured DNA and guanine > adenine ≈ cytosine > thymine for native DNA. The ratio of radioactivity for denaturedtnative was 11.6 for cytosine, 1.5 for guanine, 1.8 for adenine and 1.1 for thymine. Hence the incorporation in cytosine under the reaction conditions is preferential for single-stranded, nonhelical regions of DNA. Escherichia coli glutamic acid tRNA II was treated in 3H2O with 1.24 M cysteine methyl ester at pH 5 and 37°C. The 24-h-treated tRNA was digested with ribonuclease T1 and the fragments were fractionated. Each fragment was then digested with ribonuclease T2 into mononucleotides and the radioactivity distribution among the bases was determined. The average radioactivity found for each of the bases of the four major nucleotides was cytosine » guanine ≈ adenine > uracil. The radioactivity in cytosine varied greatly among the RNase T1 fragments, the ratio of the highest to the lowest radioactivity being 18.7. The corresponding value for guanine was 11.1, for adenine 4.73 and for uracil 3.64. Based on the data obtained, it was deduced that in this tRNA the anticodon loop, the dihydrouridine loop and the extra loop were ‘exposed’ under the conditions employed for the labeling, The 5′-terminal cytosine of the anticodon loop was in a ‘non-exposed’ state, a situation similar to that previously reported for E. coli tyrosine tRNA [Cashmore, A. R., Brown, D. M. & Smith, J. D. (1971) J. Mol. Biol. 59, 359–373] and for E. coli- formylmethionine tRNA [Goddard, J. P. & Schulman, L. H. (1972) J. Biol. Chem. 247, 3864–3867]. Both cytosine 48, located at the 3′-terminal of the extra loop, and guanine 15 in the dihydrouridine loop were in an ‘exposed’ state. This finding does not agree with a tRNA model in which this pair of cytosine and guanine, commonly found in tRNA sequences, forms hydrogen bondings. Positions 30–32, 61–64 and 71, which are located in the stems, were found to be strongly ‘buried’. [ABSTRACT FROM AUTHOR]

The of antigen of Escherichia coli O9 consists of a mannan, bound to the core oligosaccharide and lipid A. The mannan contains α-1,2- and α-1,3-linked mannose in an unknown sequence. The serological specificity of the O9-antigen is not expressed through the mannan but through an immunodominant group in which isopropylidene ribose seems to play a role. From a non-capsulated (K-) form or E. coli O9:K29(A):H- a mutant lacking phosphomannose isomerase (pmi-) was selected. Membrane preparations were obtained from this mutant using plasmolysis, spheroplasting and sonic rupture of the spheroplasts. Cytoplasmic and outer membranes were separated by sucrose gradient centrifugation. Incorporation in vivo of [14C]mannose into late log phase bacteria resulted in the formation of complete lipopolysaccharide (O9 antigen) which accumulated to a large extent on the cytoplasmic membrane before being exported to the outer membrane. The product was extracted with 45% aqueous phenol and characterized by chemical analysis, dodecylsulfate polyacrylamide gel electrophoresis, gel permeation chromatography and antigen binding using anti-O9 antiserum. Incorporation in vitro from GDP-[14C]mannose into membrane mixtures or isolated cytoplasmic membrane resulted in the formation of the mannan part of the lipopolysaccharide which was not substituted by the determinant group and was not transferred to the core-lipid A part. The product, isolated with 45% aqueous phenol, was characterized as was the product in vivo. Furthermore, it was subjected to methylation analysis with the same results as obtained with authentic O9 (lipo)polysaccharide. By monitoring the formation of radioactive polymer the over-all reaction was found to have an apparent Km = 5 × 10-5 moles per 1, based on GDP-mannose. It was found that the preferred activated form of mannose in the O9 antigen synthesis is GDP-mannose, other purine or pyrimidine bases being much less effective; it was also found that the reaction is not dependent on bivalent cations such as Mg2+ or Mn2+, these ions even inhibiting the reaction partially at concentrations above 5 mM; it was further found that bacitracin as well as EDTA are not inhibitory. All attempts to extract an intermediate into organic solvents were unsuccessful. Oligosaccharides could not be isolated at any stage of the synthesis, starting 5 s after the addition of GDP-[14C]mannose. In pulse-chase experiments in vitro it was found that an intermediate was formed which can be detected by dodecylsulfate polyacrylamide gel electrophoresis. With increasing incubation time this material shows decreasing charge to mass ratios. Treatment of the incubation mixture with mild acid or mild alkali prior to dodecylsulfate polyacrylamide gel electrophoresis showed that the radioactive material (mannan) was bound to a cartier through an alkali-stable but acid-labile linkage. The nature of the carrier is discussed. From the results it is concluded that the O9 mannan is synthesized in a single chain mechanism which does not utilize lipid-bound oligosaccharides. [ABSTRACT FROM AUTHOR]

The cyanogens bromide fragments of protein I, a major protein of the Escherichia coli outer cell envelope membrane, have been isolated and characterized. There appear to be two methionineserine or methionine-threonine sequences causing incomplete cleavage but complete conversion of methionine to homoserine. Largerly due to the existence of these overlapping fragments the order of 5 of the 6 fragments present could be deduced. None of the fragments exhibits any remarkable low degree of polarity, and the tryptic fingerprint of the largest fragment (comprising about 60%,of protein I) also does not show any conspicuous large fraction of lipophilic peptides. It is concluded that the domain of protein I that may be buried in the lipid phase of the outer membrane in all likelihood is not very large, and there is, in fact, no definite proof yet that protein I is a membrane protein sensu stricto. [ABSTRACT FROM AUTHOR]

After digestion of protein S4 with trypsin, all 32 tryptic peptides were isolated. Their amino acid compositions were analyzed and the sequence of the amino acids within the tryptic peptides was determined by means of a solid-phase peptide sequenator and by exopeptidases. Alignment of the tryptic peptides was established by analyzing and partially sequencing peptides isolated after digestion of the $4 protein with chymotrypsin, thermolysin and a glutamic-acid-specific protease. Further information about the alignment of peptides came from treatment of S4 with CNBr and with a lysine-modifying reagent. Protein S4 consists of 203 amino acids (Asp8, Asn8, Thr6, Ser10, Glu16, Gln10, Pros, Gly15, Ala18, Va116, Cys1, Met3, Ile8, Leu20, Tyr8, Phe4, His3, Lys20, Arg22 and Trp1) and has a molecular weight of 22550. The basic amino acids are clustered in five regions. Many short repetitions mainly with charged amino acids occur. A prediction is made for regions with or α-helices and with β-sheets. [ABSTRACT FROM AUTHOR]

The lipopolysaccharide of Escherichia coli BB and a number of R-phage selected (e.g. T3, T4) cell-wall-defective mutants were analyzed. From their lipopolysaccharides the respective core oligosaccharides were obtained. Following dephosphorylation, the oligosaccharides were methylated and analyzed by gas chromatography/mass spectrometry. This revealed the sugar sequence in the hexose-heptose region of the core. The linkage of heptose (Hep) to 2-keto-3-deoxyoctonate (KDO) was established as ... Hep [This symbol cannot be presented in ASCII format] KDO... by methylation analysis. The substituted derivative of KDO was identified by gas chromatography and mass spectrometry. The KDO region contains three KDO units, Its structure was elaborated by (a) selective removal and identification of 7-phosphoryl ethanolamine-KDO (KDO-PN), (b) periodate oxidation and thiobarbiturie acid reaction in conjunction with mild hydrolysis, (c) a modified methylation analysis. Phosphate substitution of the E. coli BB core was studied by β-elimination and using the information obtained with KDO-PN. The structures of the cell wall lipopolysaccharides from E. coli BB and cell-walt-defective mutants are given. [ABSTRACT FROM AUTHOR]

Two physically and genetically distinct forms of ribosephosphate isomerase have been identified in Escherichia coli K12. The constitutive ribosephosphate isomerase A has a Km for ribose 5-phosphate (4.4 ± 0.5 mM) six times greater than that of the inducible ribosephosphate isomerase B (0.83 ± 0.13 mM). Treatment of the enzymes with 1.25 mM iodoacetate resulted in 100% loss of activity for ribosephosphate isomerase B, whereas ribosephosphate isomerase A was unaffected. Various cellular metabolites were tested and found to be without significant effect on either enzyme. The two enzymes could be separated by filtration on Sephadex G75 superfine and their apparent molecular weights were 45000 for ribosephosphate isomerase A and 32000–34000 for ribosephosphate isomerase B. Under certain conditions the two enzymes showed different patterns of heat inactivation but the results with ribosephosphate isomerase A varied in an unusual way with the protein concentration. Ribosephosphate isomerase B was formed inducibly in a mutant lacking ribosephosphate isomerase A but there was no evidence for the production of ribosephosphate isomerase B in wild-type cells. The formation of ribosephosphate isomerase B was not a consequence of the ribosephosphate isomerase A mutation, since strains could be constructed which formed both enzymes constitutively in the anticipated amounts. The ribosephosphate isomerase formed by a secondary mutant obtained from a ribosephosphate-isomerase-A-negative strain was identified as ribosephosphate isomerase B on the basis of its Km, elution profile from Sephadex G75, inhibition by iodoacetate, and heat inactivation. The ribosephosphate isomerases of another Escherichia coli K12 strain, X289, were investigated, since their properties were reported to be different from many of these described here for ribosephosphate isomerases A and B. In our hands strain X289 contained two ribosephosphate isomerases apparently identical to ribosephosphate isomerases A and B. The evidence to date suggests that ribosephosphate isomerase A catalyses the formation of ribose 5-phosphate from ribulose 5-phosphate and also participates in the reverse reaction during ribose and adenosine catabolism. The normal physiological role of the inducible ribosephosphate isomerase B is still uncertain. [ABSTRACT FROM AUTHOR]

Highly purified RNA polymerase from Escherichia coli terminates RNA synthesis in vitro at defined sites on the DNA of coliphage TT. One such site maps at the end of the major ‘early’ transcription region of the genome. A second, distal site is most readily studied in certain mutant strains from which the first site has been deleted. At both sites, termination in vitro is simple (independent of rho or other factors) and both appear to be functional in vivo: We have applied to these sites a technique designed to study base sequences at and beyond RNA termini. The RNA terminated at the first site has cytosine at its 3′ end, and the first base coded by the DNA template beyond the RNA terminus is guanine. The specificity of this sequence is at least 92%. At the second terminator, which is found to be less efficient in its action, the corresponding bases are cytosine and adenine. [ABSTRACT FROM AUTHOR]

Both rRNA and protein components of Escherichia coli ribosomes have been specifically labelled without any important loss of activity for polyphenylalanine synthesis in the cell-free system. Three adenylic residues per 70-S ribosome were labelled by an anthracenyl derivative and the ribosomal proteins by dansylation of four amino acid residues per 70-S particle. The association between the two complementary subparticles, the formation of the binary and ternary complexes in the presence of mRNA and tRNA were investigated using the concomitant measuring of fluoroscence intensity and polarisation of the two kinds of labels. The formation of these complexes involves the rRNA and the ribosomal protein components of the 30-S and 50-S subparticles directly and/or indirectly. The mobility of the messenger bound to the 70-S ribosome in the presence of tRNA is indicated by use of a polyadenylic acid labelled with the same marker ss that for rRNA. Reversible conformational changes are observed during acidic-alkaline titrations and melting curves of fluorescent ribosomal particles. The irreversible denaturation occurs at the same pH and melting temperature for the rRNA and the ribosomal components: The results are interpreted in terms of highly specific interactions between the rRNA and the proteins, slight modification in the strength and/or nature of these interactions leading to a conformational change of the whole ribosomal particle. [ABSTRACT FROM AUTHOR]

An RNA ligase which is dependent on ATP and Mg2+ for maximal activity with 5'-32P-labeled poly(I) · poly(C) as substrate has been purified from Escherichia coli infected with phage T4. Ligase activity was demonstrated by the transfer of alkaline phosphatase sensitive 5'-32P termini into an alkaline phosphatase resistant form. The formation of phosphodiester bond was verified by hydrolysis of the reaction product and determining the transfer of 32p from the 5' position to the 2'(3') position by electrophoresis. An increase in sedimentation rate of poly(I) · poly(C) was also observed after reaction with RNA ligase. The enzyme also showed an ATP-PP1 exchange activity. The activity on the synthetic polyribonueleotides poly(A), poly(U), poly(A) · poly(U) and poly(I) · poly(C) was examined and an increased efficiency of the substrate was obtained when [5'-32P]poly(U) formed a complex with poly(A). [5'-32P]Poly(A) was a good substrate both with and without the complementary strand. With 5'-32P-labeled poly(I) · poly(C) as substrate RNA-ligase activity was detected in mammalian cells such as KB, HeLa and L-cells. The activity seems to increase after infection with encephalomyelocarditis (EMC) virus or poliovirus, but not aider infection with adenovirus type 2. The RNA ligase activity was confined to the cytoplasmic fraction of the cells. [ABSTRACT FROM AUTHOR]

Discusses results of a study investigating the enzymes involved in wall peptide crosslinking in Escherichia coli K12 strain 44. Transpeptidase; DD-carboxypeptidase; Endopeptidase; Hydrolytic activity; Transfer reaction; Formation of hybrid monoamidated peptide.

Properties of murein hydrolases, assumed to play an essential role in bacterial morphogenesis, are described. Evidence is presented that in the intact cell these enzymes are prevented from uncontrolled reaction. It is shown that the ‘barrier’ between the enzymes and their substrate sacculus, a shape-maintaining macromolecule within the cell envelope, can be artificially broken. Assay systems to measure murein hydrolase activity in the intact cell, in isolated cell envelopes and after solubilization are described. A combination of Triton X.100 and sodium chloride is shown to liberate membrane-bound hydrolases effectively. [ABSTRACT FROM AUTHOR]

Following the finding that the ATP-PPi exchange reaction and the aminoacylation of tRNA catalysed by methionyl-tRNA synthetase from Escherichia coli are inhibited by adenosine, numerous analogues of adenosine have been examined to determine the nature of the specificity. The main features observed are as follows. 1. Modifications to positions 1, 2 and 6 of the purine ring of adenosine largely eliminate the inhibition of the ATP-pyrophosphate exchange reaction. 2. The replacement of the nitrogen at position 7 with a carbon has virtually no effect. 3. Substitutions at positions 8 give analogues exhibiting a wide range of inhibition constants ; 8-aminoadenosine is a highly effective inhibitor, with a Ki300 times lower than that of adenosine. 4. The sugar part of the nucleoside is essential for binding, but can be considerably modified without too great a detrimental effect, particularly in the 5′-position. 5. For the nucleosides which have a low inhibition constant the presence of a triphosphate group lowers the affinity, but for the analogues exhibiting a high inhibition constant a triphosphate group has no effect. [ABSTRACT FROM AUTHOR]

We have studied the ribonucleosidediphosphate reductase of a deoxyuridine-requiring mutant LD195 of Escherichia coli K. This enzyme was purified 50 fold from the mutant and a control strain. In all steps of the purification the mutant strain yielded normal activity of the Bi subunit of the enzyme but approximately 10 % of the wild-type activity of the B2 subunit The activity is similarly reduced for all three substrates tested CDP, UDP, and GDP. The mutation appears to affect the physical structure of the B2 subunit, since addition of high concentrations of sodium acetate can restore enzymatic activity to the partially purified B2 subunit from the mutant strain. In contrast, the same concentrations strongly inhibit the wild- type B2 subunit. Although the mutant has a requirement of deoxyuridine at 42 °C but not at 30 °C (as shown in an accompanying paper), mutant protein B2 is not more thermo-labile than wild-type protein B2 This requirement therefore probably reflects an increased demand of deoxyribonucleotides at higher temperatures. Hydroxyurea inhibits mutant and wild-type ribonucleosidediphosphate reductase to the same extent in vitro. In spite of this, hydroxyurea inhibits growth of the mutant strain at a 20 fold lower concentration than that required for comparable inhibition of growth of the parent. This is explained by the greatly decreased protein B2 activity of the mutant. [ABSTRACT FROM AUTHOR]

A procedure to isolate Escherichia coli mutants defective in ribonucleotide reduction is described. Using a parental strain defective in dCTP deaminase (paxA) and thus unable to synthesize dUMP from deoxycytidine nucleotides, we selected for cells unable to reduce UDP at a rate sufficient to satisfy the cell's need for thymidine nucleotides. This was accomplished by selecting for cells resistant to 2,4-diamino-5-(3,4,5-trimethoxybenzyl)pyrimidine (trimethoprim) in the presence of thymidine and screening these cells for a thymidine requirement that could be satisfied by deoxyuridine. Genetic analysis as well as enzyme assays of four such mutants chosen for study indicated that three had a defective thymidylate synthetase. One, LD195, which had normal thymidylate synthetase activity, was found to have a conditional deoxyuridine requirement that is only expressed under favourable growth conditions. Since restoration of a functional dCTP deaminase to derivatives of LD195 eliminated the deoxyuridine requirement, it was concluded that a combination of two mutations is responsible for the expression of this phenotype. Analysis of nucleotide pools of LD195 grown exponentially under permissive conditions revealed that both the dTMP and dTTP pools were 6-fold lower than in the parent indicating a deficiency in the production of a thymidine nucleotide precursor. Enzyme assays of crude extracts of LD195 indicated that this deficiency was due to a defective ribonucleosidediphosphate reductase. This conclusion is proven by an extensive enzymatic analysis presented in an accompanying paper. [ABSTRACT FROM AUTHOR]

Initiation of protein synthesis in Escherichia coli is a catalytic process, provided that conditions for hydrolysis of GTP are present. This means that the initiation factors IF-1, IF-2 and IF-3 are released at a certain stage of initiation complex formation, whereafter they recycle and are reutilized in another round of initiation. Experiments presented in this paper provide evidence for the mechanism of recycling, in which the hydrolysis of GTP and IF-1 both play a predominant role. We demonstrate that binding of fMet-tRNA, which is dependent on IF-2, is a stoichiometric process in a system devoid of IF-1. Addition of IF-1 converts it into a catalytic process, however, only if GTP can be hydrolysed. No such conversion takes place with 5′-guanylylmethylenediphosphonate. The same observation is valid for the uncoupled IF-2 dependent GTPase activity. In the process of initiation IF-1 acts as a recycling promoting factor, which displays analogous properties to elongation factor EF-Ts. We postulate that a ribosomal-bound IF-2 · GDP complex is converted into an IF-2 · GTP complex, which is released and is capable of starting a new cycle of initiation. Furthermore, kinetic evidence is presented that IF-3 recycles even at the level of 30-S initiation complex formation, irrespective of whether conditions for hydrolysis of GTP are provided. [ABSTRACT FROM AUTHOR]

It is known from previous work that the regulation of Glutaminesynthetase in coli is effected by two mechanisms. First, the synthesis of GS is repressed by NH4+; and secondly, the activity of GS is regulated by inactivation and reactivation of the enzyme molecule. In the present paper we demonstrate and characterize the reactivation of inactivated GS in intact cells of E. coli. GS is inactivated after addition of NH4+ to the culture medium. Experiments with a cell flee extract from E. coli have shown, that the inactivation is mediated by a specific "inactivating enzyme", ATP, Mg2+, and Glutamine which is probably formed from the added NH4+, The reactivation is observed, when the inactivated ceils are centrifuged from the NH4+ containing medium and then resuspended in an NH4+ free medium. In about 5–7 minutes the activity increases 5–30-fold. Inhibitors of protein synthesis such as chloramphenicol and p-fluoro-phenylalanine do not affect the reactivation process. Only a slight retardation of the reactivation is observed. A carbon source is required for reactivation. When inactivated cells are incubated in a medium containing only salts and buffer no reactivation is observed. Probably the carbon sources is metabolized to form intermediates and energy, which are needed for glutamine catabolizing reactions or for prevention of glutamine synthesis. Reactivation does not take place m the presence of NH4+ i.e. under inactivating conditions. However if inactivation is inhabited by fluoride, reactivation can be observed in the presence of NH4+. When inactivated cells are incubated with fluoride only, without a carbon source in the reactivation medium, a reactivation is found. Inactivation as well as reactivation arc inhibited by thiol-group reagents. From these results we conclude that: (a) Reactivation is independent of protein synthesis; (b) Reactivation does not require energy; (c) Probably thiol-groups are involuted in the reactivation process. [ABSTRACT FROM AUTHOR]

Ultraviolet light produces pyrimidine dimers in cellular DNA. In mouse cell lines the great majority of these pyrimidine dimers are not excised, but remain in high molecular weight DNA. Hence the DNA used as template for DNA synthesis in the first generation after ultraviolet irradiation must contain such dimers. In two mouse cell lines (L5178Y and 3T3), alkaline sucrose sedimentation studies showed that the DNA pulse-labelled shortly after irradiation contained gaps, which by analogy with the situation in Escherichia coli, are presumed to be opposite the pyrimidine dimers. In contrast such gaps could not be detected in DNA pulse-labelled several hours after irradiation, despite the fact that dimers must have been present on the template strands. A possible explanation is that gaps were still being formed, but were filled in rapidly and were therefore not detected. This hypothesis was tested as follows. Either 1 or 8 h after ultraviolet irradiation cells were pulse-labelled in the presence of theophylline. This purine inhibits the filling in of gaps presumably by binding to the DNA in the gap. Even in the presence of theophylline, the late-synthesized DNA was considerably larger than the early-synthesized DNA. This suggests that at late times after irradiation, gaps were either not formed at all opposite the dimers, or were so transient that theophylline could not bind and inhibit their filling in. A model for synthesis of DNA on templates containing pyrimidine dimers in mammalian cells, based on these findings and other recent results, is discussed. [ABSTRACT FROM AUTHOR]

Aspartokinase I-homoserine dehydrogenase I from Escherichia coli K 12 was subjected to mild proteolysis. A fragment carrying only the desensitized homoserine dehydrogenase activity was purified. It is a dimer having a subunit molecular weight of 55 000 as opposed to 86 000 for the subunit of the native tetrameric enzyme. On the other hand, a threonine sensitive aspartokinase devoid of homoserine dehydrogenase activity was extracted from the mutant Gif 108. The purified protein is shown to have subunits shorter than those of the wild-type enzyme (molecular weight 47 000). It was shown that the two catalytic activities of aspartokinase I-homoserine dehydrogenase I are sequentially distributed on the single polypeptide chain: the aspartokinase activity is located in the amino-terminal section and the homoserine dehydrogenase in the carboxyl-terminal section. The results are discussed in relation to the configuration of the native enzyme and with the possible origin of the bifunctional protein. [ABSTRACT FROM AUTHOR]

Develops a method for the stepwise degradation of tRNA by means of periodate oxidation, amine-catalyzed elimination and alkaline phosphatase treatment. Difference in rate of dephosphorylation; Biological activity of Escherichia coli tRNA; Reduction of tRNA with sodium borohydride.

Through the use of the analytical active-enzyme-centrifugation method we have been able to measure the sedimentation coefficients of enzymes which have not yet been obtained in highly purified preparations: aspartate-semialdehyde dehydrogenase from Escherichia coli and from yeast and lactate dehydrogenase from rabbit muscle. We have also been able to determine unambiguously the polymerization state of the fully active unit, of β-galactosidase from E. coli, alcohol dehydrogenase from yeast as well as the polymerization state of the fully active unit of two enzymes which undergo an association-dissociation concentration-dependent reaction, glucose-6-phosphate dehydrogenase from yeast and glutamate dehydrogenase from beef liver (for this last enzyme the active-enzyme-centrifugation method has been applied with NAD, NADH, NADP and NADPH as coenzymes and also for its alanine dehydrogenase activity). [ABSTRACT FROM AUTHOR]

It is known that Escherichia coli can incorporate labeled thymidme into its DNA, but it has not been previously possible to measure the incorporation of the other deoxyribonucleosides deoxycytidine, deoxyadenosine, and deoxyguanosine because of degradation of these compounds. The present experiments utilize a mutant of E. coli B lacking deoxyribonucleoside-catabolizing enzymes. This strain, OK441, has mutations affecting the following enzymes: thymidine phosphorylase, purine nucleoside phosphorylase, cytidine deaminase, and adenosine deaminase. The results with OK441 show that E. coli, in contrast to lactobacilli and mammalian cells, does not incorporate any deoxyribonucleoside other than thymidine into its DNA. E. coli may be unable to phosphorylate deoxycytidine, deoxyadenosine, and deoxyguanosine. In agreement. with this suggestion, only thymidine kinase but no other deoxyribonucleotide kinase could be detected in extracts of OK441. [ABSTRACT FROM AUTHOR]

The replication of the colicinogenic factor Col E1 has been studied in two mutants of Escherichia coli with different thermosensitive lesions in DNA replication. One of these mutants E. coli ts 120/6 (Col E1) presumably synthesizes a thermolabile initiator for DNA replication. This mutant is not capable of supporting the synthesis of the Col E1 DNA at the restrictive temperature. The other mutant E. coli ts CR 34/43 (Col E1) is able to replicate Col E1 DNA at the restrictive temperature at a reduced rate. The Col E1 DNA forms synthesized under the non-permissive conditions are abnormal. The banding pattern of the DNA in ethidium bromide-cesium chloride gradients and the sedimentation profile in sucrose gradients suggest that multiple circular and possibly catenated forms of Col E1 DNA are generated these non-permissive conditions. Mutant E. coli ts CR 34/43 (Col E1) shows a high colicin production upon induction with mitomycin C at 43°, while mutant E. coli ts 120/6 (Col E1) fails to synthesize colicin at the restrictive temperature. [ABSTRACT FROM AUTHOR]

The tyrosine tRNAs specified by the E. coli amber suppressor gene suIII+ and the wild type non-suppressing allele suCH were selectively labelled with 32P in E. coli infected with transducing phage φ80 carrying either of these genes. The determination of the nucleotide sequence of the suIII+ tyrosine tRNA is described. This tRNA has the anticodon CUA. The suIII- tRNA differs from suIII+ tRNA by a single nucleotide and has the anticodon GUA where G is a modified guanylic acid residue. E. coli su- cells contain two tyrosine tRNAs (I and II). The determination of the nucleotide sequence of these is described. Species I is identical to suIII- tRNA while species II differs by two nucleotides in the variable loop region. [ABSTRACT FROM AUTHOR]

After pronase treatment of the murein-lipoprotein complex (rigid layer) of the cell wall of E, coli B or E. coli K12 (W 945), lysine and arginine remain as the sole amino acids covalently bound to the murein (peptidoglycan, glycopeptide). These amino acids occur in equimolar amounts, each equal to the amount of lysine remaining with the murein after trypsin digestion of the murein-lipoprotein complex. From partial acid hydrolysates of such a murein, prepared by pronase digestion of the murein-lipoprotein complex, the following peptides have been isolated: (1) diaminopimelyl-lysyl-arginine; (2) alanyl-glutamyl-diaminopimelyl-lysyl-arginine; (3) glucosaminyl-muramyl-alanyl-glutamyl-diaminopimelyl-lysyl-arginine. Peptide 1 shows that the lipoprotein is bound by the α-amino group of the presumably N-terminal lysine to the carboxyl group of diaminopimelic acid. Peptide 2 consists of a peptide side chain of the murein to which the two amino acids of the N-terminal end of the lipoprotein, lysine and arginine, are attached. Peptide 3 constitutes a repeating unit of the murein to which the peptide lysyl-arginine of the lipoprotein is bound. The lipoprotein cleaved from the murein by a short trypsin digestion had an amino acid composition similar to the lipoprotein in the untreated murein-lipoprotein complex and arginine as N-terminal amino acid. The following structure is proposed: murein-lysyl-arginyl-lipoprotein. In the rapid reaction of trypsin with the cell wall the enzyme apparently cleaves at the C-terminal end of the lysine of the murein-lipoprotein linkage which results in murein-lysine and arginyl-lipoprotein. Some cleavage at the C-terminal end of arginine gives rise to free arginine (14%). These results support the supramolecular structure of the murein-lipoprotein complex previously proposed. On the average one lipoprotein molecule is covalently bound to every tenth repeating unit of the murein from which an average distance of 103 Å between two lipoprotein molecules along the polysaccharide chains of the murein is deduced. [ABSTRACT FROM AUTHOR]

Polymerization of nucleoside diphosphates by polynucleotide phosphorylase from Escherichia coli B normally proceeds with a lag phase (exponential phase) which can be abolished by very low concentrations of 3′-OH oligonucleotides. The influence of several factors, including the nature of the oligonucteotide and magnesium concentration, on the concentration required for half activation, i.e. abolition of the lag phase, was studied; the values varied from 1 µM to < 10 nM, depending on the oligonucleotide. Evidence is presented which indicates that, even though the oligonucleotides are rapidly incorporated into the newly formed polymer at concentrations < i µM, de novo synthesis is activated to the same extent as thc overall reaction. Oligonucleotides activate arsenolysis of ADP at the same level as polymerization. Activation by 3′-phosphate terminated oligonucleotides requires about 100 times higher concentrations and may be a result of their contamination by dephosphorylated oligonucleotides. A kinetic scheme for the polymerization reaction is presented. The essential factor is the strong binding of polymer, either added or formed directly on the enzyme, at multiple subsites, as a necessary condition for maintaining conformation of a polynucleotide phosphorylase active in de novo synthesis of polymer. Michaelis constants in the phosphorolysis reaction of oligonucleotides (pA)3 and (pA)4 are 250 and 90 µM, respectively, while those for poly A and poly U are 2 µM (nucleotide units) and for inorganic phosphate, Km = 0,7 mM. Michaelis constants of the oligonucleotides in the phosphorolysis reaction arc about three orders of magnitude larger than the apparent activator constants. The temperature coefficients of polymerization and phosphorolysis between 0.4° and 37° were the same; the rates varied 25-fold over this temperature range. [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

A method is described of producing and maintaining division synchrony of bacterial cells growing in a chemostat. The method depends upon adding the limiting nutrient, phosphate, to the culture periodically, the period being equal to the generation time so that there is one addition per cell generation. Several enzymes were measured and shown to oscillate once during the cell cycle. Each enzyme had a characteristic phase relationship to cell division. [ABSTRACT FROM AUTHOR]

The primary structures of the 16S and 23S ribosomal RNAs of Escherichia coli have been studied. Nucleotide sequences have been determined which occur in specific areas close to the small numbers of methylated nucleotides which are present in these molecules. Fragments containing these methylated nucleotides were obtained by digestion of radioactive RNA substrates with T1 ribonuclease. Such digestion products were fractionated by high-voltage electrophoresis in two dimensions. The 23S RNA yielded predominantly 11 methylated oligonucleotides on digestion, and the 16S RNA gave rise to 6 methylated components. Nucleotide sequence analysis of these products was carried out, and the nature of the modified nucleotides occurring in each product was also examined. It was found that some of the sequences contained several modified components positioned close to each other. Quantitative studies indicate that each of the methylated sequences is probably present twice in a molecule of the 23S RNA, so that these sequences encompass about 5% of the nucleotides present in the entire molecule. It is postulated that extensive repetition of nucleotide sequences occurs within the 23S RNA. [ABSTRACT FROM AUTHOR]

Biosynthetically inactive labelled glutamine synthetase b was produced by enzymic adenylylation of biosynthetically active glutamine synthetase a with [14C]ATP. Upon incubation of the glutamine synthetase b with a crude extract from E. coli B a reactivation, i. e. an increase of biosynthetic activity, and a release of protein bound radioactivity takes place with identical kinetics. Thus, E. coli B contains a glutamine synthetase b activating (deadenylylating) enzyme system. The radioactive material released was identified as AMP. Fluoride (2.5 mM) and 2.5 mM ATP stimulate the enzymic activation of glutamine synthetase b multi-fold, dATP, ITP, GTP, CTP, and UTP also stimulate but AMP inhibits the activation. These effects point to a control of the glutamine synthetase interconverting enzyme system by the ATP/AMP ratio, i.e. by the energy situation of the cell. [ABSTRACT FROM AUTHOR]

The non-enzymatic binding of aminoacyl-tRNA, N-blocked aminoacyl-tRNA, peptidyl-tRNA and N-blocked peptidyl-tRNA to E. coli ribosomes was measured at 0.01 M magnesium ion concentration in the presence of poly U. It was found that, the maximal amounts of phenylalanyl-tRNA and peptidyl-tRNA, that can be bound to the ribosomes are the same, but the amounts of N-blocked phenylalanyl-tRNA and N-blocked peptidyl-tRNA, that can maximally be bound to the ribosomes are much less. Phenytalanyl-tRNA and peptidyl-tRNA can be bound to ribosomes which are saturated in respect to N-blocked phenylalanyl-tRNA or N-blocked peptidyl-tRNA; however, the presence of the N-blocked substrates on the ribosomes partially inhibits the additional binding of phenylalanyl-tRNA or peptidyl-tRNA. Aminoacyl-tRNA added to ribosomes saturated with respect to peptidyl-tRNA, partially displaces the peptidyl-tRNA from its ribosomal binding site. Under the same conditions, peptidyl-tRNA exchanges with prebound aminoacyl-tRNA considerably less. [ABSTRACT FROM AUTHOR]

The complex protein carrying the two threonine sensitive activities aspartokinase I and homoserine dehydrogenase I is composed of six subunits of a molecular weight 60,000. Furthermore, quantitative determination of the N-terminal amino acids indicates the presence of six methionine residues per mole of native enzyme (mol wt, 360,000). Equilibrium sedimentation studies of N-ethylmaleimide treated protein shows that its six disulfide bridges, revealed by chemical analysis, are intra-chain. Fingerprints of tryptic digests of the protein fail to reveal any difference between the subunits. [ABSTRACT FROM AUTHOR]

An acidic polysaccharide which consists of D­glucuronic acid. D­glucose, D­galactose and L­fucose in a molar ratio of 1:1:1:1 and which contains 5.2% of O-acetyl groups was isolated from Escherichia coli 08:K 27 (A):H- cells. About 80% of the total polysaccharide present on the bacterial cell could not be extracted with saline at 60°. This polysaccharide fraction was solubilized with 45% aqueous phenol at 65°. Purification of the acidic polysaccharide was achieved with cetavlon precipitation. It was shown to be homogeneous by ultracentrifugation analysis. The acidic polysaccharide has a high molecular weight (mean value 3 × 106), gives an aqueous solution with high viscosity ([η] = 5.0 dl/g) and possesses a very large form factor (ƒ/ƒo = 6.5). Treatment of the acidic polysaccharide with dilute alkali produced smaller molecules of a molecular weight of about 100,000. Alkali treatment did not alter the sugar composition of the acidic polysaccharide nor did it impair its serological properties. The acidic polysaccharide was oxidized by sodium periodate with concomitant destruction of the galactose moiety. Glucuronic acid, glucose and fucose in the polysaccharide resisted periodate oxidation. When the periodate oxidized and sodium borohydride reduced polysaccharide was hydrolyzed, 0.8 moles of glycerol per mole of the oxidized galact, ose was detected in the hydrolyzate. The methylated acidic polysaccharide was subjected to methanolysis and the methyl glycosides of the methylated sugar constituents were investigated with the aid of gas liquid chromatography. Methyl-tetra-O-methyl-D-galactoside was found to be present in the methanolyzate. Acid hydrolysis of the acidic polysaccharide gave rise to the following charged oligosaccharides: (i) glucuronosyl-(l:3)-fucose, (ii) glucosyl-(l:3)-glucuronosyl-(l:3)-fucose and (iii) galactosyl-(1:3)-glucosyl-(1:3)-glucuronosyl-(l:3)-fucose. No neutral oligosaccharides were detected in hydrolyzates of the acidic polysaccharide. It is concluded that the acidic polysaccharide of E. coli 08:K27 (A):H- consists of subunits of a molecular weight of about 100,000. These subunits are probably linked through ester bonds between carboxyl groups of glucuronic acid and hydroxyl groups of sugar constituents. It is suggested that the polysaccharide chains of the subunits consist, of glucose, glucuronic acid and fucose in repeating order to which galactose is bound in 1:3-linkage, with glucose as the branch point. The acidic polysaccharide absorbes directly onto erythrocytes. In passive haemagglutination tests the polysaccharide-sensitized red cells reacted strongly with E. coli 08:K27 anti OK and anti K sera but very weakly with anti O serum. After absorption of anti OK serum with the purified acidic polysaccharide the antiserum no longer agglutinated the encapsulated strain. The acidic polysaccharide was precipitated by 08:K27 antiserum and by K27 antiserum. This precipitation was inhibited by the tetrasaccharide (iii) and to a lesser extent by the trisaccharide (ii), but not by disaccharide (i) and glucuronic acid. After periodate oxidation—which destroyed the galactose moiety—the acidic polysaccharide was no longer reactive in serological tests. From these results it is concluded that the acidic polysaccharide isolated from E. coli 08:K27 (A):H- is the K antigen of this strain. Galactose appears to be the immunodominant sugar constituent of the K27 antigen, but the whole determinant group consists (at least) of the galactose-1:3-glucose disaccharide. [ABSTRACT FROM AUTHOR]

Effect of spermine on the binding of erythromycin to ribosomes from Escherichia coli (Q13) and on N-acetylphenylalanyl-puromycin (AcPhe-puromycin) synthesis on the ribosomes was studied under various ionic conditions. 1. Spermine inhibited the binding of erythromycin to ribosomes. The inhibitory effect was diminished with increasing concentration of Mg2+ or monovalent cation such as K+ or NH4+. 2. The preincubation of ribosomes with spermine strongly decreased the affinity of ribosomes to erythromycin. The affinity of spermine-treated ribosomes was restored by subsequent incubation with high concentration of NH4+. These inactivation and reactivation processes were strongly dependent on the incubation temperature. 3. At a high concentration of Mg2+ (16 mM), AcPhe-puromycin synthesis was inhibited by the addition of spermine, although the binding of N-acetylphenylalanyl-tRNA (AcPhe-tRNA) to ribosomes was not affected. 4. At a low Mg2+ (5 mM) concentration, AcPhe-tRNA-ribosome complex formation and AcPhe-puromycin synthesis were stimulated by the addition of relatively low concentration of spermine. Further additions of spermine resulted in marked reductions of AcPhe-puromycin synthesis, while AcPhe-tRNA · ribosome complex formation was little affected. 5. The inhibition by spermine of AcPhe-puromycin synthesis was reduced by increasing concentration of K+ or NH4+, regardless of the concentration of Mg2+. These results suggest that spermine binds to ribosomes and the incubation of the spermine · ribosome complex at physiological temperature induces an alteration of ribosome conformation and consequent changes in the ribosomal functions. [ABSTRACT FROM AUTHOR]

The SUMO proteins are a class of small ubiquitin-like modifiers. SUMO is attached to a specific lysine side chain on the target protein via an isopeptide bond with its C-terminal glycine. There are at least four SUMO proteins in humans, which are involved in protein trafficking and targeting. A truncated human SUMO-2 protein that contains residues 9–93 was expressed inEscherichia coliand crystallized in two different unit cells, with dimensions of a = b = 75.25 Å, c = 29.17 Å and a = b = 74.96 Å, c = 33.23 Å, both belonging to the rhombohedral space groupR3. They diffracted X-rays to 1.6 Å and 1.2 Å resolution, respectively. The structures were determined by molecular replacement using the yeast SMT3 protein as a search model. Subsequent refinements yieldedR/ Rfree values of 0.169/0.190 and 0.119/0.185, at 1.6 Å and 1.2 Å, respectively. The peptide folding of SUMO-2 consists of a half-openβ-barrel and two flankingα-helices with secondary structural elements arranged asββαββαβ in the sequence, identical to those of ubiquitin, SMT3 and SUMO-1. Comparison of SUMO-2 with SUMO-1 showed a surface region near the C terminus with significantly different charge distributions. This may explain their distinct intracellular locations. In addition, crystal-packing analysis suggests a possible trimeric assembly of the SUMO-2 protein, of which the biological significance remains to be determined. [ABSTRACT FROM AUTHOR]

Cyclophilins facilitate the peptidyl-prolyl isomerization of a trans-isomer to a cis-isomer in the refolding process of unfolded proteins to recover the natural folding state with cis-proline conformation. To date, only short peptideswith a cis-form proline have been observed in complexes of human and Escherichia coli proteins of cyclophilin A, which is present in cytoplasm. The crystal structures analyzed in this study show two complexes in which peptides having a transform proline, i.e. succinyl-Ala-trans-Pro-Ala-p-nitroanilide and acetyl-Ala-Ala-trans-Pro-Ala-amidomethylcoumarin, are bound on a K163T mutant of Escherichia coli cyclophilin B, the preprotein of which has a signal sequence. Comparison with cis-form peptides bound to cyclophilin A reveals that in any case the proline ring is inserted into the hydrophobic pocket and a hydrogen bond between CO of Pro andNeta2 of Arg is formed to fix the peptide. On the other hand, in the cis-isomer, the formation of two hydrogen bonds of NH and CO of Ala preceding Pro with the protein fixes the peptide, whereas in the trans-isomer formation of a hydrogen bond between CO preceding Ala-Pro and His47 Nepsiv2 via a mediating water molecule allows the large distortion in the orientation of Ala of Ala-Pro. Although loss of double bond character of the amide bond of Ala-Pro is essential to the isomerization pathway occurring by rotating around its bond, these peptides have forms impossible to undergo proton transfer from the guanidyl group of Arg to the prolyl N atom, which induces loss of double bond character. Guanylate cyclase-activating proteins (GCAPs) are neuronal calcium sensors that activate membrane bound guanylate cyclases (EC 4.6.1.2.) of vertebrate photoreceptor cells when cytoplasmic Ca2+ decreases during illumination. GCAPs contain four EF-hand Ca2+-binding motifs, but the first EF-hand is nonfunctional. It was concluded that for GCAP-2, the loss of Ca2+-binding ability of EF-hand 1 resulted in a region that is crucial for targeting guanylate cyclase [Ermilov, A.N.,Olshevskaya, E.V.& Dizhoor,A.M. (2001) J. Biol. Chem. 276, 48143-48148]. In this study we tested the consequences of mutations in EF-hand 1 of GCAP-1 with respect to Ca2+ binding, Ca2+-induced conformational changes and target activation. When the nonfunctional first EF-hand in GCAP-1 is replaced by a functional EF-hand the chimeric mutant CaM-GCAP-1 bound four Ca2+ and showed similar Ca2+-dependent changes in tryptophan fluorescence as the wild-type. CaM- GCAP-1 neither activated nor interacted with guanylate cyclase. Size exclusion chromatography revealed that the mutant tended to form inactive dimers instead of active monomers like the wild-type. Critical amino acids in EFhand 1 ofGCAP-1 are cysteine at position 29 and proline at position 30, as changing these to glycine was sufficient to cause loss of target activation without a loss of Ca2+- induced conformational changes. The latter mutation also promoted dimerization of the protein. Our results show that EF-hand 1 in wild-typeGCAP-1 is critical for providing the correct conformation for target activation. [ABSTRACT FROM AUTHOR]

Malate dehydrogenase (MDH) may be important in carbohydrate and energy metabolism in malarial parasites. The cDNA corresponding to the MDH gene, identified on chromosome 6 of the Plasmodium falciparum genome, was amplified by RT-PCR, cloned and overexpressed in Escherichia coli. The recombinant Pf MDH was purified to homogeneity and biochemically characterized as an NAD+(H)-specific MDH, which catalysed reversible interconversion of malate to oxaloacetate. Pf MDH could not use NADP/NADPH as a cofactor, but used acetylpyridine adenine dinucleoide, an analogue of NAD. The enzyme exhibited strict substrate and cofactor specificity. The highest levels of Pf MDH transcripts were detected in trophozoites while the Pf MDH protein level remained high in trophozoites as well as schizonts. A highly refined model of Pf MDH revealed distinct structural characteristics of substrate and cofactor binding sites and important amino acid residues lining these pockets. The active site amino acid residues involved in substrate binding were conserved in Pf MDH but the N-terminal glycine motif, which is involved in nucleotide binding, was similar to the GXGXXG signature sequence found in Pf LDH and also in α-proteobacterial MDHs. Oxamic acid did not inhibit Pf MDH, while gossypol, which interacts at the nucleotide binding site of oxidoreductases and shows antimalarial activity, inhibited Pf MDH also. Treatment of a synchronized culture of P. falciparum trophozoites with gossypol caused induction in expression of Pf MDH, while expression of Pf LDH was reduced and expression of malate:quinone oxidoreductase remained unchanged. Pf MDH may complement Pf LDH function of NAD/NADH coupling in malaria parasites. Thus, dual inhibitors of Pf MDH and Pf LDH may be required to target this pathway and to develop potential new antimalarial drugs. [ABSTRACT FROM AUTHOR]

Using 0.4 m imidazole citrate buffer (pH 7.5) containing 0.1 m m l-cysteine, homodimeric starch phosphorylase from Corynebacterium calluane ( CcStP) was dissociated into native-like folded subunits concomitant with release of pyridoxal 5′-phosphate and loss of activity. The inactivation rate of CcStP under resolution conditions at 30 °C was, respectively, four- and threefold reduced in two mutants, Arg234→Ala and Arg242→Ala, previously shown to cause thermostabilization of CcStP [Griessler, R., Schwarz, A., Mucha, J. & Nidetzky, B. (2003) Eur. J. Biochem. 270, 2126–2136]. The proportion of original enzyme activity restored upon the reconstitution of wild-type and mutant apo-phosphorylases with pyridoxal 5′-phosphate was increased up to 4.5-fold by added phosphate. The effect on recovery of activity displayed a saturatable dependence on the phosphate concentration and results from interactions with the oxyanion that are specific to the quarternary state. Arg234→Ala and Arg242→Ala mutants showed, respectively, eight- and > 20-fold decreased apparent affinities for phosphate ( Kapp), compared to the wild-type ( Kapp≈ 6 m m). When reconstituted next to each other in solution, apo-protomers of CcStP and Escherichia coli maltodextrin phosphorylase did not detectably associate to hybrid dimers, indicating that structural complementarity among the different subunits was lacking. Pyridoxal-reconstituted CcStP was inactive but ≈ 60% and 5% of wild-type activity could be rescued at pH 7.5 by phosphate (3 m m) and phosphite (5 m m), respectively. pH effects on catalytic rates were different for the native enzyme and pyridoxal-phosphorylase bound to phosphate and could reflect the differences in p Ka values for the cofactor 5′-phosphate and the exogenous oxyanion. [ABSTRACT FROM AUTHOR]

We describe the expression, purification, and biochemical characterization of two homologous enzymes, with amidohydrolase activities, of plant ( Lupinus luteus potassium-independent asparaginase, LlA) and bacterial ( Escherichia coli, ybiK/ spt/iaaA gene product, EcAIII) origin. Both enzymes were expressed in E. coli cells, with (LlA) or without (EcAIII) a His-tag sequence. The proteins were purified, yielding 6 or 30 mg·L−1 of culture, respectively. The enzymes are heat-stable up to 60 °C and show both isoaspartyl dipeptidase and l-asparaginase activities. Kinetic parameters for both enzymatic reactions have been determined, showing that the isoaspartyl peptidase activity is the dominating one. Despite sequence similarity to aspartylglucosaminidases, no aspartylglucosaminidase activity could be detected. Phylogenetic analysis demonstrated the relationship of these proteins to other asparaginases and aspartylglucosaminidases and suggested their classification as N-terminal nucleophile hydrolases. This is consistent with the observed autocatalytic breakdown of the immature proteins into two subunits, with liberation of an N-terminal threonine as a potential catalytic residue. [ABSTRACT FROM AUTHOR]

A putative phosphoglycerate dehydrogenase (PGDH), which catalyzes the oxidation of d-phosphoglycerate to 3-phosphohydroxypyruvate in the so-called phosphorylated serine metabolic pathway, from the enteric protozoan parasite Entamoeba histolytica was characterized. The E. histolytica PGDH gene ( EhPGDH) encodes a protein of 299 amino acids with a calculated molecular mass of 33.5 kDa and an isoelectric point of 8.11. EhPGDH showed high homology to PGDH from bacteroides and another enteric protozoan ciliate, Entodinium caudatum. EhPGDH lacks both the carboxyl-terminal serine binding domain and the 13–14 amino acid regions containing the conserved Trp139 (of Escherichia coli PGDH) in the nucleotide binding domain shown to be crucial for tetramerization, which are present in other organisms including higher eukaryotes. EhPGDH catalyzed reduction of phosphohydroxypyruvate to phosphoglycerate utilizing NADH and, less efficiently, NADPH; EhPGDH did not utilize 2-oxoglutarate. Kinetic parameters of EhPGDH were similar to those of mammalian PGDH, for example the preference of NADH cofactor, substrate specificities and salt-reversible substrate inhibition. In contrast to PGDH from bacteria, plants and mammals, the EhPGDH protein is present as a homodimer as demonstrated by gel filtration chromatography. The E. histolytica lysate contained PGDH activity of 26 nmol NADH utilized per min per mg of lysate protein in the reverse direction, which consisted 0.2–0.4% of a total soluble protein. Altogether, this parasite represents a unique unicellular protist that possesses both phosphorylated and nonphosphorylated serine metabolic pathways, reinforcing the biological importance of serine metabolism in this organism. Amino acid sequence comparison and phylogenetic analysis of various PGDH sequences showed that E. histolytica forms a highly supported monophyletic group with another enteric protozoa, cilliate E. caudatum, and bacteroides. [ABSTRACT FROM AUTHOR]

An open reading frame (Acc. no. P50740) on the Bacillus subtilis chromosome extending from bp 184 997–186 043 with similarity to the idi-2 gene of Streptomyces sp. CL190 specifying type II isopentenyl diphosphate isomerase was expressed in a recombinant Escherichia coli strain. The recombinant protein with a subunit mass of 39 kDa was purified to apparent homogeneity by column chromatography. The protein was shown to catalyse the conversion of dimethylallyl diphosphate into isopentenyl diphosphate and vice versa at rates of 0.23 and 0.63 µmol·mg−1·min−1, respectively, as diagnosed by 1H spectroscopy. FMN and divalent cations are required for catalytic activity; the highest rates were found with Ca2+. NADPH is required under aerobic but not under anaerobic assay conditions. The enzyme is related to a widespread family of ( S)-α–hydroxyacid oxidizing enzymes including flavocytochrome b2 and l-lactate dehydrogenase and was shown to catalyse the formation of [2,3-13C2]lactate from [2,3-13C2]pyruvate, albeit at a low rate of 1 nmol·mg−1·min−1. Putative genes specifying type II isopentenyl diphosphate isomerases were found in the genomes of Archaea and of certain eubacteria but not in the genomes of fungi, animals and plants. The analysis of the occurrence of idi-1 and idi-2 genes in conjunction with the mevalonate and nonmevalonate pathway in 283 completed and unfinished prokaryotic genomes revealed 10 different classes. Type II isomerase is essential in some important human pathogens including Staphylococcus aureus and Enterococcus faecalis where it may represent a novel target for anti-infective therapy. [ABSTRACT FROM AUTHOR]

Iron–sulfur clusters are widely represented in most organisms, but the mechanism of their formation is not fully understood. Of the two main proteins involved in cluster formation, NifS/IscS and NifU/IscU, only the former has been well studied from a structural point of view. Here we report an extensive structural characterization of Escherichia coli IscU. We show by a variety of physico-chemical techniques that E. coli IscU construct can be expressed to high purity as a monomeric protein, characterized by an αβ fold with high α-helix content. The high melting temperature and the reversibility of the thermal unfolding curve (as measured by CD spectroscopy) hint at a well ordered stable fold. The excellent dispersion of cross peaks in the 1H-15N correlation spectrum is consistent with these observations. Monomeric E. coli IscU is able to provide a scaffold for Iron–sulfur cluster assembly, but has no direct interaction with either Fe(II) or Fe(III) ions, suggesting the need of further partners to achieve a stable interaction. [ABSTRACT FROM AUTHOR]

p-Hydroxyphenylacetate decarboxylase from Clostridium difficile catalyses the decarboxylation of p-hydroxyphenylacetate to yield the cytotoxic compound p-cresol. The three genes encoding two subunits of the glycyl-radical enzyme and the activating enzyme have been cloned and expressed in Escherichia coli. The recombinant enzymes were used to reconstitute a catalytically functional system in vitro. In contrast with the decarboxylase purified from C. difficile, which was an almost inactive homo-dimeric protein (β2), the recombinant enzyme was a hetero-octameric (β4γ4), catalytically competent complex, which was activated using endogenous activating enzyme from C. difficile or recombinant activating enzyme to a specific activity of 7 U·mg−1. Preliminary results suggest that phosphorylation of the small subunit is responsible for the change of the oligomeric state. These data point to an essential function of the small subunit of the decarboxylase and may indicate unique regulatory properties of the system. [ABSTRACT FROM AUTHOR]

An amidase acting on ( R, S)-piperazine-2- tert-butylcarboxamide was purified from Pseudomonas azotoformans IAM 1603 and characterized. The enzyme acted S-stereoselectively on ( R, S)-piperazine-2- tert-butylcarboxamide to yield ( S)-piperazine-2-carboxylic acid. N-terminal and internal amino acid sequences of the enzyme were determined. The gene encoding the S-stereoselective piperazine-2- tert-butylcarboxamide amidase was cloned from the chromosomal DNA of the strain and sequenced. Analysis of 2.1 kb of genomic DNA revealed the presence of two ORFs, one of which ( laaA) encodes the amidase. This enzyme, LaaA is composed of 310 amino acid residues (molecular mass 34 514 Da), and the deduced amino acid sequence exhibits significant similarity to hypothetical and functionally characterized proline iminopeptidases from several bacteria. The laaA gene modified in the nucleotide sequence upstream from its start codon was overexpressed in Escherichia coli. The activity of the recombinant LaaA enzyme in cell-free extracts of E. coli was 13.1 units·mg−1 with l-prolinamide as substrate. This enzyme was purified to electrophoretic homogeneity by ammonium sulfate fractionation and two column chromatography steps. On gel-filtration chromatography, the enzyme appeared to be a monomer with a molecular mass of 32 kDa. It had maximal activity at 45 °C and pH 9.0, and was completely inactivated in the presence of phenylhydrazine, Zn2+, Ag+, Cd2+ or Hg2+. LaaA had hydrolyzing activity toward l-amino acid amides such as l-prolinamide, l-proline- p-nitroanilide, l-alaninamide and l-methioninamide, but did not act on the peptide substrates for the proline iminopeptidases despite their sequence similarity to LaaA. The enzyme also acted S-stereoselectively on ( R, S)-piperidine-2-carboxamide, ( R, S)-piperazine-2-carboxamide and ( R, S)-piperazine-2- tert-butylcarboxamide. Based on its specificity towards l-amino acid amides, the enzyme was named l-amino acid amidase. E. coli transformants overexpressing the laaA gene could be used for the S-stereoselective hydrolysis of ( R, S)-piperazine-2- tert-butylcarboxamide. [ABSTRACT FROM AUTHOR]

A novel amidase acting on ( R, S)-piperazine-2- tert-butylcarboxamide was purified from Pseudomonas sp. MCI3434 and characterized. The enzyme acted R-stereoselectively on ( R, S)-piperazine-2- tert-butylcarboxamide to yield ( R)-piperazine-2-carboxylic acid, and was tentatively named R-amidase. The N-terminal amino acid sequence of the enzyme showed high sequence identity with that deduced from a gene named PA3598 encoding a hypothetical hydrolase in Pseudomonas aeruginosa PAO1. The gene encoding R-amidase was cloned from the genomic DNA of Pseudomonas sp. MCI3434 and sequenced. Analysis of 1332 bp of the genomic DNA revealed the presence of one open reading frame ( ramA) which encodes the R-amidase. This enzyme, RamA, is composed of 274 amino acid residues (molecular mass, 30 128 Da), and the deduced amino acid sequence exhibits homology to a carbon–nitrogen hydrolase protein (PP3846) from Pseudomonas putida strain KT2440 (72.6% identity) and PA3598 protein from P. aeruginosa strain PAO1 (65.6% identity) and may be classified into a new subfamily in the carbon–nitrogen hydrolase family consisting of aliphatic amidase, β-ureidopropionase, carbamylase, nitrilase, and so on. The amount of R-amidase in the supernatant of the sonicated cell-free extract of an Escherichia coli transformant overexpressing the ramA gene was about 30 000 times higher than that of Pseudomonas sp. MCI3434. The intact cells of the E. coli transformant could be used for the R-stereoselective hydrolysis of racemic piperazine-2- tert-butylcarboxamide. The recombinant enzyme was purified to electrophoretic homogeneity from cell-free extract of the E. coli transformant overexpressing the ramA gene. On gel-filtration chromatography, the enzyme appeared to be a monomer. It had maximal activity at 45 °C and pH 8.0, and was completely inactivated in the presence of p-chloromercuribenzoate, N-ethylmaleimide, Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Ag+, Cd2+, Hg2+ or Pb2+. RamA had hydrolyzing activity toward the carboxamide compounds, in which amino or imino group is connected to β- or γ-carbon, such as β-alaninamide, ( R)-piperazine-2-carboxamide ( R)-piperidine-3-carboxamide, d-glutaminamide and ( R)-piperazine-2- tert-butylcarboxamide. The enzyme, however, did not act on the other amide substrates for the aliphatic amidase despite its sequence similarity to RamA. [ABSTRACT FROM AUTHOR]

The Hfq (Host factor 1) polypeptide is a nucleic acid binding protein involved in the synthesis of many polypeptides. Hfq particularly affects the translation and the stability of several RNAs. In an earlier study, the use of fold recognition methods allowed us to detect a relationship between Escherichia coli Hfq and the Sm topology. This topology was further validated by a series of biophysical studies and the Hfq structure was modelled on an Sm protein. Hfq forms a β-sheet ring-shaped hexamer. As our previous study predicted a large number of alternative conformations for the C-terminal region, we have determined whether the last 19 C-terminal residues are necessary for protein function. We find that the C-terminal truncated protein is fully capable of binding a polyadenylated RNA ( Kd of 120 p m vs. 50 p m for full-length Hfq). This result shows that the functional core of E. coli Hfq resides in residues 1–70 and confirms previous genetic studies. Using equilibrium unfolding studies, however, we find that full-length Hfq is 1.8 kcal·mol−1 more stable than its truncated variant. Electron microscopy analysis of both truncated and full-length proteins indicates a structural rearrangement between the subunits upon truncation. This conformational change is coupled to a reduction in β-strand content, as determined by Fourier transform infra-red. On the basis of these results, we propose that the C-terminal domain could protect the interface between the subunits and stabilize the hexameric Hfq structure. The origin of this C-terminal domain is also discussed. [ABSTRACT FROM AUTHOR]

A psychrotrophic bacterium Shewanella sp. strain SIB1 was grown at 4 and 20 °C, and total soluble proteins extracted from the cells were analyzed by two-dimensional polyacrylamide gel electrophoresis. Comparison of these patterns showed that the cellular content of a protein with a molecular mass of 28 kDa and an isoelectric point of four greatly increased at 4 °C compared to that at 20 °C. Determination of the N-terminal amino acid sequence, followed by the cloning and sequencing of the gene encoding this protein, revealed that this protein is a member of the FKBP family of proteins with an amino acid sequence identity of 56% to Escherichia coli FKBP22. This protein was overproduced in E. coli in a His-tagged form, purified, and analyzed for peptidyl-prolyl cis-trans isomerase activity. When this activity was determined by the protease coupling assay using N-succinyl-Ala-Leu-Pro-Phe- p-nitroanilide as a substrate at various temperatures, the protein exhibited the highest activity at 10 °C with a kcat/ Km value of 0.87 µ m−1·s−1. When the peptidyl-prolyl cis-trans isomerase activity was determined by the RNase T1 refolding assay at 10 and 20 °C, the protein exhibited higher activity at 10 °C with a kcat/ Km value of 0.50 µ m−1·s−1. These kcat/ Km values are lower but comparable to those of E. coli FKBP22. We propose that a FKBP family protein is involved in cold-adaptation of psychrotrophic bacteria. [ABSTRACT FROM AUTHOR]

Although isopentenyl diphosphate–dimethylallyl diphosphate isomerase is thought to be essential for archaea because they use the mevalonate pathway, its corresponding activity has not been detected in any archaea. A novel type of the enzyme, which has no sequence similarity to the known, well-studied type of enzymes, was recently reported in some bacterial strains. In this study, we describe the cloning of a gene of a homologue of the novel bacterial isomerase from a thermoacidophilic archaeon Sulfolobus shibatae. The gene was heterologously expressed in Escherichia coli, and the recombinant enzyme was purified and characterized. The thermostable archaeal enzyme is tetrameric, and requires NAD(P)H and Mg2+ for activity, similar to its bacterial homologues. Using its apoenzyme, we were able to confirm that the archaeal enzyme is strictly dependent on FMN. Moreover, we provide evidence to show that the enzyme also has NADH dehydrogenase activity although it catalyzes the isomerase reaction without consuming any detectable amount of NADH. [ABSTRACT FROM AUTHOR]