Search

Presents upcoming research papers on biochemistry to be published in "European Journal of Biochemistry." Discussion of the molecular cloning and sequencing of a cDNA encoding the acyl carrier protein; Exploration of the primary structure of human thyroglobulin; Examination of the reversible activation of hydrogenase from Escherichia coli.

Presents a list of forthcoming papers to be published in 1980 issues of the "European Journal of Biochemistry." Subjects; Authors.

Lists the research studies concerning biochemistry that will be published following December 1987. Titles of the articles; Authors of the studies; Focus of the studies.

The article provides a list of forthcoming papers to be published in "European Journal of Biochemistry." Some of the papers mentioned are: "Isolation and characterization of cDNAs from Atlantic cod encoding two different forms of trypsinogen," "Molecular analysis of chicken embryo SPARC (osteonectin),"

This article presents information regarding the forthcoming papers published in the "European Journal of Biochemistry." The papers include "Studies on the Mechanism of Action of the Histone Kinase Dependent on Adenosine 3'5' Monophosphate: Investigation of protein-protein Interaction by Electron-spin-Resonance Spectroscopy and Stopped-Flow Methods," and "A quantitative Description of Microtubule Formation in the Presence of Tubulin-Colchicine."

This article presents a list of some of the forthcoming papers in biochemistry to be published in this journal. Some of the papers listed are "The Organization of the Chloroplast DNA in wheat and maize in the region containing the LS Gene," by B. Koller, H. Delius and T.A. Dyer, "Effect of Carbamination on the Buffering Power of Purified Human Hamoglobins A Solutions At Two Temperatures," by M. Castaing, E. Bursaux and C. Poyart, "The Complete Nucleotide of the Chicken Ovotransferrin mRNA," by J.M. Jeltsch and P. Chambon, "The Primary Structure of Hen Ovotransferrin," by J. Williams, T.C. Elleman, I.B. Kington, A.G. Wilkins and K.A. Kuhn.

Lists forthcoming papers to be featured in the "European Journal of Biochemistry."

Presents a list of papers scheduled to be published in the "European Journal of Biochemistry," as of August 15, 1992. Topics; Authors.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Lists research papers scheduled for publication in the "European Journal of Biochemistry," in 1989. Topics; Authors; Data presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers scheduled to be pubilshed in the "European Journal of Biochemistry," in 1988. Subjects; Authorship.

Presents a list of forthcoming papers scheduled for publication in the "European Journal of Biochemistry," in 1988. Topics; Authors; Studies and data to be presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Presents several research papers related to biochemistry published in the September 1983 issue of the "European Journal of Biochemistry." "Intracellular Forms of Transferrin Oligosaccharide Chains in Rat Liver," by H. Nakada, H. Kohno, T. Kawasaki and Y. Tashiro; "Primary Structure of Protamine From the Northern Pike Esox lucius," by W. Speckert, B. Kennedy, St. L. Daisley and P. Davies; "ATP-AMP phosphotransferase From Paracoccus denitrificans," by S. -S. Yeh, A. G. Tomasselli and L. H. Noda.

Presents forthcoming papers published on the February 1, 1980 issue of the "European Journal of Biochemistry." "The Interaction of Bovine Pancreatic Deoxyribonuclease I and Skeletal Muscle Actin," by H. G. Mannherz, R. S. Goody, M. Konrad and E. Nowak; "The Hexokinases From Wild-Type and Morphological Mutant Strains of Neurospora crassa," by R. Lagos and T. Ureta; "The Kinetic Mechanism of Xanthine Dehydrogenase and Related Enzymes," by M. P. Coughlan and K. V. Rajagopalan.

Lists the coming articles that will be published in the periodical "European Journal of Biochemistry". Topics of the articles; Authors who wrote the articles; Implication of the research studies on biochemistry.

Lists articles that are scheduled for inclusion in forthcoming issues of the "European Journal of Biochemistry." "Synthesis and Characterization of Neurotensin Analogues for Structure Activity Relationship Studies," by C. Granier et al; "Enhanced Breakdown of Arylsulfate A in Multiple Sulfatase Deficiency," by A.Waheed et al; "An Extracellular polysaccharide Produced by Zoogloea ramigera," F. Ikeda et al.

Lists titles of research papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers on biochemistry which appeared in the January 1983 issue of the "European Journal of Biochemistry."

The deoxyoctanucleotide (5′-3′)d(A-A-G-G-A-G-G-T), which is complementary to the 3′ end of 16-S RNA, inhibits the formation of the complex between the 30-S subunit and MS2 RNA described in the preceding paper. If the complex is preformed, the octanucleotide cannot prevent entry of the complex into the ribosome cycle upon supplementation with the components for protein synthesis. The subunit · MS2-RNA complex is unable to bind the octanucleotide. It is concluded that in the subunit · phage-RNA initiation precursor the 16-S terminus is base-paired with a complementary MS2 RNA sequence. Edeine, aurintricarboxylic acid and antibodies against ribosomal protein S1 prevent the association of phage RNA with 30-S subunits. These compounds do not, however, inhibit the binding of (5′-3′)d(A-A-G-G-A-G-G-T) to 30-S subunits. It is concluded that the formation of the complex between MS2 RNA and 30-S subunits does not depend solely on the Shine and Dalgarno base-pairing reaction. [ABSTRACT FROM AUTHOR]

With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]

Adult bovine aortic endothelial (ABAE) cells, exposed to serum-free medium, specifically bind 125I-labeled human high-density lipoprotein (125I-HDL). Addition of human lipoprotein-deficient serum (LPDS) reduces the specific binding of 125I-HDL in a concentration-dependent manner, such that LPDS at a concentration of 6 mg protein/ml almost completely inhibits the specific binding of 125I-HDL. ABAE cultures exposed to 125I-labeled LPDS (125I-LPDS) specifically bind two peptides, which appear as minor iodinated components in 125I-LPDS. The binding of these two components is abolished in the presence of excess amounts of unlabeled LPDS or HDL. Preincubation of ABAE cells with 25-hydroxycholesterol (25-HC) results in an increase in the binding of the two 125I-LPDS components, similar to the increase observed in 125I-HDL binding in the presence of 25-HC. These two LPDS components comigrate on sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) with apolipoproteins A-I and A-IV of molecular masses 28 kDa and 43 kDa respectively. Furthermore, these two proteins were transfered from the SDS gel to nitrocellulose paper and interacted specifically with anti-(A-I) and anti-(A-IV) sera respectively. When ABAE cultures, pretreated with 25-HC in the presence of LPDS, are subjected to cell-surface iodination, the A-IV appears as one of the major proteins on the cell surface accessible to iodination. The interaction of A-IV with the cell surface of 25-HC-treated cells is not specific to ABAE cells and appears also in human skin fibroblasts. Analysis of the relative amounts of various apolipoproteins in the 125I-HDL bound to ABAE cells demonstrates a decrease in the relative amount of iodinated A-II concomitant with increase in the relative amounts of the other iodinated apolipoproteins, when compared to the composition of the native 125I-HDL. These changes are similar whether the binding is done in the presence or absence of LPDS. It indicates that the decrease in 125I-HDL binding in the presence of LPDS is not due to displacement of the iodinated apolipoproteins A-I and A-IV in the 125I-HDL by unlabeled A-I and A-IV present in LPDS. The results indicate that free apolipoproteins A-I and A-IV, present in LPDS, can displace HDL on the cell surface of ABAE cells. Thus, free A-I and A-IV, present in plasma, control the binding of HDL to endothelial cells and may regulate the process of cholesterol removal from the cells performed by HDL. [ABSTRACT FROM AUTHOR]

On mild acid hydrolysis of lipolysaccharide from Shigella dysenteriae type 3 the O-specific polysaccharide (hapten) was obtained which appeared to be acidic branched hexosaminoglycan. The repeating unit of this polysaccharide represents a pentasaccharide composed of two D-galactose residues, N-acetyl-D-galactosamine, D-glucose and unidentified acidic component. On the basis of methylation analysis, periodate oxidation, partial acid hydrolysis and chromic anhydride oxidation it is concluded that the structure of the chemical repeating unit of polysaccharide is -3)β-D-GalNAcp(1-3)α-D-Galp(1-6)-D-Galf(1- ↑ 14A(1-6)α-D-Glcp. where Glcp is glucopyranose, Galp is galactopyranose, Galf is galactofuranose, GaiNAcp is 2-acetamido-2-deoxygalactopyranose and where the configuration of galactofuranoside glycosidic linkage and the structure of the acidic monosaccharide A are not known. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

The article presents information on the rules for the nomenclature of steroids. The rules of steroid nomenclature originate from a discussion held at the Chemical Industry in Basle Foundation in London, England, in 1950 among the representatives of many schools. In 1960, a group of specialists under the chairmanship of scientist T. Reichstein, including representatives of the International Union of Pure & Applied Chemistry Commissions of the Nomenclature of Organic Chemistry and of Biochemical Nomenclature, met in Basle, Switzerland, for discussions of amendments and additions to the rules. The present rule include all the original rules, mostly renumbered along with additions and amendments arising from the Basle Proposals or from current practice in the literature.

A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]

A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]

1. The action of insulin on [14C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]

Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]

The reversible dehydration of (R )-2-hydroxyglutaryl-CoA to (E )-glutaconyl-CoA is catalysed by the combined action of two oxygen-sensitive enzymes from Acidaminococcus fermentans , the homodimeric component A (2 × 27 kDa) and the heterodimeric component D (45 and 50 kDa). Component A was purified to homogeneity (specific activity 25–30 s-1 ) using streptavidin-tag affinity chromatography. In the presence of 5 mm MgCl2 and 1 mm ADP or ATP, component A could be stabilized and stored for 4–5 days at 4 °C without loss of activity. The purification of component D from A. fermentans was also improved as indicated by the 1.5-fold higher specific activity (15 s-1 ). The content of 1.0 riboflavin 5′-phosphate (FMN) per heterodimer could be confirmed, whereas in contrast to an earlier report only trace amounts of riboflavin (< 0.1) could be detected. Each active component contains an oxygen sensitive diamagnetic [4Fe-4S]2+ cluster as revealed by UV-visible, EPR and Mössbauer spectroscopy. Reduction of the [4Fe-4S]2+ cluster in component A with dithionite yields a paramagnetic [4Fe-4S]1+ cluster with the unusual electron spin ground state S = 3/2 as indicated by strong absorption type EPR signals at high g values, g = 4–6. Spin-Hamiltonian simulations of the EPR spectra and of magnetic Mössbauer spectra were performed to determine the zero field splitting (ZFS) parameters of the cluster and the 57 Fe hyperfine interaction parameters. The electronic properties of the [4Fe-4S]2+,1+ clusters of component A are similar to those of the nitrogenase iron protein in which a [4Fe-4S]2+ cluster bridges the two subunits of the homodimeric protein. Under air component A looses its activity within seconds due to irreversible degradation of its [4Fe-4S]2+ cluster to a [2Fe-2S]2+ cluster. The [4Fe-4S]2+ cluster of component D could not be reduced to a [4Fe-4S]1+ cluster, even with excess of Ti(III)citrate or dithionite. Exposure to oxic conditions slowly converts the diamagnetic [4Fe-4S]2+ cluster of component D to a paramagnetic [3Fe-4S]+ cluster concomitant with loss of activity (30% within 24 h at 4 °C). [ABSTRACT FROM AUTHOR]

Examines the biochemical properties of the putative new profilm isoform by expressing both profilin 1 and profilin II in Escherichia coli. Comparison of interactions with actin; Isoform showing similar affinity for poly(L-proline) and PtdIns with similar effects on nucleotide exchange from actin.

Assesses a possible role of the two glycosylation sites wild-type and glycosylation-deficient (GLAST-1) expressed in Xenopus oocytes. Characterization of function by using the whole-cell voltage-clamp technique; Results proving that the N-glycosylation has no impact on the transport activity of GLAST-1.

Investigates the oxidized iron-compound ferredoxin from the thermophilic bacterium, Thermatoga maritima to characterize its hyperfine-shifted resonances originating from the cysteinyl cluster ligands. Analysis of the chemical shift and relaxation time pattern of the signals; Formation of at least two elements of secondary structure of the polypeptide chain.

Studies the expression and characterization of Geotrichum candidum (GC) lipase I gene. Sequence variation within the nitrogen-terminal 194 amino acids of the GC lipase; Comparison of the specificity profile with lipase II.

Presents a reinvestigation of the structure of the lantibiotic actagardine. Properties of lantibiotics; Biosynthetic pathway of lantibiotics consists in the ribosomal synthesis of a prepeptide; Dehydration of serine and threonine residues.

Five complex hopanoids have been detected in the purple non-sulfur bacterium Rhodopseudomonas acidophila. Next to the polyfunctionalized methylcyclopentane bacteriohopanetetrol ether already isolated from Methylo- bacterium organophilum, 3 5-carbamoylbacteriohopane-32 ,3 3,34-trio!, 34,3 5-dicarbamoyl bacteriohopane-3 2,33 - diol and two nucleoside analogues, (22R)-30-(5'-adenosyl)hopane and (223)-30-(5'-adenosyl)hopane were isolated and identified by spectroscopic and chemical methods. In Rhodopseudomonas palustris, however, only 3 5-amino- bacteriohopane-32,33,34-triol was detected. Chemical correlation between adenosyihopane and bacteriobopanetetrol, as well as comparison of derivatives obtained from bacterial and synthetic hopanoids, permitted the determination of the configurations of all asymmetric centres of the side-chain of bacteriohopanetetrol as 22R, 32R, 33R and 34S. According to the stereochemistry, this side-chain could be a D-ribose derivative linked through its C-5 carbon atom to the hopane skeleton. [ABSTRACT FROM AUTHOR]

We describe a rapid purification of protein kinase C from rat brain cytosol employing a specific substrate, protamine-coupled to agarose. Sequential chromatography on DEAE-Sephacel, phenyl-Sepharose CL-4B, and protamine-agarose columns resulted in a 1500-fold purification of protein kinase C. SDS-PAGE analysis of the purified enzyme resolved a doublet protein of 77–80 kDa. This doublet was recognized by a polyclonal antiserum against protein kinase C. Proteolytic digestion of each protein band generated similar peptide fragments. The underlying principle of the protamine sulfate purification method was also clarified. Protamine can serve as a Ca2+/phospholipid-independent substrate. We demonstrate phosphorylation of protamine on the column; phosphorylated protamine did not bind the enzyme with the same affinity and this covalent modification was most probably responsible for releasing the bound enzyme from the column after addition of Mg2+ and ATP. The C kinase inhibitor, H7, inhibits protamine phosphorylation in a dose-dependent fashion but does not prevent binding of the enzyme to a protamine-agarose column. We therefore conclude that protamine interacts with the active center of the enzyme enabling it to be phosphorylated, upon which it loses its binding affinity for C kinase. [ABSTRACT FROM AUTHOR]

Calmodulin contains several binding sites for hydrophobic compounds. The apparent specificity of various ‘calmodulin antagonists’ for these sites was investigated. The Ki values for the inhibition of calmodulin-activated cyclic-nucleotide phosphodiesterase and myosin light-chain kinase was determined. In addition, the Kd values of the same compounds for binding to calmodulin were measured. The compounds could be separated into four. groups. Group I and II compounds inhibited competitively the activation of the phosphodiesterase and myosin light-chain kinase by calmodulin. Group I compounds inhibited the activation of the phosphodiesterase and myosin light-chain kinase at identical concentrations. In contrast, group II compounds inhibited the activation of the phosphodiesterase at 5–10-fold lower concentrations than that of myosin light-chain kinase. Group III compounds inhibited the activation of these enzymes by an uncompetitive mechanism. Group IV compounds inhibited the activation of the phosphodiesterase with Ki values above 10 μM and did not affect the activation of myosin light-chain kinase. Binding of [3H]bepridil to calmodulin under equilibrium conditions yielded one high-affinity site (apparent Kd 0.4 μM) and four low affinity sites (apparent Kd 44 μM). Group I compounds interfered with the binding of bepridil to the high and low-affinity sites in a competitive manner. Group II compounds interfered in a non-competitive manner with the high-affinity site and apparently competed only with one of the low-affinity sites. Group III compounds did not compete with any of the bepridil-binding sites. Nimodipine, a group III compound, bound to one site on calmodulin with a Kd value of 1.1 μM. Other dihydropyridines competed with [3H]nimodipine for this site. The group I and II compounds, trifluoperazine and prenylamine, did not affect the binding of [3H]nimodipine. These data show that ‘calmodulin antagonists’ can be differentiated into at least three distinct groups. Kinetic and binding data suggest that the three groups bind to at least three different sites on calmodulin. Selective occupation of these sites may inhibit specifically the activation of distinct enzymes. [ABSTRACT FROM AUTHOR]

The sterols and sterol precursors of two amoebae of the genus Naegleria, Naegleria lovaniensis and Naegleria gruberi were investigated. Cycloartenol, the sterol precursor in photosynthetic organisms, is present in both amoebae. In N. lovaniensis, it is accompanied by lanosterol and parkeol, as well as by the 24,25-dihydro derivatives of these triterpenes. One of the most striking features of these amoebae is the accumulation of 4α-methylsterols which are present in similar amounts as those of 4,4-desmethylsterols (3–5 mg/g, dry weight). 4α-Methylergosta- 7,22-dienol was identified as a new compound. Ergosterol was the major 4,4-desmethylsterol, accompanied by small amounts of C27 and other C28 sterols. Treatment of N. lovaniensis with fenpropimorph modified the sterol pattern of this amoeba and inhibited its growth. This fungicide, known to inhibit steps of sterol biosynthesis in fungi and plants, induced the disappearance of 4α-methyl-Δ7-sterols and the appearance of the unusual Δ6,8,22-ergostatrienol as in A. polyphaga. These results might be explained by a partial inhibition of the Δ8 → Δ7 isomerase, the small amounts of Δ7-sterols formed being converted into ergosterol which is still present in fenpropimorph-exposed cells. De novo sterol biosynthesis in N. lovaniensis was shown by incorporation of [1-14C]acetate into sterols and sterol precursors, especially cycloartenol. Lanosterol and parkeol were not significantly labelled. Furthermore, [3-3H]squalene epoxide was efficiently cyclized by a cell-free system of this amoeba into cycloartenol, and again no significant radioactivity was detected in lanosterol and parkeol. This shows that cycloartenol, the sterol precursor in plants and algae, is also the sterol precursor in Naegleria species, and that these amoebae, like A. polyphaga, are related by some biosynthetic pathways to photosynthetic phyla. Lanosterol, the sterol precursor in non-photosynthetic phyla (animal and fungi) and parkeol are more likely dead-ends of this biosynthetic pathway. The peculiar phylogenetic position of these protozoa was further emphasized by the action of indole acetic acid and other auxine-like compounds on their growth. Indeed amoebic growth was enhanced in the presence of these higher plant growth hormones. The differences in the sterol composition of the protozoa we have hitherto examined is related to their sensitivity toward polyene macrolide antibiotics. The growth of A. polyphaga, containing mainly the C29 stigmasta-5,7,22-trienol was not affected by nystatin, and only slightly by amphotericin. Both antibiotics inhibited however the growth of the ergosterol-containing amoeba N. lovaniensis and trypanosome Crithidia fasciculata. [ABSTRACT FROM AUTHOR]

The hepatic subcellular distribution of apolipoprotein B (apo B) was studied quantitatively by using an enzyme immunoassay developed for apo B and by immunoadsorption-precipitation of [3H]leucine-labelled apo B. Over 50% (of 0.59 μg/ms protein) of the apo B was located in the microsomal fraction. Further subfractionation of the microsomes revealed that 47% of the microsomal apo B was in the Golgi apparatus, while another 43% was associated with the rough endoplasmic reticulum. The smooth endoplasmic reticulum accounted for only 4% of the total. When rat livers were labelled with [3H]leucine for 10 min, the rough endoplasmic reticulum accounted for 80% of the total immunoadsorbed precipitable apo B radioactivity while the smooth accounted for 20%, with no contribution from the Golgi However, only 8.7% of the total radioactive immunoadsorbed precipitable apo B was lipoprotein-associated, the remainder being membrane-bound. Lipoprotein-associated apo B radioactivity in the smooth endoplasmic reticulum accounted for 40%, with the rough contribution attributed at 50% and the Golgi at 9%. We concluded that (a) there are two major pools of apo B in rat liver microsomes; (b) although the apo B mass may be negligible in the smooth endoplasmic reticulum, the latter does play a role in lipoprotein biogenesis. The possible function of apo B associated with membranes of the microsomes is also discussed. [ABSTRACT FROM AUTHOR]

Changes in the concentration of several metabolites and enzymes related to carbohydrate metabolism were measured during the growth of Saccharomyces cerevisiae on a mineral medium containing glucose as the limiting nutrient. When about 50% of the original glucose was used the exponential phase ended and the culture entered a ‘transition’ phase before the complete exhaustion of glucose. In this transition phase several metabolic changes occurred. cAMP, that decreased along growth, reached a constant value of about 0.7 nmol/g dry weight. A pronounced drop in fructose-6-phosphate-2-kinase activity and in the concentration of fructose 2,6-bisphosphate and fructose 1,6-bisphosphate was observed accompanied by a less marked decrease in hexose monophosphates. Trehalase activity also dropped and reached a minimal value at the onset of the stationary phase when synthesis of trehalose began. Glycogen concentration and glycogen synthase activity increased sharply during the transition phase. Plasma membrane ATPase began to increase at the middle of the exponential phase and then, coincident with the glucose exhaustion, a 90% decrease in the measurable activity was observed. [ABSTRACT FROM AUTHOR]

The photosystem I (PSI) complex of Lemna gibba, isolated by deriphat/polyacrylamide gel electrophoresis of thylakoids solubilized in glycosidic surfactants, has been fractionated into its two chlorophyll-protein complexes: a core component (CCI) and a light-harvesting component (LHCI), using either non-denaturing gel electrophoresis or ion-exchange chromatography/sucrose gradient centrifugation. Both methods yielded an LHCI component that contained only one apoprotein of approximately 20 kDa. All the chlorophyll b and lutein of the PSI complex is associated with this LHCI preparation. The chlorophyg a/b ratio of this chlorophyll-protein is 2.5, and lutein is essentially the only carotenoid present. While the purified LHCI from Lemna cross-reacts with antibodies raised against spinach LHCPIb of Lam et al. [FEBS Lett. 168, 10–14 (1984)], no cross-reactivity occurred between it and the major light-harvesting chlorophyll-a/b-protein of PSII, LHCIIβ. This and a comparison of the amino acid and pigment compositions of the apoproteins of the LHCI and LHCIIβ chlorophyll-proteins indicate that these are two distinct but similar chlorophyll-proteins. [ABSTRACT FROM AUTHOR]

We have monitored the thermotropic behavior of mixed dimyristoylglycerophosphoserine (Myr2GroPSer)/dimyristoylglycerophosphocholine (Myr2GroPCho) and Myr2GroPSer/dipalmitoylglycerophosphocholine (Pam2GroPCho) vesicles in the presence of blood-clotting factor Va, using 1,6-diphenyl-1,3,5-hexatriene as a lipid probe. The Ca2+-independent interaction of factor Va with these vesicles caused a small increase (1-2&geg;C) in the phase transition temperature, regardless of whether Myr2GroPChe was the lower or higher-melting component of the mixed vesicles. The major effect of factor Va was to increase the polarization of diphenylhexatriene when the mixed vesicles were in the liquid crystalline phase. The protein did not change the anisotropy in the bilayer gel state. The increase in the polarization value above the transition temperature closely correlated with the amount of phospholipid-bound factor Va, as verified by a direct binding technique. In addition, we found that the affinity of factor Va for Myr2GroPSer/Myr2GroPCho and Myr2GroPSer/Pam2GroPCho greatly increased at temperatures above the transition temperatures. Time-dependent fluorescence anisotropy measurements of diphenylhexatriene embedded in vesicles in the liquid crystalline state give fluorescence decay curves which can best be fitted by two exponential functions with two rotational correlation times and a constant term. Vesicles composed of Myr2GroPSer exhibit more ordering than Myr2GroPCho vesicles. However, the order parameter of mixed vesicles composed of 40% Myr2GroPSer and 60% Myr2GroPCho (mol/mol) approached that of Myr2GroPCho. Factor Va dramatically increased the longer rotational correlation time of diphenylhexatriene embedded in mixed vesicles in the liquid crystalline state from 3.7 ns to about 17 ns. The second rank-order parameter increased only slightly, but the calculated steady-state auisotropy increased by twofold. These results indicate that the acidic phospholipid-dependent binding of factor Va to mixed vesicles has an ordering effect on the acyl chains of the acidic phospholipids in the outer layer, but leaves the bulk of the phospholipids, mainly phosphatidylcholine, unaltered. None of the factor-Va-induced alterations in the anisotropy parameters point to the occurrence of lateral phase separation. [ABSTRACT FROM AUTHOR]

The nucleotide sequence of an endolytic cellulase gene of Bacillus subtilis was determined and compared with the NH2-terminal amino acid sequence of the purified enzyme. The mature protein appeared to be extended by a signal sequence of 36 amino acids. The putative AUG initiation codon was preceded by a σ43-type promoter of B. subtilis and an AAGGAGG sequence, typical of procaryofic ribosomal binding sites. Partial homology of amino acid sequences was found between B. subtilis cellulase and an alkalophilic Bacillus cellulase. [ABSTRACT FROM AUTHOR]

A specific ribonuclease was detected and purified to homogeneity from six-day-old larvae of the insect Ceratitis capitata and its homogeneity was checked by analysis in polyacrylamide gels in the presence of sodium dodecyl sulfate. The nuclease specifically degrades poly(U) and poly(C) whilst it fails to do so with other single-stranded homopolyrihonucleotides. The enzyme has a pH optimum in the region 7–9 and relative molecular mass of about 25000. The effect of this ribonuclease on the integrity of RNAs isolated from six-day-old larvae or rat liver was also studied. [ABSTRACT FROM AUTHOR]

Hyoscyamine 6β-hydroxylase, a 2-oxoglutarate-dependent dioxygenase that catalyzes the hydroxylation of l-hyoscyamine to 6β-hydroxyhyoscyamine in the biosynthetic pathway leading to scopolamine [Hashimoto, T. & Yamada, Y, (1986) Plant Physiol. 81, 619–625] was purified 310-fold from root cultures of Hyoscyamus niger L. The enzyme has an average Mr of 4l000 as determined by gel filtration on Superose 12 and exhibited maximum activity at pH 7.8. l-Hyoscyamine and 2-oxoglutarate are required for the enzyme activity, with respective Km values of 35 μM and 43 μM. Fe2+, catalase and a reductant such as ascorbate significantly activated the enzyme. 2-Oxoglutarate was not replaced by any of ten other oxo acids tested, nor was Fe2+ by nine other divalent cations tested. The enzyme was inhibited moderately by EDTA, Tiron and various oxo acids and aliphatic dicarboxylic adds, and strongly by nitroblue tetrazolium and divalent cations Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Hg2+. Several pyridine dicarboxylates and o-dihydroxyphenyl derivatives inhibited the hydroxylase. Pyridine 2,4-dicarboxylate and 3,4-dihydroxybenzoate are competitive inhibitors with respect to 2-oxoglutarate with the respective Ki values of 9 μM and 90 μM. Several alkaloids with structures similar to l-hyoscyamine were hydroxylated by the enzyme at the C-6 position of the tropane moiety. The enzyme preparation also epoxidized 6,7-dehydrohyoscyamine, a hypothetical precursor of scopolamine, to scopolamine (Km 10 μM). This epoxidation reaction required the same co-factors as the hydroxylation reaction and the epoxidase activities were found in the same fractions with the hydroxylase activities during purification. Two possible pathways for scopolamine biosynthesis are discussed in the light of the hydroxylase and epoxidase activities found in the partially purified preparation of hyoscyamine 6β-hydroxylase. [ABSTRACT FROM AUTHOR]

The Helical structures of d(C-G-C-A-m5C-G-T-G-mSC-G), d(m5C-G-C-A-m5C-G-T-G-C-G) and d(C- 2aminoA-C-G-T-G) were studied in aqueous solution at various salt concentrations and temperatures by 1H-NMR spectroscopy. In 0.1 M NaCl solution only the B form was evidenced for these DNA fragments whereas in 4 M NaCI both B and Z forms, in slow exchange on the NMR time scale, were observed. Under these conditions the Z form accounted for less than 60% of the decamer conformation; conversely d(C-G)3 hexamers containing methylated cytidines were predominantly in the Z form (> 90%) [Tran-Dinh et al. (1984) Biochemistry 23, 1362: Cavailles et al. (1984) J. Biomol. Struct. Dyn. I. 1347–1371]. On the other hand, d(C-2aminoA-C-G-T-G) in which the d(2ammoA) · dT base pair forms three hydrogen bonds, was found to adopt the Z conformation in 4M NaCI solution which was not the case for d(C-A-C-G-T-G) (unpublished results). The present study shows that the B ⇄ Z transition in solution is highly sequence-dependent and that correlation exists between the stability of the duplexes (essentially governed by the number of hydrogen bonds between complementary bases) and their ability to adopt the Z conformation. [ABSTRACT FROM AUTHOR]