Search

Abstract: The interactions between proteins and ligands often involve a conformational change in the protein. This conformational change can occur before (conformational selection) or after (induced fit) the association with ligand. It is often very difficult to distinguish induced fit from conformational selection when hyperbolic binding kinetics are observed. In light of a recent paper in this journal (Vogt et al., Biophys. Chem., 186, 2014, 13-21) and the current interest in binding mechanisms emerging from observed sampling of distinct conformations in protein domains, as well as from the field of intrinsically disordered proteins, we here describe a kinetic method that, at least in some cases, unequivocally distinguishes induced fit from conformational selection. The method relies on measuring the observed rate constant λ for binding and varying both the protein and the ligand in separate experiments. Whereas induced fit always yields a hyperbolic dependence of increasing λ values, the conformational selection mechanism gives rise to distinct kinetics when the ligand and protein (displaying the conformational change) concentration is varied in separate experiments. We provide examples from the literature and discuss the limitations of the approach. [Copyright &y& Elsevier]

Abstract: The fact that we observe a single conformational selection event during binding does not necessarily mean that only a single conformational selection event takes place, even though this is the common assumption. Here we suggest that conformational selection takes place not once in a given binding/allosteric event, but at every step along the allosteric pathway. This view generalizes conformational selection and makes it applicable also to other allosteric events, such as post-translational modifications (PTMs) and photon absorption. Similar to binding, at each step along a propagation pathway, conformational selection is coupled with induced fit which optimizes the interactions. Thus, as in binding, the allosteric effects induced by PTMs and light relate not only to population shift; but to conformational selection as well. Conformational selection and population shift take place conjointly. [Copyright &y& Elsevier]

Abstract: Two competing and mutually exclusive mechanisms of ligand recognition – conformational selection and induced fit – have dominated our interpretation of ligand binding in biological macromolecules for almost six decades. Conformational selection posits the pre-existence of multiple conformations of the macromolecule from which the ligand selects the optimal one. Induced fit, on the other hand, postulates the existence of conformational rearrangements of the original conformation into an optimal one that are induced by binding of the ligand. In the former case, conformational transitions precede the binding event; in the latter, conformational changes follow the binding step. Kineticists have used a facile criterion to distinguish between the two mechanisms based on the dependence of the rate of relaxation to equilibrium, k obs, on the ligand concentration, [L]. A value of k obs decreasing hyperbolically with [L] has been seen as diagnostic of conformational selection, while a value of k obs increasing hyperbolically with [L] has been considered diagnostic of induced fit. However, this simple conclusion is only valid under the rather unrealistic assumption of conformational transitions being much slower than binding and dissociation events. In general, induced fit only produces values of k obs that increase with [L] but conformational selection is more versatile and is associated with values of k obs that increase with, decrease with or are independent of [L]. The richer repertoire of kinetic properties of conformational selection applies to kinetic mechanisms with single or multiple saturable relaxations and explains the behavior of nearly all experimental systems reported in the literature thus far. Conformational selection is always sufficient and often necessary to account for the relaxation kinetics of ligand binding to a biological macromolecule and is therefore an essential component of any binding mechanism. On the other hand, induced fit is never necessary and only sufficient in a few cases. Therefore, the long assumed importance and preponderance of induced fit as a mechanism of ligand binding should be reconsidered. [Copyright &y& Elsevier]

Abstract: The binding of ligands and substrates to proteins has been extensively studied for many years and can be described, in its simplest form, by two limiting mechanisms: conformational selection and induced fit. Conformational selection involves the binding of ligand to a pre-existing sparsely-populated conformation of the free protein that is the same as that in the final protein–ligand complex. In the case of induced fit, the ligand binds to the major conformation of the free protein and only subsequent to binding undergoes a conformational change to the final protein–ligand complex. While these two mechanisms can be dissected and distinguished by transient kinetic measurements, direct direction, characterization and visualization of transient, sparsely-populated states of proteins are experimentally challenging. Unless trapped, sparsely-populated states are generally invisible to conventional structural and biophysical techniques, including crystallography and most NMR measurements. In this review we summarize some recent developments in the use of paramagnetic relaxation enhancement to directly study sparsely-populated states of proteins and illustrate the application of this approach to two proteins, maltose binding protein and calmodulin, both of which undergo large rigid body conformational rearrangements upon ligand binding from an open apo state to a closed ligand-bound holo state. We show that the apo state ensemble comprises a small population of partially-closed configurations that are similar but not identical to that of the holo state. These results highlight the complementarity and interplay of induced fit and conformational selection and suggest that the existence of partially-closed states in the absence of ligand facilitates the transition to the closed ligand-bound state. [Copyright &y& Elsevier]

Abstract: Biomolecular interactions regulate a plethora of vital cellular processes, including signal transduction, metabolism, catalysis and gene regulation. Regulation is encoded in the molecular properties of the constituent proteins; distinct conformations correspond to different functional outcomes. To describe the molecular basis of this behavior, two main mechanisms have been advanced: ‘induced fit’ and ‘conformational selection’. Our understanding of these models relies primarily on NMR, computational studies and kinetic measurements. These techniques report the average behavior of a large ensemble of unsynchronized molecules, often masking intrinsic dynamic behavior of proteins and biologically significant transient intermediates. Single molecule measurements are emerging as a powerful tool for characterizing protein function. They offer the direct observation and quantification of the activity, abundance and lifetime of multiple states and transient intermediates in the energy landscape, that are typically averaged out in non-synchronized ensemble measurements. Here we survey new insights from single molecule studies that advance our understanding of the molecular mechanisms underlying biomolecular recognition. [Copyright &y& Elsevier]

Abstract: Allostery, the modulation of function of a protein at one site by the binding of a ligand at a different site, is a property of many proteins. Two kinetically distinct models have been proposed: i) The induced fit model in which the ligand binds to the protein and then induces the conformational change. ii) The population selection model, in which the protein spontaneously undergoes a conformational change, which is then ‘captured’ by the ligand. Using measured kinetic constants for the lac repressor the contribution of population selection vs. induced dissociation is quantified by simulating the kinetics of allostery. At very low inducer concentration, both mechanisms contribute significantly. Total induction, though, is small under these conditions. At increasing levels of induction the induced dissociation mechanism soon dominates, first due to binding of one inducer, and then from two inducers binding. [Copyright &y& Elsevier]

Abstract: The thermal stability and ligand binding properties of the l-argininamide-binding DNA aptamer (5′–GATCGAAACGTAGCGCCTTCGATC–3′) were studied by spectroscopic and calorimetric methods. Differential calorimetric studies showed that the uncomplexed aptamer melted in a two-state reaction with a melting temperature T m =50.2±0.2 °C and a folding enthalpy ΔH°fold =−49.0±2.1 kcal mol−1. These values agree with values of T m =49.6 °C and ΔH°fold =−51.2 kcal mol−1 predicted for a simple hairpin structure. Melting of the uncomplexed aptamer was dependent upon salt concentration, but independent of strand concentration. The T m of aptamer melting was found to increase as l-argininamide concentrations increased. Analysis of circular dichroism titration data using a single-site binding model resulted in the determination of a binding free energy ΔG°bind =−5.1 kcal mol−1. Isothermal titration calorimetry studies revealed an exothermic binding reaction with ΔH°bind =−8.7 kcal mol−1. Combination of enthalpy and free energy produce an unfavorable entropy of − TΔS°=+3.6 kcal mol−1. A molar heat capacity change of −116 cal mol−1 K−1 was determined from calorimetric measurements at four temperatures over the range of 15–40 °C. Molecular dynamics simulations were used to explore the structures of the unligated and ligated aptamer structures. From the calculated changes in solvent accessible surface areas of these structures a molar heat capacity change of −125 cal mol−1 K−1 was calculated, a value in excellent agreement with the experimental value. The thermodynamic signature, along with the coupled CD spectral changes, suggest that the binding of l-argininamide to its DNA aptamer is an induced-fit process in which the binding of the ligand is thermodynamically coupled to a conformational ordering of the nucleic acid. [Copyright &y& Elsevier]