Energetic basis of molecular recognition in a DNA aptamer

Abstract: The thermal stability and ligand binding properties of the l-argininamide-binding DNA aptamer (5′–GATCGAAACGTAGCGCCTTCGATC–3′) were studied by spectroscopic and calorimetric methods. Differential calorimetric studies showed that the uncomplexed aptamer melted in a two-state reaction with a melting temperature T m =50.2±0.2 °C and a folding enthalpy ΔH°fold =−49.0±2.1 kcal mol−1. These values agree with values of T m =49.6 °C and ΔH°fold =−51.2 kcal mol−1 predicted for a simple hairpin structure. Melting of the uncomplexed aptamer was dependent upon salt concentration, but independent of strand concentration. The T m of aptamer melting was found to increase as l-argininamide concentrations increased. Analysis of circular dichroism titration data using a single-site binding model resulted in the determination of a binding free energy ΔG°bind =−5.1 kcal mol−1. Isothermal titration calorimetry studies revealed an exothermic binding reaction with ΔH°bind =−8.7 kcal mol−1. Combination of enthalpy and free energy produce an unfavorable entropy of − TΔS°=+3.6 kcal mol−1. A molar heat capacity change of −116 cal mol−1 K−1 was determined from calorimetric measurements at four temperatures over the range of 15–40 °C. Molecular dynamics simulations were used to explore the structures of the unligated and ligated aptamer structures. From the calculated changes in solvent accessible surface areas of these structures a molar heat capacity change of −125 cal mol−1 K−1 was calculated, a value in excellent agreement with the experimental value. The thermodynamic signature, along with the coupled CD spectral changes, suggest that the binding of l-argininamide to its DNA aptamer is an induced-fit process in which the binding of the ligand is thermodynamically coupled to a conformational ordering of the nucleic acid. [Copyright &y& Elsevier]