Search

In this work, double- and single-stranded small-interference RNAs (siRNAs) were designed to knock down the bcr/abl oncogene in leukaemia KYO-1 cells. The siRNA molecules were targeted against two distinct sites encompassing the b2a2 junction of the bcr/abl transcripts. The siRNAs were able to reduce the levels of both bcr/abl mRNA and protein p210(BCR/ABL). Conversely, control siRNAs bearing 3 or 4 base-pair substitutions did not produce any inhibitory effect. The designed siRNAs were also found to be active in KCl22 cells, which harbor the b2a2 junction, but not in K562 cells, which, by contrast, harbor the b3a2 junction. The anti-b2a2 siRNAs promoted biological effects on KYO-1 cells, because the bcr/abl suppression resulted in the inhibition of cell growth and colony formation in agar and activation of apoptosis and upregulation of the cell-cycle inhibitor p27 protein. The bioactivity of the designed siRNAs is discussed in terms of internal stability of the RNA duplexes. Our data suggest that siRNAs can be considered strong tools for functional analysis of bcr/abl and for developing molecular therapeutic approaches to leukaemia.

Triplex-forming oligonucleotides are able to modulate gene expression by site-specific binding to genomic DNA. Their use as therapeutic agents is limited by inefficient cellular uptake, scarce nuclear internalization, and oligonucleotide self-aggregation. In this study, we demonstrate that a 13-mer AG motif oligonucleotide covalently linked to a high-molecular mass (9000 Da) polyethylene glycol (PEG ODN(13)) exhibits uptake and biological properties that are superior to those of the nonconjugated isosequence analogue (free ODN(13)). Band-shift and footprinting experiments showed that PEG ODN(13) forms a stable triple helix (apparent K(d) between 10(-6) and 10(-7) M in 50 mM Tris-acetate, 10 mM MgCl(2), pH 7.4, 37 degrees C) with a natural polypurine-polypyrimidine target located in the 5' flanking region of the human bcr/abl oncogene. Confocal laser microscopy performed on unfixed live cells stained with hexidium iodide as well as on glass-fixed cells stained with propidium iodide showed that fluorescein-labeled PEG ODN(13) is far more efficiently taken up and internalized in the nucleus by K562 and HeLa cells than the nonconjugated free ODN(13). It was found that PEG ODN(13) specifically downregulated the transcription of bcr/abl mRNA at 65 +/- 5% with respect to control and inhibited cell growth by 32 +/- 3% in a 3 day liquid culture assay. Moreover, PEG ODN(13) was more resistant against S1 and fetal bovine serum nucleases than free ODN(13), and less inclined to self-associate into multistrand structures in solution. Taken together, these results provide useful elements for designing artificial transcription repressors with enhanced potency in vivo.

The promoter of the murine c-Ki-ras proto-oncogene contains a critical homopurine-homopyrimidine sequence which is recognized by a protein factor and is a potential site for triplex-forming oligonucleotides (TFOs). The TFOs designed to bind this critical c-Ki-ras target have either an AG or a GT sequence motif. Of the two types, the first is found to form triplexes with extraordinarily high stability. For instance, both d(AGGGAGGGAGGAAGGGAGGG) (20AG) and d(GGGAGGGAGGGAAGGAGGGAGGGAGGGAGC) (30AG) are able to bind the c-Ki-ras target at 65 degrees C and to resist a polyacrylamide gel temperature of 55 degrees C. By contrast, the triplex formed by d(TGGGTGGGTGGTTGGGTGGG) (20GT) is largely dissociated at a gel temperature of 55 degrees C. The affinity constants of the TFOs at 37 degrees C, 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 5 mM MgCl2 (standard buffer) were determined through band-shift experiments and found to be respectively 1.0 x 10(6), 4.0 x 10(6), and 2.5 x 10(7) M-1 for 20GT, 30AG, and 20AG. The AG-triplexes exhibit in standard buffer monophasic melting profiles (Tm approximately 75 degrees C) and circular dichoroism spectra showing the typical negative ellipticity at 212 nm, which is a hallmark for triplex DNA. The rate at which the TFOs bind to the c-Ki-ras target at 37 degrees C was examined under pseudo-first-order conditions. When the TFOs are in excess over the target and in the micromolar concentration range, the kinetics of triplex formation are slow, characterized by association half-lives of about 1 h. The ability of the TFOs to act as artificial transcription repressors was examined in a cellular system employing transient transfection experiments. Cultured NIH 3T3 fibroblast cells were cotransfected with a DNA mixture composed by a TFO and plasmid pKRS-413 containing the chloramphenicol acetyltransferase (CAT) gene driven by the c-Ki-ras promoter. It was found that the CAT activity is specifically inhibited by the TFOs in a dose-dependent manner. As expected, stronger CAT repression is obtained with 20AG, the oligonucleotide which forms the more stable triplex. These data suggest that (A,G)-oligonucleotides may provide a valuable means for the selective repression of the c-Ki-ras gene expression.

Mutations in the Kirsten ras (KRAS) gene are present in almost all pancreatic adenocarcinomas, and one common mutation is at codon 12: GGT (Gly) is transformed into GAT (Asp). In this work we have targeted the KRAS coding sequence embracing the GAT mutation with a sense PNA molecule (P14), with the aim of downregulating the expression of the mutant allele. P14 was designed with a 15-base sequence complementary to the antisense strand of KRAS at the GAT (Asp) mutation and conjugated to the nuclear localization signal peptide PKKKRKV. CD spectra as a function of temperature show that P14 (2 microM) binds to the antisense strand of the GAT target in the mutated allele with a T(M) of 78 degrees C and to the antisense strand of the GGT target in the wild-type allele with a T(M) of 69 degrees C, in 50 mM Tris-HCl, pH 7.4, and 1 M NaCl. Moreover, P14 showed a high capacity to enter and accumulate in the nuclei of pancreatic cells (Panc-1 and BxPC3), whereas the nonconjugated analogue did not. Quantitative RT-PCR showed that 1 microM P14 was able to specifically suppress KRAS transcription in Panc-1 cells, which harbor mutant KRAS, but not in BxPC3 cells, which contain only wild-type KRAS. However, P14 inhibited KRAS transcription also in BxPC3 cells when used at concentrations of 5 and 10 microM. Following a single PNA treatment, changes in protein level were evident only in Panc-1 cells. As we found that all three genes of the ras family are expressed in the pancreatic cells, we designed PNA-NLS conjugates (P16 and P17) to target also HRAS and NRAS. The binding of each PNA conjugate to the ras genes was assayed by electrophoresis, and their capacity to inhibit transcription was measured by RT-PCR. All of the data obtained, both in vivo and in vitro, are discussed in terms of sequence specificity in the binding between PNA-NLS molecules and genomic DNA.

The murine Ki-ras promoter contains a unique polypurine--polypyrimidine [poly(R.Y)] sequence between -290 and -320 from the 3' boundary of exon phi. Previously we demonstrated triplex formation and transcription inhibition promoted by GT and AG oligonucleotides directed against this site [Alunni-Fabbroni et al. (1996) Biochemistry 35, 16361--16369]. In this work, we have investigated triplex formation and anti-gene activity of five 20-mer AG motif triplex-forming oligonucleotides specific for the Ki-ras poly(R.Y) target, derived from 5'-AGGGAGGGAGGAAGGGAGGG (20AG) by replacing an increasing number of phosphodiester linkages with phosphorothioate linkages (S(i)-20AG; i = 2, 3, 4, 5, 19). Electrophoretic mobility-shift experiments (EMSA) showed that four thioate oligonucleotides, S(i)-20AG (i = 2, 3, 4, 5), recognized the Ki-ras target and exhibited dissociation constants similar to that of 20AG: K(d) = 12 +/- 2 nM, while the all-thioate S(19)-20AG exhibited a K(d) of 128 +/- 15 nM. Moreover, the binding between the Ki-ras promoter and oligonucleotides S(i)-20AG (i = 2, 3, 4, 5, 19) was characterized by DMS/piperidine and DNase I footprinting experiments. We observed that the introduction in the phosphodiester oligonucleotide 20AG of sulfur atoms reduced its aggregation significantly and increased its nuclease resistance. Transient transfection experiments using preformed triplexes with a recombinant plasmid containing the reporter chloramphenicol acetyltransferase (CAT) gene under the control of Ki-ras promoter showed that oligonucleotides S(i)-20AG (i = 2, 3, 4, 5, 19) promote a strong inhibition of up to 75% of the CAT expression when compared with control Ki-ras unspecific oligonucleotides. Taken together, these data provide a guideline for designing triplex-forming effector molecules capable of controlling Ki-ras expression in vivo.

The secondary structures of the synthetic DNA fragments d(CGCGCGTTTTTCGCGCG) (T5), d(CGCGCGAAAAACGCGCG) (A5), d(CGCGCGTACGCGCG) (TA), and d(CGCGCGATCGCGCG) (AT) were investigated in a combined electrophoretic and spectroscopic study. All the oligomers exist, at low temperature and over a wide range of ionic strength (0.5-100 mM salt) and of nucleotide concentration [0.1-2.0 mM (phosphate)], as a mixture of two slowly interconverting species, identified as the dimeric duplex and the monomeric hairpin structure. The thermodynamic parameters for hairpin denaturation of T5, A5, TA, and AT and for duplex denaturation of d(CGCGCG) show that (a) the hairpins are more stable than the reference hexamer duplex at all accessible nucleotide concentrations; (b) the loop contributes favorably to the enthalpy change of hairpin denaturation in the four DNA fragments; (c) the base composition of the loop (A vs T) and the size of the loop (A5/T5 vs TA/AT) do not appreciably influence the enthalpic contents of the hairpins; (d) hairpins TA and AT, with two AT bases intervening in the CG self-complementary part of the molecule, exhibit a markedly higher thermal stability than hairpins T5 and A5, which is entropic in origin. These findings are consistent with the presence of two-residue loops in the tetradecamers TA and AT.