Search

Abstract Liver sinusoidal endothelial cells (LSECs) play a pivotal role in maintaining liver homeostasis and influencing the pathological processes of various liver diseases. However, neither LSEC-specific hallmark genes nor a LSEC promoter-driven Cre mouse line has been introduced before, which largely restricts the study of liver diseases with vascular disorders. To explore LSEC-specific hallmark genes, we compared the top 50 marker genes between liver endothelial cells (ECs) and liver capillary ECs and identified 18 overlapping genes. After excluding globally expressed genes and those with low expression percentages, we narrowed our focus to two final candidates: Oit3 and Dnase1l3. Through single-cell RNA sequencing (scRNA-seq) and analysis of the NCBI database, we confirmed the extrahepatic expression of Dnase1l3. The paired-cell sequencing data further demonstrated that Oit3 was predominantly expressed in the midlobular liver ECs. Subsequently, we constructed inducible Oit3-CreERT2 transgenic mice, which were further crossed with ROSA26-tdTomato mice. Microscopy validated that the established Oit3-CreERT2-tdTomato mice exhibited significant fluorescence in the liver rather than in other organs. The staining analysis confirmed the colocalization of tdTomato and EC markers. Ex-vivo experiments further confirmed that isolated tdTomato+ cells exhibited well-differentiated fenestrae and highly expressed EC markers, confirming their identity as LSECs. Overall, Oit3 is a promising hallmark gene for tracing LSECs. The establishment of Oit3-CreERT2-tdTomato mice provides a valuable model for studying the complexities of LSECs in liver diseases.

Photosynthesis occurs mainly in chloroplasts, whose development is regulated by proteins encoded by nuclear genes. Among them, pentapeptide repeat (PPR) proteins participate in organelle RNA editing. Although there are more than 450 members of the PPR protein family in rice, only a few affect RNA editing in rice chloroplasts. Gene editing technology has created new rice germplasm and mutants, which could be used for rice breeding and gene function study. This study evaluated the functions of OsPPR9 in chloroplast RNA editing in rice. The osppr9 mutants were obtained by CRISPR/Cas9, which showed yellowing leaves and a lethal phenotype, with suppressed expression of genes associated with chloroplast development and accumulation of photosynthetic-related proteins. In addition, loss of OsPPR9 protein function reduces the editing efficiency of rps8-C182, rpoC2-C4106, rps14-C80, and ndhB-C611 RNA editing sites, which affects chloroplast growth and development in rice. Our data showed that OsPPR9 is highly expressed in rice leaves and encodes a DYW-PPR protein localized in chloroplasts. Besides, the OsPPR9 protein was shown to interact with OsMORF2 and OsMORF9. Together, our findings provide insights into the role of the PPR protein in regulating chloroplast development in rice.

Abstract Cellular senescence plays a pivotal role in wound healing. At the initiation of liver fibrosis regression, accumulated senescent cells were detected and genes of senescence were upregulated. Flow cytometry combined with single‐cell RNA sequencing analyses revealed that most of senescent cells were liver nonparenchymal cells. Removing senescent cells by dasatinib and quercetin (DQ), alleviated hepatic cellular senescence, impeded fibrosis regression, and disrupted liver sinusoids. Clearance of senescent cells not only decreased senescent macrophages but also shrank the proportion of anti‐inflammatory M2 macrophages through apoptotic pathway. Subsequently, macrophages were depleted by clodronate, which diminished hepatic senescent cells and impaired fibrosis regression. Mechanistically, the change of the epigenetic regulator enhancer of zeste homolog2 (EZH2) accompanied with the emergence of hepatic senescent cells while liver fibrosis regressed. Blocking EZH2 signaling by EPZ6438 reduced hepatic senescent cells and macrophages, decelerating liver fibrosis regression. Moreover, the promoter region of EZH2 was transcriptionally suppressed by Notch‐Hes1 (hairy and enhancer of split 1) signaling. Disruption of Notch in macrophages using Lyz2 (lysozyme 2) Cre‐RBP‐J (recombination signal binding protein Jκ) f/f transgenic mice, enhanced hepatic cellular senescence, and facilitated fibrosis regression by upregulating EZH2 and blocking EZH2 abrogated the above effects caused by Notch deficiency. Ultimately, adopting Notch inhibitor Ly3039478 or exosome‐mediated RBP‐J decoy oligodeoxynucleotides accelerated liver fibrosis regression by augmenting hepatic cellular senescence.

Research has shown that long-chain noncoding RNAs (lncRNAs) are involved in the regulation of a variety of biological processes, including peripheral nerve regeneration, in part by acting as competing endogenous RNAs. c-Jun plays a key role in the repair of peripheral nerve injury. However, the precise underlying mechanism of c-Jun remains unclear. In this study, we performed microarray and bioinformatics analysis of mouse crush-injured sciatic nerves and found that the lncRNA Pvt1 was overexpressed in Schwann cells after peripheral nerve injury. Mechanistic studies revealed that Pvt1 increased c-Jun expression through sponging miRNA-214. We overexpressed Pvt1 in Schwann cells cultured in vitro and found that the proliferation and migration of Schwann cells were enhanced, and overexpression of miRNA-214 counteracted the effects of Pvt1 overexpression on Schwann cell proliferation and migration. We conducted in vivo analyses and injected Schwann cells overexpressing Pvt1 into injured sciatic nerves of mice. Schwann cells overexpressing Pvt1 enhanced the regeneration of injured sciatic nerves following peripheral nerve injury and the locomotor function of mice was improved. Our findings reveal the role of lncRNAs in the repair of peripheral nerve injury and highlight lncRNA Pvt1 as a novel potential treatment target for peripheral nerve injury.

Cuticular wax covers the surface of the apple epidermis and plays an important role in water loss and pathogen resistance. However, little is known about wax biosynthesis during apple fruit development. In this study, the morphological structure and chemical composition of wax and the transcription patterns of wax-related genes were investigated in the 'Red Delicious' and 'Golden Delicious' cultivars. The results showed that accumulation of the waxy layer was synchronized with enlargement and maturation of fruit. The crystal structure, major chemical components (very long chain fatty acids and triterpenes) of wax and the expression levels of wax-related genes varied significantly 90 days after flowering (DAF), indicating that the critical period for biosynthesis of cuticular wax was about 90 DAF. This finding is valuable for further study of the regulatory mechanism of wax biosynthesis at both the molecular and physiological levels.

Abstract Bimetallic nanomaterials, which exhibit a combination of the properties associated with two different metals, have enabled innovative applications in nanoscience and nanotechnology. Here, we introduce the fabrication of dendritic Au/Ag bimetallic nanostructures for surface-enhanced Raman scattering (SERS) and catalytic applications. The dendritic Au/Ag bimetallic nanostructures were prepared by combining the electrochemical deposition and replacement reaction. The formation of Au nanoparticle shell on the surface of Ag dendrites greatly improves the stability of dendritic nanostructures, followed by a significant SERS enhancement. In addition, these dendritic Au/Ag bimetallic nanostructures are extremely efficient in degrading 4-nitrophenol (4-NP) compared with the initial dendritic Ag nanostructures. These experimental results indicate the great potential of the dendritic Au/Ag bimetallic nanostructures for the development of excellent SERS substrate and highly efficient catalysts.

Abstract. Background:. Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. Methods:. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. Results:. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each

Abstract Highly branched metallic nanostructures, which possess a large amount of catalyst active sites and surface-enhanced Raman scattering (SERS) hot spots owing to their large surface areas, multi-level branches, corners, and edges, have shown potential in various applications including catalysis and SERS. In this study, well-defined dendritic silver (Ag) nanostructures were prepared by a facile and controllable electrochemical deposition strategy. The morphology of Ag nanostructures is controlled by regulating electrodeposition time and concentration of AgNO3 in the electrolyte solution. Compared to conventional Ag nanoparticle films, dendritic Ag nanostructures exhibited larger SERS enhancement ascribed to the numerous hot spots exist in the nanogaps of parallel and vertically stacked multilayer Ag dendrites. In addition, the prepared dendritic Ag nanostructures show 3.2-fold higher catalytic activity towards the reduction of 4-nitrophenol (4-NP) by NaBH4 than the Ag nanoparticle films. The results indicate that the dendritic Ag nanostructures represent a unique bifunctional nanostructure that serves as both efficient catalysts and excellent SERS substrates, which may be further employed as a nanoreactor for in situ investigation and real-time monitoring of catalytic reactions by SERS technique.

Objectives The survival benefit of postmastectomy radiotherapy (PMRT) has not been fully proven in inflammatory breast cancer (IBC). Thus, in the present research, we aimed at elucidating the effects of PMRT on the survival of IBC patients. Methods Eligible patients were collected from the Surveillance, Epidemiology, and End Results (SEER) dataset between 2010 and 2013. The Kaplan-Meier method along with the log-rank test was utilized for the comparison of both the overall survival (OS) andthe cancer-specific survival (CSS) in patients undergoing PMRT or not. Additionally, multivariate survival analysis of CSS and OS were performed using the Cox proportional hazard model. Results In total, 293 eligible cases were identified, with the median follow-up time of 27 months (range: 5–59 months). After propensity score matching (PSM), 188 patients (94 for each) were classified intothe No-PMRT and the PMRT group. Consequently, significantly higher OS rates were detected in the PMRT group compared with the No-PMRT group prior to PSM (P = 0.034), and significantly higher CSS (P = 0.013) and OS (P = 0.0063) rates were observed following PSM. Furthermore, multivariate analysis revealed thatPMRT [CSS (HR: 0.519, 95% CI [0.287–0.939], P = 0.030); OS (HR: 0.480, 95% CI [0.269–0.859], P = 0.013)], as well as Her2+/HR+ subtype, was independent favorable prognostic factors.Besides, black ethnicity, AJCC stage IV and triple-negative subtype were independent unfavorable prognostic factors. Further subgroup analysis revealed that most of the study population could benefit from PMRT, no matter OS or CSS. Conclusions Our findings support that PMRT could improve the survival of IBC patients.

Objective The study was designed to construct and validate a nomogram for predicting overall survival (OS) of male breast cancer (MBC) patients with infiltrating duct carcinoma (IDC). Methods The cohort was selected from the Surveillance, Epidemiology, and End Results (SEER) database between January 1, 2004 and December 31, 2013. Univariate and multivariate Cox proportional hazard (PH) regression models were performed. A nomogram was developed based on the significant prognostic indicators of OS. The discriminatory and predictive capacities of nomogram were assessed by Harrell’s concordance index (C-index), calibration plots, area under the curve (AUC) and the decision curve analysis (DCA). Results The median and maximal survival time of 1862 eligible patients were 49 and 131 months, respectively. Multivariate analysis showed that age (P

Background This study was designed to investigate the clinicopathological characteristics, treatment and survival of patients with pulmonary large cell neuroendocrine carcinoma (LCNEC). Methods The Surveillance, Epidemiology and End Results database was utilized to identify patients diagnosed with pulmonary LCNEC between 2004 and 2013. Kaplan–Meier analysis was conducted to determine the overall survival (OS) and cancer-specific survival (CSS) rate. Univariate survival analysis along with log-rank test, and Cox proportional hazards model were employed to detect independent prognostic factors. Results Pulmonary LCNEC accounted for 0.58% (2972/510607) of the total number of lung and bronchus carcinoma. And a total of 1,530 eligible cases were identified, with the median follow-up time of 11 months. To be specific, the 3-, 5-year OS and CSS rates were 22.8%, 16.8% and 26.5%, 20.8% respectively. Generally, pulmonary LCNEC was commonly detected in the elderly (72.2%), males (55.9%), the upper lobe (62.0%) and advanced AJCC stage (65.5%). Multivariate analysis revealed that elderly [(≥60 and

Nineteen new quinoline derivatives were prepared via the Mannich reaction and evaluated for their antibacterial activities against both Gram-positive (G+) and Gram-negative (G−) bacteria, taking compound 1 as the lead. Among the target compounds, quinolone coupled hybrid 5d exerted the potential effect against most of the tested G+ and G− strains with MIC values of 0.125⁻8 μg/mL, much better than those of 1. Molecular-docking assay showed that compound 5d might target both bacterial LptA and Top IV proteins, thereby displaying a broad-spectrum antibacterial effect. This hybridization strategy was an efficient way to promote the antibacterial activity of this kind, and compound 5d was selected for the further investigation, with an advantage of a dual-target mechanism of action.

BackgroundThe utility of pre- and post-operative alpha-fetoprotein (AFP) and des-gamma (γ)-carboxy prothrombin (DCP) expression patterns and their dynamic changes as predictors of the outcome of hepatic resection for hepatocellular carcinoma (HCC) has yet to be well elucidated.MethodsFrom a multicenter database, AFP and DCP data during the week prior to surgery and the first post-discharge outpatient visit (within 1-2 months after surgery) were collected from patients with HCC who underwent hepatectomy. AFP-DCP expression patterns were categorized according to the number of positive tumor markers (AFP ≥ 20ng/mL, DCP ≥ 40mAU/mL), including double-negative, single-positive, and double-positive. Changes in the AFP-DCP expression patterns were delineated based on variations in the number of positive tumor markers when comparing pre- and post-operative patterns.ResultsPreoperatively, 53 patients (8.3%), 337 patients (52.8%), and 248 patients (38.9%) exhibited double-negative, single-positive, and double-positive AFP-DCP expression patterns, respectively. Postoperatively, 463 patients (72.6%), 130 patients (20.4%), and 45 patients (7.0%) showed double-negative, single-positive, and double-positive AFP-DCP expression patterns, respectively. Survival analysis showed a progressive decrease in recurrence-free (RFS) and overall survival (OS) as the number of postoperative positive tumor markers increased (both P < 0.001). Multivariate analysis showed that postoperative AFP-DCP expression pattern, but not preoperative AFP-DCP expression pattern, was an independent risk factor for RFS and OS. Further analysis showed that for patients with positive preoperative markers, prognosis gradually improves as positive markers decrease postoperatively. In particular, when all postoperative markers turned negative, the prognosis was consistent with that of preoperative double-negative patients, regardless of the initial number of positive markers.ConclusionsAFP-DCP expression patterns, particularly postoperative patterns, serve as vital sources of information for prognostic evaluation following hepatectomy for HCC. Moreover, changes in AFP-DCP expression patterns from pre- to post-operation enable dynamic prognostic risk stratification postoperatively, aiding the development of individualized follow-up strategies.

Abstract Background Routine clinical staging for hepatocellular carcinoma (HCC) incorporates liver function, general health, and tumor morphology. Further refinement of prognostic assessments and treatment decisions may benefit from the inclusion of tumor biological marker alpha-fetoprotein (AFP) and systemic inflammation indicator C-reactive protein (CRP). Methods Data from a multicenter cohort of 2770 HCC patients undergoing hepatectomy were analyzed. We developed the PACE risk score (Prognostic implications of AFP and CRP Elevation) after initially assessing preoperative AFP and CRP’s prognostic value. Subgroup analyzes were performed in BCLC cohorts A and B using multivariable Cox analysis to evaluate the prognostic stratification ability of the PACE risk score and its complementary utility for BCLC staging. Results Preoperative AFP ≥ 400ng/mL and CRP ≥ 10 mg/L emerged as independent predictors of poorer prognosis in HCC patients who underwent hepatectomy, leading to the creation of the PACE risk score. PACE risk score stratified patients into low, intermediate, and high-risk groups with cumulative 5-year overall (OS) and recurrence-free survival (RFS) rates of 59.6%/44.9%, 43.9%/38.4%, and 20.6%/18.0% respectively (all P

Abstract Non‐small cell lung cancer (NSCLC) accounts for ~85% of all lung cancer cases. Neferine is used as a traditional Chinese medicine with many pharmacological effects, including antitumor properties; however, it has not been reported whether neferine plays an anticancer role by causing pyroptosis in NSCLC cells. We used two typical lung cancer cell lines, A549 and H1299, and 42 lung cancer tissue samples to investigate the regulatory effects of neferine on TGF‐β and MST1. We also treated lung cancer cells with different concentrations of neferine to study its effects on lung cancer cell survival, migration, invasion, and epithelial–mesenchymal transition (EMT) as well as on pyroptosis. Lentivirus‐mediated gain‐of‐function studies of TGF‐β and MST1 were applied to validate the roles of TGF‐β and MST1 in lung cancer. Next, we used murine transplanted tumor models to evaluate the effect of neferine treatment on the metastatic capacity of lung cancer tissues. With increasing neferine concentration, the viability, migration, invasion, and EMT capacity of A549 and H1299 cells decreased, whereas pyroptosis increased. Neferine repressed TGF‐β expression to modulate the induction of reactive oxygen species (ROS) by MST1. Overexpression of TGF‐β in either in vitro or mouse‐transplanted A549 cells restored the inhibitory effect of neferine on tumor development. Overexpression of MST1 clearly enhanced pyroptosis. Neferine contributed to pyroptosis by regulating MST1 expression through downregulation of TGF‐β to induce ROS formation. Therefore, our study shows that neferine can serve as an adjuvant therapy for NSCLC patients.

BackgroundThis study evaluates the efficacy of alpha-fetoprotein (AFP) response as a surrogate marker for determining recurrence-free survival (RFS) in patients with unresectable hepatocellular carcinoma (uHCC) who undergo salvage hepatectomy following conversion therapy with tyrosine kinase inhibitor (TKI) and anti-PD-1 antibody-based regimen.MethodsThis multicenter retrospective study included 74 patients with uHCC and positive AFP (>20 ng/mL) at diagnosis, who underwent salvage hepatectomy after treatment with TKIs and anti-PD-1 antibody-based regimens. The association between AFP response—defined as a ≥ 80% decrease in final AFP levels before salvage hepatectomy from diagnosis—and RFS post-hepatectomy was investigated.ResultsAFP responders demonstrated significantly better postoperative RFS compared to non-responders (P

With an increase in aging population, osteoporosis has become one of the major public health issues nowadays, affecting over 200 million people worldwide. Since current medications are associated with various side effects, there is a clear clinical need to develop alternative therapeutics for managing osteoporosis. Selenium is an essential trace mineral, which has been proved to play important role in bone health. However, the narrow therapeutic window of selenium has greatly hindered its further development. Recently, selenium nanoparticles (SeNPs) have become a new selenium source due to its promising bioactivity and low toxicity. Nevertheless, scientific research concerning their effects on bone health is still very limited. By using the mushroom polysaccharide-protein complex isolated from Cordyceps sinensis, we have successfully prepared novel SeNPs (“Cs4-SeNPs”) with well-characterized structure and high stability. Interestingly, Cs4-SeNPs (10 μM) were found to markedly induce proliferation, differentiation, and mineralization of the pre-osteoblast murine MC3T3-E1 cells. Further mechanistic study discovered that after cellular internalization via endocytosis, Cs4-SeNPs would trigger Nox4-derived intracellular ROS generation in the MC3T3-E1 cells followed by promoting downstream BMP-2 gene transcription and activating BMP signaling via both Smad dependent and Smad independent p38 MAPK pathways. More importantly, Cs4-SeNPs (25–500 μg/kg BW/d) exhibitedpromising in vivo bone protective efficacy against OVX-induced osteoporosis by promoting bone formation, inhibiting bone resorption, and improving bone microarchitecture after oral gavage for 6 weeks. Findings of this study collectively suggested that Cs4-SeNPs is of great potential to be further developed into a safe and evidence-based nano-mineral for managing postmenopausal osteoporosis.

Postmenopausal women are prone to osteoporosis due to increased osteoclast activation and bone resorption caused by oestrogen deficiency. In Traditional Chinese Medicine theory, medicines with spleen- and kidney-nourishing effects are commonly used in postmenopausal osteoporosis (PMOP) treatment. Aikeqing (AKQ) is a compound Chinese medicinal granule with spleen- and kidney-nourishing effects. Herein, we investigate the in vitro and in vivo anti-osteoporotic effects of AKQ, its underlying mechanisms and pharmacodynamic basis. In vitro antiosteoporotic effects of AKQ were assessed by its ability to promote osteoblastogenesis in MC3T3-E1 and/or inhibit RANKL-induced osteoclastogenesis in murine bone marrow monocytes (BMMs). The protective effect of AKQ on bone loss induced by oestrogen deficiency was evaluated in ovariectomized rats. The underlying mechanisms were studied in BMMs by detecting the effects of AKQ on the RANKL-induced expression of genes and proteins involved in the regulation of osteoclastogenesis. The main chemical constituents of AKQ in the granule were analyzed by UPLC-QTOF-MS. Our findings show that AKQ did not affect osteoblastogenesis, but it inhibited RANKL-induced osteoclastogenesis. In the ovariectomized rats, oral administration of AKQ (4 g/kg/d) for 90 d effectively prevented oestrogen deficiency-induced bone loss. Mechanistic studies in BMMs revealed that AKQ inhibited RNAKL-induced activation of NF-κB (p65) and MAPKs (p38 and JNK) via blocking the RANK-TRAF6 interaction, subsequently suppressing the translocation and expression of NFATc1 and c-Fos. UPLC-QTOF-MS analysis quantified the 123 main components of AKQ. Taken together, AKQ was demonstrated for the first time as a novel alternative therapy for osteoclast-associated bone diseases.

Abstract This paper studies the black hole shadow, absorption cross section, and Hawking radiation of a massless scalar field in the background of a static spherically symmetric black hole spacetime that is surrounded by a cloud of strings in Rastall gravity. Specifically, the effects of the parameters a and $$\beta $$ β on the photon sphere and shadow radii are investigated. The results show that as the negative parameter $$\beta $$ β decreases, the photon sphere and shadow radii change in an N-shape. In addition, the absorption cross section obtained after solving the massless Klein–Gordon equation is calculated using the sinc approximation and the partial waves method. We compare the absorption cross section obtained by the sinc approximation and the partial waves method, and find it to be exceptionally consistent in the mid-to-high frequency region. Furthermore, the effects of parameters a and $$\beta $$ β on absorption are examined in detail. Finally, we study in detail the effects of the parameters a, $$\beta $$ β and l on the Hawking radiation power emission spectrum of the considered black hole. It turns out that the string parameter a always suppresses the power emission spectrum, indicating that such black holes live longer when the string parameter a is increased while other parameters are fixed.

As one of the most common diseases in pediatric surgery, an inguinal hernia is usually diagnosed by medical experts based on clinical data collected from magnetic resonance imaging (MRI), computed tomography (CT), or B-ultrasound. The parameters of blood routine examination, such as white blood cell count and platelet count, are often used as diagnostic indicators of intestinal necrosis. Based on the medical numerical data on blood routine examination parameters and liver and kidney function parameters, this paper used machine learning algorithm to assist the diagnosis of intestinal necrosis in children with inguinal hernia before operation. In the work, we used clinical data consisting of 3,807 children with inguinal hernia symptoms and 170 children with intestinal necrosis and perforation caused by the disease. Three different models were constructed according to the blood routine examination and liver and kidney function. Some missing values were replaced by using the RIN-3M (median, mean, or mode region random interpolation) method according to the actual necessity, and the ensemble learning based on the voting principle was used to deal with the imbalanced datasets. The model trained after feature selection yielded satisfactory results with an accuracy of 86.43%, sensitivity of 84.34%, specificity of 96.89%, and AUC value of 0.91. Therefore, the proposed methods may be a potential idea for auxiliary diagnosis of inguinal hernia in children.

Abstract Background Canker disease caused by Neoscytalidium dimidiatum is a devastating disease resulting in a major loss to the pitaya industry. However, resistance proteins in plants play crucial roles to against pathogen infection. Among resistance proteins, the leucine-rich repeat (LRR) protein is a major family that plays crucial roles in plant growth, development, and biotic and abiotic stress responses, especially in disease defense. Results In the present study, a transcriptomics analysis identified a total of 272 LRR genes, 233 of which had coding sequences (CDSs), in the plant pitaya (Hylocereus polyrhizus) in response to fungal Neoscytalidium dimidiatum infection. These genes were divided into various subgroups based on specific domains and phylogenetic analysis. Molecular characterization, functional annotation of proteins, and an expression analysis of the LRR genes were conducted. Additionally, four LRR genes (CL445.Contig4_All, Unigene28_All, CL28.Contig2_All, and Unigene2712_All, which were selected because they had the four longest CDSs were further assessed using quantitative reverse transcription PCR (qRT-PCR) at different fungal infection stages in different pitaya species (Hylocereus polyrhizus and Hylocereus undatus), in different pitaya tissues, and after treatment with salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) hormones. The associated protein functions and roles in signaling pathways were identified. Conclusions This study provides a comprehensive overview of the HpLRR family genes at transcriptional level in pitaya in response to N. dimidiatum infection, it will be helpful to understand the molecular mechanism of pitaya canker disease, and lay a strong foundation for further research.

Abstract Background Tumor motion may compromise the accuracy of liver stereotactic radiotherapy. In order to carry out a precise planning, estimating liver tumor motion during radiotherapy has received a lot of attention. Previous approach may have difficult to deal with image data corrupted by noise. The iterative closest point (ICP) algorithm is widely used for estimating the rigid registration of three-dimensional point sets when these data were dense or corrupted. In the light of this, our study estimated the three-dimensional (3D) rigid motion of liver tumors during stereotactic liver radiotherapy using reconstructed 3D coordinates of fiducials based on the ICP algorithm. Methods Four hundred ninety-five pairs of orthogonal kilovoltage (KV) images from the CyberKnife stereo imaging system for 12 patients were used in this study. For each pair of images, the 3D coordinates of fiducial markers inside the liver were calculated via geometric derivations. The 3D coordinates were used to calculate the real-time translational and rotational motion of liver tumors around three axes via an ICP algorithm. The residual error was also investigated both with and without rotational correction. Results The translational shifts of liver tumors in left-right (LR), anterior-posterior (AP),and superior-inferior (SI) directions were 2.92 ± 1.98 mm, 5.54 ± 3.12 mm, and 16.22 ± 5.86 mm, respectively; the rotational angles in left-right (LR), anterior-posterior (AP), and superior-inferior (SI) directions were 3.95° ± 3.08°, 4.93° ± 2.90°, and 4.09° ± 1.99°, respectively. Rotational correction decreased 3D fiducial displacement from 1.19 ± 0.35 mm to 0.65 ± 0.24 mm (P

We consider the joint estimation of direction-of-arrival (DOA) and polarization of constant modulus (CM) signals based on an electromagnetic vector-sensor (EMVS) array. Two algebraic algorithms for canonical polyadic decomposition (CPD) with CM constraint are proposed in two scenarios, in which the source signals are fully and partially CM, respectively. The proposed algorithms use the analytic CM algorithm in the first step to calculate the source matrix, and then exploit the CPD structure of the data tensor to compute the remaining factor matrices, from which the DOA and polarization parameters can finally be obtained. Due to the algebraic nature, the proposed algorithms are faster and more stable than the optimization based algorithms, and can be used to effectively initialize the latter. We have shown that the proposed algorithms have more relaxed uniqueness conditions than unconstrained CPD, and thus can be applied in highly underdetermined cases where the number of source signals greatly exceeds that of the EMVSs. Simulation results are provided to illustrate the performance of the proposed algorithms.

Joint estimation of direction-of-arrival (DOA) and polarization with electromagnetic vector-sensors (EMVS) is considered in the framework of complex-valued non-orthogonal joint diagonalization (CNJD). Two new CNJD algorithms are presented, which propose to tackle the high dimensional optimization problem in CNJD via a sequence of simple sub-optimization problems, by using LU or LQ decompositions of the target matrices as well as the Jacobi-type scheme. Furthermore, based on the above CNJD algorithms we present a novel strategy to exploit the multi-dimensional structure present in the second-order statistics of EMVS outputs for simultaneous DOA and polarization estimation. Simulations are provided to compare the proposed strategy with existing tensorial or joint diagonalization based methods.