Search

AIM: To evaluate the sensitivity of mean absolute amplitudes of the thoracic and the abdominal signals as a prompt indicator of the occurrence of sleep apnoea events. BACKGROUND: To provide symptomatic management of sleep apnoea, a reliable method of detecting sleep apnoea is essential to ensure that the intervention can be applied only when needed. It is also crucial to identify the threshold for the trigger of an intervention using a deployed sensor. DESIGN: Twenty-six subjects aged between 18-65 years who were diagnosed with obstructive or central sleep apnoea underwent an overnight sleep study. METHOD: Signals of nasal and oral airflow, thoracic and abdominal efforts and pulse oximetry level were recorded using a polysomnography device. RESULTS: With a 95% CI, the overall area under the receiver operating characteristic of the thoracic signal, the abdominal signal and the combination of the thoracic and the abdominal signals were 84.56, 87.48 and 90.91%, respectively. Using -20, -25 and -30% as a cut-off point, the sensitivity values of thoracic signal, abdominal signal and combination of the thoracic and the abdominal signals ranged from 70.29-86.25% and the specificity values ranged from 74.82 to 90.09%. CONCLUSIONS: Using mean absolute amplitude analysis, the results of this study showed that combination of the thoracic and the abdominal signals achieved the best overall and individual performances compared with thoracic signal and abdominal signal. Overall, thoracic signal, abdominal signal and combination of the thoracic and the abdominal signals have a good performance with an receiver operating characteristic value higher than 80%. The thoracic and the abdominal signals were good parameters for the identification of the occurrence of sleep apnoea, being as quick as the nasal airflow signal. RELEVANCE TO CLINICAL PRACTICE: These results suggested that sleep apnoea events could be identified through constant monitoring of the patient's thoracic and abdominal signals. Knowledge of these signals could help nurses to manage sleep apnoea in patients. [ABSTRACT FROM AUTHOR]

Background: Recent trials of anti-amyloid-β (Aβ) monoclonal antibodies, including lecanemab and donanemab, in early Alzheimer disease (AD) showed that these drugs have limited clinical benefits and their use comes with a significant risk of serious adverse events. Thus, it seems crucial to explore complementary therapeutic approaches. Genome-wide association studies identified robust associations between AD and several AD risk genes related to immune response, including but not restricted to CD33 and TREM2. Here, we critically reviewed the current knowledge on candidate neuroinflammatory biomarkers and their role in characterizing the pathophysiology of AD. Main body: Neuroinflammation is recognized to be a crucial and contributing component of AD pathogenesis. The fact that neuroinflammation is most likely present from earliest pre-stages of AD and co-occurs with the deposition of Aβ reinforces the need to precisely define the sequence and nature of neuroinflammatory events. Numerous clinical trials involving anti-inflammatory drugs previously yielded unfavorable outcomes in early and mild-to-moderate AD. Although the reasons behind these failures remain unclear, these may include the time and the target selected for intervention. Indeed, in our review, we observed a stage-dependent neuroinflammatory process in the AD brain. While the initial activation of glial cells counteracts early brain Aβ deposition, the downregulation in the functional state of microglia occurs at more advanced disease stages. To address this issue, personalized neuroinflammatory modulation therapy is required. The emergence of reliable blood-based neuroinflammatory biomarkers, particularly glial fibrillary acidic protein, a marker of reactive astrocytes, may facilitate the classification of AD patients based on the ATI(N) biomarker framework. This expands upon the traditional classification of Aβ ("A"), tau ("T"), and neurodegeneration ("N"), by incorporating a novel inflammatory component ("I"). Conclusions: The present review outlines the current knowledge on potential neuroinflammatory biomarkers and, importantly, emphasizes the role of longitudinal analyses, which are needed to accurately monitor the dynamics of cerebral inflammation. Such a precise information on time and place will be required before anti-inflammatory therapeutic interventions can be considered for clinical evaluation. We propose that an effective anti-neuroinflammatory therapy should specifically target microglia and astrocytes, while considering the individual ATI(N) status of patients. [ABSTRACT FROM AUTHOR]

Background: Alzheimer's disease (AD) and behavioral variant frontotemporal dementia (bvFTD) show differential vulnerability to large-scale brain functional networks. Plasma neurofilament light (NfL), a promising biomarker of neurodegeneration, has been linked in AD patients to glucose metabolism changes in AD-related regions. However, it is unknown whether plasma NfL would be similarly associated with disease-specific functional connectivity changes in AD and bvFTD. Objective: Our study examined the associations between plasma NfL and functional connectivity of the default mode and salience networks in patients with AD and bvFTD. Methods: Plasma NfL and neuroimaging data from patients with bvFTD (n = 16) and AD or mild cognitive impairment (n = 38; AD + MCI) were analyzed. Seed-based functional connectivity maps of key regions within the default mode and salience networks were obtained and associated with plasma NfL in these patients. RESULTS: We demonstrated divergent associations between NfL and functional connectivity in AD + MCI and bvFTD patients. Specifically, AD + MCI patients showed lower default mode network functional connectivity with higher plasma NfL, while bvFTD patients showed lower salience network functional connectivity with higher plasma NfL. Further, lower NfL-related default mode network connectivity in AD + MCI patients was associated with lower Montreal Cognitive Assessment scores and higher Clinical Dementia Rating sum-of-boxes scores, although NfL-related salience network connectivity in bvFTD patients was not associated with Neuropsychiatric Inventory Questionnaire scores. CONCLUSIONS: Our findings indicate that plasma NfL is differentially associated with brain functional connectivity changes in AD and bvFTD. [ABSTRACT FROM AUTHOR]

Background: Infant, junior, and adult patients with neuronal intranuclear inclusion disease (NIID) present with various types of seizures. We aimed to conduct a systematic literature review on the clinical characteristics of NIID with seizures to provide novel insight for early diagnosis and treatment and to improve prognosis of these patients. Methods: We used KEYWORDS: to screen articles related to NIID and seizures, and data concerning the clinical characteristics of patients, including demographic features, disease characteristics of the seizures, treatment responses, imaging examinations, and other auxiliary examination results were extracted. Results: The included studies comprised 21 patients with NIID with seizures. The most common clinical phenotypes were cognitive impairment (76.20%) and impaired consciousness (57.14%), and generalized onset motor seizures (46.15%) represented the most common type. Compared with infantile and juvenile cases, the use of antiepileptic drugs in adults led to significant seizure control and symptom improvement, in addition to providing a better prognosis. The number of GGC sequence repeats in the NOTCH2NLC gene in six NIID patients with seizures who underwent genetic testing ranged 72-134. Conclusion: The most common clinical phenotypes in patients with NIID with seizures were cognitive impairment and consciousness disorders. Patients with NIID presented with various types of seizures, with the most common being generalized onset motor seizures. Adult patients had a better prognosis and were relatively stable. The early diagnosis of NIID with seizures is of great significance for treatment and to improve prognosis. [ABSTRACT FROM AUTHOR]

Bilingualism is thought to confer advantages in executive functioning, thereby contributing to cognitive reserve and a later age of dementia symptom onset. While the relation between bilingualism and age of onset has been explored in Alzheimer's dementia, there are few studies examining bilingualism as a contributor to cognitive reserve in frontotemporal dementia (FTD). In line with previous findings, we hypothesized that bilinguals with behavioral variant FTD would be older at symptom onset compared to monolinguals, but that no such effect would be found in patients with nonfluent/agrammatic variant primary progressive aphasia (PPA) or semantic variant PPA. Contrary to our hypothesis, we found no significant difference in age at symptom onset between monolingual and bilingual speakers within any of the FTD variants, and there were no notable differences on neuropsychological measures. Overall, our results do not support a protective effect of bilingualism in patients with FTD-spectrum disease in a U.S. based cohort. [ABSTRACT FROM AUTHOR]

Previous in vitro and post-mortem studies have reported the role of inflammation in neurodegenerative disorders. However, the association between inflammation and brain structure in vivo and the transcriptome-driven functional basis with relevance to neurodegenerative disorders remains elusive. The aim of the present study is to identify the association among inflammation, brain structure, and neurodegenerative disorders at genetic and transcriptomic levels. Genetic variants associated with inflammatory cytokines were selected from the latest and largest genome-wide association studies of European ancestry. Neurodegenerative disorders including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), and dementia with Lewy bodies (DLB) and brain structure imaging measures were selected as the outcomes. Two-sample Mendelian randomization analyses were conducted to identify the causal associations. Single-nucleus transcriptome data of the occipitotemporal cortex was further analyzed to identify the differential expressed genes in AD, which were tested for biological processes and protein interaction network. MR analysis indicated that genetically predicted TREM2 and sTREM2 were significantly associated with AD (TREM2: z-score = −9.088, p-value = 1.02 × 10−19; sTREM2: z-score = −7.495, p-value = 6.61 × 10−14). The present study found no evidence to support the causal associations between other inflammatory cytokines and the risks of AD, PD, ALS, or DLB. Genetically predicted TREM2 was significantly associated with the cortical thickness of inferior temporal (z-score = −4.238, p-value = 2.26 × 10−5) and pole temporal (z-score = −4.549, p-value = 5.40 × 10−6). In the occipitotemporal cortex samples, microglia were the main source of TREM2 gene and showed increasing expression of genes associated with inflammation and immunity. The present study has leveraged genetic and transcriptomic data to identify the association among TREM2, temporal lobe, and AD and the underlying cellular and molecular basis, thus providing a new perspective on the role of TREM2 in AD and insights into the complex associations among inflammation, brain structure, and neurodegenerative disorders, particularly AD. [ABSTRACT FROM AUTHOR]

Background: The use of structural and perfusion brain imaging in combination with behavioural information in the prediction of cognitive syndromes using a data-driven approach remains to be explored. Here, we thus examined the contribution of brain structural and perfusion imaging and behavioural features to the existing classification of cognitive syndromes using a data-driven approach. Methods: Study participants belonged to the community-based Biomarker and Cognition Cohort Study in Singapore who underwent neuropsychological assessments, structural-functional MRI and blood biomarkers. Participants had a diagnosis of cognitively normal (CN), subjective cognitive impairment (SCI), mild cognitive impairment (MCI) and dementia. Cross-sectional structural and cerebral perfusion imaging, behavioural scale data including mild behaviour impairment checklist, Pittsburgh Sleep Quality Index and Depression, Anxiety and Stress scale data were obtained. Results: Three hundred seventy-three participants (mean age 60.7 years; 56% female sex) with complete data were included. Principal component analyses demonstrated that no single modality was informative for the classification of cognitive syndromes. However, multivariate glmnet analyses revealed a specific combination of frontal perfusion and temporo-frontal grey matter volume were key protective factors while the severity of mild behaviour impairment interest sub-domain and poor sleep quality were key at-risk factors contributing to the classification of CN, SCI, MCI and dementia (p < 0.0001). Moreover, the glmnet model showed best classification accuracy in differentiating between CN and MCI cognitive syndromes (AUC = 0.704; sensitivity = 0.698; specificity = 0.637). Conclusions: Brain structure, perfusion and behavioural features are important in the classification of cognitive syndromes and should be incorporated by clinicians and researchers. These findings illustrate the value of using multimodal data when examining syndrome severity and provide new insights into how cerebral perfusion and behavioural impairment influence classification of cognitive syndromes. [ABSTRACT FROM AUTHOR]

Background: The behavioral variant of frontotemporal dementia (bvFTD) is very heterogeneous in pathology, genetics, and disease course. Unlike Alzheimer's disease, reliable biomarkers are lacking and sporadic bvFTD is often misdiagnosed as a primary psychiatric disorder (PPD) due to overlapping clinical features. Current efforts to characterize and improve diagnostics are centered on the minority of genetic cases. Objective: The multi-center study DIPPA-FTD aims to develop diagnostic and prognostic algorithms to help distinguish sporadic bvFTD from late-onset PPD in its earliest stages. Methods: The prospective DIPPA-FTD study recruits participants with late-life behavioral changes, suspect for bvFTD or late-onset PPD diagnosis with a negative family history for FTD and/or amyotrophic lateral sclerosis. Subjects are invited to participate after diagnostic screening at participating memory clinics or recruited by referrals from psychiatric departments. At baseline visit, participants undergo neurological and psychiatric examination, questionnaires, neuropsychological tests, and brain imaging. Blood is obtained to investigate biomarkers. Patients are informed about brain donation programs. Follow-up takes place 10-14 months after baseline visit where all examinations are repeated. Results from the DIPPA-FTD study will be integrated in a data-driven approach to develop diagnostic and prognostic models. Conclusions: DIPPA-FTD will make an important contribution to early sporadic bvFTD identification. By recruiting subjects with ambiguous or prodromal diagnoses, our research strategy will allow the characterization of early disease stages that are not covered in current sporadic FTD research. Results will hopefully increase the ability to diagnose sporadic bvFTD in the early stage and predict progression rate, which is pivotal for patient stratification and trial design. [ABSTRACT FROM AUTHOR]

Summary: Background: Neuronal intranuclear inclusion disease (NIID) is a rare highly heterogeneous disease. In this paper, we present a case of NIID featured in cortical involvement in left hemisphere of brain and the imaging changes in the process of the disease. Case presentation: A 57-year-old female was hospitalized due to recurrent attacks of headache with cognitive impairment and tremor for 2 years. The symptoms of headache episodes were reversible. The characteristic radiologic change was high intensity signal involving the grey matter-white matter junction on the brain diffusion-weighted imaging (DWI), which existed in the frontal lobe and then extended backwards. Atypical features on fluid-attenuated inversion recovery (FLAIR) sequences showing small patchy high signals in the cerebellar vermis. High signals and edema were detected on FLAIR images along the cortex of the left occipito-parieto-temporal lobes, expanding and gradually shrinking in the follow-up visit. Besides, cerebral atrophy and bilateral symmetrical leukoencephalopathy were also detected. Skin biopsy and genetic testing confirmed the diagnosis of NIID. Conclusion: Except for typical radiological change strongly suggesting NIID, it is also necessary to notice the insidious symptoms of NIID combining with some atypical imaging features to make an early diagnosis. Skin biopsies or genetic testing should be carried out early in patients with highly suspected NIID. [ABSTRACT FROM AUTHOR]

Expansions of short tandem repeats (STRs) have been found to be present in more than 50 diseases and have a close connection with neurodegenerative diseases. Transcriptional silencing and R-LOOP formation, RNA-mediated sequestration of RNA-binding proteins (RBPs), gain-of-function (GOF) proteins containing expanded repeats, and repeat-associated non-AUG (RAN) translation of toxic repeat peptides are some potential molecular mechanisms underlying STR expansion disorders. R-LOOP, a byproduct of transcription, is a three-stranded nucleic acid structure with abnormal accumulation that participates in the pathogenesis of STR expansion disorders by inducing DNA damage and genome instability. R-LOOPs can engender a series of DNA damage, such as DNA double-strand breaks (DSBs), single-strand breaks (SSBs), DNA recombination, or mutations in the DNA replication, transcription, or repair processes. In this review, we provide an in-depth discussion of recent advancements in R-LOOP and systematically elaborate on its genetic destabilizing effects in several neurodegenerative diseases. These molecular mechanisms will provide novel targets for drug design and therapeutic upgrading of these devastating diseases. [ABSTRACT FROM AUTHOR]

Introduction: Diagnosing acute encephalopathy with biphasic seizures and late reduced diffusion (AESD) after the first seizure (early seizure/seizures, ES/ESs) is challenging because a reduced apparent diffusion coefficient (ADC) in the cortical or subcortical white matter, often described as having a “bright-tree appearance (BTA),” is usually not observed until secondary seizures (late seizures, LSs) occur. Previous studies have reported hypoperfusion on arterial spin labeling (ASL) within 24  h after ES/ESs in patients with AESD and hyperperfusion within 24  h after LS onset. This study aimed to investigate cerebral blood flow in the hyperacute phase (between ES/ESs and LSs) using ASL in patients with AESD. Methods: Eight ASL images were acquired in six patients with AESD admitted to our hospital from October 2021 to October 2022. ASL findings in the hyperacute phase were investigated and video-electroencephalogram findings obtained around ASL image acquisition in the hyperacute phase were evaluated. Results: Four ASL images were obtained for three patients before LS onset, with three images showing hyperperfusion areas and one image showing hypoperfusion areas. These hyperperfuion regions coincided with BTA on subsequent images of these patients. In one patient, the first ASL image was obtained in the late hyperacute phase and revealed hyperperfusion areas with a slightly abnormal change on diffusionweighted image (DWI), which were not accompanied by ADC abnormalities. The second ASL image obtained 51  h after the first ASL, and before LS onset revealed more prominent hyperperfusion areas than the first ASL image, which were accompanied by BTA. In another patient, the ASL image obtained 82  h after ES revealed hyperperfusion areas without abnormal change on DWI or ADC. Conclusion: This study revealed that two patients exhibited hyperperfusion regions and another patient exhibited hypoperfusion regions among three patients who underwent ASL imaging during the period from 24  h after ES/ESs to LSs in patients with LSs or cooling initiation in patients without LSs due to early anaesthesia induction (late hyperacute phase). Further prospective studies on cerebral blood flow are required to explore the relationship among the timing of image acquisition, the presence of electrographic seizures, and ASL findings in patients with AESD. [ABSTRACT FROM AUTHOR]

Parkinsonism is a syndrome characterized by bradykinesia in combination with either rest tremor, rigidity, or both. These features are the cardinal manifestations of Parkinson's disease, the most common cause of parkinsonism, and atypical parkinsonian disorders. However, parkinsonism can be a manifestation of complex neurological and neurodegenerative genetically determined disorders, which have a vast and heterogeneous motor and non-motor phenotypic features. Hereditary dementias, adult-onset ataxias and spastic paraplegias represent only few of this vast group of neurogenetic diseases. This review will provide an overview of parkinsonism's clinical features within adult-onset neurogenetic diseases which a neurologist could face with. Understanding parkinsonism and its characteristics in the context of the aforementioned neurological conditions may provide insights into pathophysiological mechanisms and have important clinical implications, including diagnostic and therapeutic aspects. [ABSTRACT FROM AUTHOR]

Background: The discovery of skin intranuclear inclusions and GGC repeat expansion of NOTCH2NLC has greatly promoted the diagnosis of neuronal intranuclear inclusion disease (NIID). With highly heterogeneous clinical manifestations, NIID patients tend to be underdiagnosed at early stages. Methods: This study comprehensively studied clinical manifestations, magnetic resonance imaging (MRI), and peripheral nerve conduction in 24 NIID and 166 other neurodegenerative disease (ND) subjects. The nomogram was plotted using the "rms" package, and the t-distributed stochastic neighbor embedding algorithm was performed. Associations between skin intranuclear inclusions and NOTCH2NLC GGC repeats were further analyzed. Results: The clinical, MRI, and peripheral nerve conduction features seriously overlapped in NIID and ND patients; they were assigned variables according to their frequency and specificity in NIID patients. A nomogram that could distinguish NIID from ND was constructed according to the assigned variables and cutoff values of the above features. The occurrence of skin intranuclear inclusions and NOTCH2NLC GGC repeats ≥ 60 showed 100% consistency, and intranuclear inclusion frequency positively correlated with NOTCH2NLC GGC repeats. A hierarchical diagnostic flowchart for definite NIID was further established. Conclusion: We provide a novel nomogram with the potential to realize early identification and update the diagnostic flowchart for definitive diagnosis. Moreover, this is the first study to define the association between skin pathology and NOTCH2NLC genetics in NIID. [ABSTRACT FROM AUTHOR]

Although depressive symptoms are common in PD, few studies investigated sex and age differences in depressive symptoms. Our study aimed to explore the sex and age differences in the clinical correlates of depressive symptoms in patients with PD. 210 PD patients aged 50–80 were recruited. Levels of glucose and lipid profiles were measured. The Hamilton Depression Rating Scale-17 (HAMD-17), the Montreal Cognitive Assessment (MoCA) and the Movement Disorder Society Unified Parkinson's Disease Rating Scale Part III (MDS-UPDRS-III) assessed depressive symptom, cognition and motor function, respectively. Male depressive PD participants had higher fasting plasma glucose (FPG) levels. Regarding the 50–59 years group, depressive patients had higher TG levels. Moreover, there were sex and age differences in the factors associated with severity of depressive symptoms. In male PD patients, FPG was an independent contributor to HAMD-17 (Beta = 0.412, t = 4.118, p < 0.001), and UPDRS-III score was still associated with HAMD-17 in female patients after controlling for confounding factors (Beta = 0.304, t = 2.961, p = 0.004). Regarding the different age groups, UPDRS-III (Beta = 0.426, t = 2.986, p = 0.005) and TG (Beta = 0.366, t = 2.561, p = 0.015) were independent contributors to HAMD-17 in PD patients aged 50–59. Furthermore, non-depressive PD patients demonstrated better performance with respect to visuospatial/executive function among the 70–80 years group. These findings suggest that sex and age are crucial non-specific factors to consider when assessing the relationship between glycolipid metabolism, PD-specific factors and depression. [ABSTRACT FROM AUTHOR]

With complicated conditions and a large number of potentially causative genes, the diagnosis of a patient with complex inherited peripheral neuropathies (IPNs) is challenging. To provide an overview of the genetic and clinical features of 39 families with complex IPNs from central south China and to optimize the molecular diagnosis approach to this group of heterogeneous diseases, a total of 39 index patients from unrelated families were enrolled, and detailed clinical data were collected. TTR Sanger sequencing, hereditary spastic paraplegia (HSP) gene panel, and dynamic mutation detection in spinocerebellar ataxia (SCAs) were performed according to the respective additional clinical features. Whole-exome sequencing (WES) was used in patients with negative or unclear results. Dynamic mutation detection in NOTCH2NLC and RCF1 was applied as a supplement to WES. As a result, an overall molecular diagnosis rate of 89.7% was achieved. All 21 patients with predominant autonomic dysfunction and multiple organ system involvement carried pathogenic variants in TTR, among which nine had c.349G > T (p.A97S) hotspot variants. Five out of 7 patients (71.4%) with muscle involvement harbored biallelic pathogenic variants in GNE. Five out of 6 patients (83.3%) with spasticity reached definite genetic causes in SACS, KIF5A, BSCL2, and KIAA0196, respectively. NOTCH2NLC GGC repeat expansions were identified in all three cases accompanied by chronic coughing and in one patient accompanied by cognitive impairment. The pathogenic variants, p.F284S and p.G111R in GNE, and p.K4326E in SACS, were first reported. In conclusion, transthyretin amyloidosis with polyneuropathy (ATTR-PN), GNE myopathy, and neuronal intranuclear inclusion disease (NIID) were the most common genotypes in this cohort of complex IPNs. NOTCH2NLC dynamic mutation testing should be added to the molecular diagnostic workflow. We expanded the genetic and related clinical spectrum of GNE myopathy and ARSACS by reporting novel variants. [ABSTRACT FROM AUTHOR]

Background: Multi-arm, multi-stage (MAMS) platform trials can accelerate the identification of disease-modifying treatments for Parkinson's disease (PD) but there is no current consensus on the optimal outcome measures (OM) for this approach. Objective: To provide an up-to-date inventory of OM for disease-modifying PD trials, and a framework for future selection of OM for such trials. Methods: As part of the Edmond J Safra Accelerating Clinical Trials in Parkinson Disease (EJS ACT-PD) initiative, an expert group with Patient and Public Involvement and Engagement (PPIE) representatives' input reviewed and evaluated available evidence on OM for potential use in trials to delay progression of PD. Each OM was ranked based on aspects such as validity, sensitivity to change, participant burden and practicality for a multi-site trial. Review of evidence and expert opinion led to the present inventory. Results: An extensive inventory of OM was created, divided into: general, motor and non-motor scales, diaries and fluctuation questionnaires, cognitive, disability and health-related quality of life, capability, quantitative motor, wearable and digital, combined, resource use, imaging and wet biomarkers, and milestone-based. A framework for evaluation of OM is presented to update the inventory in the future. PPIE input highlighted the need for OM which reflect their experience of disease progression and are applicable to diverse populations and disease stages. Conclusion: We present a range of OM, classified according to a transparent framework, to aid selection of OM for disease-modifying PD trials, whilst allowing for inclusion or re-classification of relevant OM as new evidence emerges. [ABSTRACT FROM AUTHOR]

Background: The longitudinal dynamics of neurofilament light chain (NfL) in multiple system atrophy (MSA) were incompletely illuminated. This study aimed to explore whether the plasma NfL (pNfL) could serve as a potential biomarker of clinical diagnosis and disease progression for MSA. Methods: We quantified pNfL concentrations in both a large cross-sectional cohort with 214 MSA individuals, 65 PD individuals, and 211 healthy controls (HC), and a longitudinal cohort of 84 MSA patients. Propensity score matching (PSM) was used to balance the age between the three groups. The pNfL levels between groups were compared using Kruskal–Wallis test. Linear mixed models were performed to explore the disease progression-associated factors in longitudinal MSA cohort. Random forest model as a complement to linear models was employed to quantify the importance of predictors. Results: Before and after matching the age by PSM, the pNfL levels could reliably differentiate MSA from HC and PD groups, but only had mild potential to distinguish PD from HC. By combining linear and nonlinear models, we demonstrated that pNfL levels at baseline, rather than the change rate of pNfL, displayed potential prognostic value for progression of MSA. The combination of baseline pNfL levels and other modifiers, such as subtypes, Hoehn–Yahr stage at baseline, was first shown to improve the diagnosis accuracy. Conclusions: Our study contributed to a better understanding of longitudinal dynamics of pNfL in MSA, and validated the values of pNfL as a non-invasive sensitive biomarker for the diagnosis and progression. The combination of pNfL and other factors is recommended for better monitoring and prediction of MSA progression. [ABSTRACT FROM AUTHOR]

Background: Neuronal intranuclear inclusion disease (NIID) is a rare neurodegenerative disorder characterized by widespread intranuclear inclusions in the nervous system as well as multiple visceral organs. In 2019, expanded GGC repeats within the 5′ untranslated region of the NOTCH2NLC gene was identified as the causative factor. NIID is a heterogeneous disorder with variable clinical manifestations including cognitive impairment, cerebellar ataxia, parkinsonism, paroxysmal symptoms, autonomic dysfunction, and muscle weakness. Although NIID primarily affects the central and peripheral nervous systems, growing evidence suggests potential cardiac abnormalities in NIID. However, the link between expanded GGC repeats within NOTCH2NLC and cardiac dysfunction remains uncertain. Results: In this study, we utilized two transgenic mouse models, expressing NOTCH2NLC-(GGC)98 ubiquitously or specifically in cardiomyocytes, and identified p62 (also known as sequestosome 1, SQSTM1)-positive intranuclear NOTCH2NLC-polyG inclusions in cardiomyocytes in two mouse models. We observed that both models exhibited cardiac-related pathological and echocardiographic changes, albeit exhibiting varying degrees of severity. Transcriptomic analysis revealed shared downregulation of genes related to ion channels and mitochondria in both models, with the cardiomyocyte-specific mice showing a more pronounced downregulation of mitochondria and energy metabolism-related pathways. Further investigations revealed decreased expression of mitochondria-related genes and electron transport chain activity. At last, we conducted a retrospective review of cardiac-related examination results from NIID patients at our hospital and also identified some cardiac abnormalities in NIID patients. Conclusions: Our study provided the first in vivo evidence linking GGC repeat expansions within NOTCH2NLC to cardiac abnormalities and highlighted the contribution of mitochondrial dysfunction in the development of cardiac abnormalities. [ABSTRACT FROM AUTHOR]

We have recently published the notion of the “vitals” of Parkinson’s, a conglomeration of signs and symptoms, largely nonmotor, that must not be missed and yet often not considered in neurological consultations, with considerable societal and personal detrimental consequences. This “dashboard,” termed the Chaudhuri’s vitals of Parkinson’s, are summarized as 5 key vital symptoms or signs and comprise of (a) motor, (b) nonmotor, (c) visual, gut, and oral health, (d) bone health and falls, and finally (e) comorbidities, comedication, and dopamine agonist side effects, such as impulse control disorders. Additionally, not addressing the vitals also may reflect inadequate management strategies, leading to worsening quality of life and diminished wellness, a new concept for people with Parkinson’s. In this paper, we discuss possible, simple to use, and clinically relevant tests that can be used to monitor the status of these vitals, so that these can be incorporated into clinical practice. We also use the term Parkinson’s syndrome to describe Parkinson’s disease, as the term “disease” is now abandoned in many countries, such as the U.K., reflecting the heterogeneity of Parkinson’s, which is now considered by many as a syndrome. [ABSTRACT FROM AUTHOR]

Tumor development, involving both cell growth (mass accumulation) and cell proliferation, is a complex process governed by the interplay of multiple signaling pathways. TET2 mainly functions as a DNA dioxygenase, which modulates gene expression and biological functions via oxidation of 5mC in DNA, yet whether it plays a role in regulating cell growth remains unknown. Here we show that TET2 suppresses mTORC1 signaling, a major growth controller, to inhibit cell growth and promote autophagy. Mechanistically, TET2 functions as a 5mC "eraser" by mRNA oxidation, abolishes YBX1–HuR binding and promotes decay of urea cycle enzyme mRNAs, thus negatively regulating urea cycle and arginine production, which suppresses mTORC1 signaling. Therefore, TET2-deficient tumor cells are more sensitive to mTORC1 inhibition. Our results uncover a novel function for TET2 in suppressing mTORC1 signaling and inhibiting cell growth, linking TET2-mediated mRNA oxidation to cell metabolism and cell growth control. These findings demonstrate the potential of mTORC1 inhibition as a possible treatment for TET2-deficient tumors. [ABSTRACT FROM AUTHOR]

Key Clinical Message: Neuronal intranuclear inclusion disease (NIID) is a progressive neurodegenerative disorder characterized by intranuclear inclusions. Kidney injury involvement and successful treatment for NIID have rarely been reported. A NIID patient developed crescentic IgA nephropathy. Steroid therapy resolved digestive symptoms and recovered renal function. Steroids are considered for concomitant symptoms of NIID. [ABSTRACT FROM AUTHOR]

GGC repeat expansion in the 5′ untranslated region (UTR) of NOTCH2NLC is associated with a broad spectrum of neurological disorders, especially neuronal intranuclear inclusion disease (NIID). Studies have found that GGC repeat expansion in NOTCH2NLC induces the formation of polyglycine (polyG)-containing protein, which is involved in the formation of neuronal intranuclear inclusions. However, the mechanism of neurotoxicity induced by NOTCH2NLC GGC repeats is unclear. Here, we used NIID patient-specific induced pluripotent stem cell (iPSC)-derived 3D cerebral organoids (3DCOs) and cellular models to investigate the pathophysiological mechanisms of NOTCH2NLC GGC repeat expansion. IPSC-derived 3DCOs and cellular models showed the deposition of polyG-containing intranuclear inclusions. The NOTCH2NLC GGC repeats could induce the upregulation of autophagic flux, enhance integrated stress response and activate EIF2α phosphorylation. Bulk RNA sequencing for iPSC-derived neurons and single-cell RNA sequencing (scRNA-seq) for iPSC-derived 3DCOs revealed that NOTCH2NLC GGC repeats may be associated with dysfunctions in ribosome biogenesis and translation. Moreover, NOTCH2NLC GGC repeats could induce the NPM1 nucleoplasm translocation, increase nucleolar stress, impair ribosome biogenesis and induce ribosomal RNA sequestration, suggesting dysfunction of membraneless organelles in the NIID cellular model. Dysfunctions in ribosome biogenesis and phosphorylated EIF2α and the resulting increase in the formation of G3BP1-positive stress granules may together lead to whole-cell translational inhibition, which may eventually cause cell death. Interestingly, scRNA-seq revealed that NOTCH2NLC GGC repeats may be associated with a significantly decreased proportion of immature neurons while 3DCOs were developing. Together, our results underscore the value of patient-specific iPSC-derived 3DCOs in investigating the mechanisms of polyG diseases, especially those caused by repeats in human-specific genes. [ABSTRACT FROM AUTHOR]

With increasing life expectancy, a growing number of individuals are being affected by Parkinson's Disease (PD), a Neurodegenerative Disease (ND). Approximately, 5–10% of PD is explained by genetic causes linked to known PD genes. With improvements in genetic testing and high-throughput technologies, more PD-associated susceptibility genes have been reported in recent years. However, a comprehensive review of the pathogenic mechanisms and physiological roles of these genes is still lacking. This article reviews novel genes with putative or confirmed pathogenic mutations in PD reported since 2019, summarizes the physiological functions and potential associations with PD. Newly reported PD-related genes include ANK2, DNAH1, STAB1, NOTCH2NLC, UQCRC1, ATP10B, TFG, CHMP1A, GIPC1, KIF21B, KIF24, SLC25A39, SPTBN1 and TOMM22. However, the evidence for pathogenic effects of many of these genes is inconclusive. A variety of novel PD-associated genes have been identified through clinical cases of PD patients and analysis of Genome-Wide Association Studies (GWAS). However, more evidence is needed in confirm the strong association of novel genes with disease. [ABSTRACT FROM AUTHOR]

Alzheimer's disease (AD) is a complex neurodegenerative disorder involving heterogenous pathophysiological characteristics, which has become a challenge to therapeutics. The major pathophysiology of AD comprises amyloid-β (Aβ), tau, oxidative stress, and apoptosis. Recent studies indicate the significance of Triggering receptor expressed on myeloid cells 2 (TREM2) and its mutant variants in AD. TREM2 are the transmembrane receptors of microglial cells that performs a broad range of physiological cell processes. Phagocytosis of Aβ is one of the physiological roles of TREM2, which plays a pivotal role in AD progression. R47H, a mutant variant of TREM2, increases the risk of AD by impairing TREM2–Aβ binding. Inconclusive evidence regarding the TREM2 signaling cascade mechanism of Aβ phagocytosis motivates the current review to propose a new hypothesis. The review systematically assesses the cross talk between TREM2 and other AD pathological domains and the influence of TREM2 on amyloid and tau seeding. Disease associated microglia (DAM), a novel state of microglia with unique transcriptional and functional signatures reported in neurodegenerative conditions, also depend on the TREM2 pathway for its differentiation. DAM is suggested to have a neuroprotective role. We hypothesize that TREM2, along with its signaling adaptors and endogenous proteins, play a key role in ameliorating Aβ clearance. We indicate that TREM2 has the potential to ameliorate the Aβ burden, though with differential clearance ability and may act as a potential therapeutic target. [ABSTRACT FROM AUTHOR]

Dementia with Lewy bodies (DLB) and Parkinson disease (PD) with and without dementia are entities of a spectrum of Lewy body diseases. About 26.3% of all PD patients develop dementia increasing up to 83%. Parkinson disease-dementia (PDD) and DLB share many clinical and morphological features that separate them from non-demented PD (PDND). Clinically distinguished by the temporal sequence of motor and cognitive symptoms, the pathology of PDD and DLB includes variable combinations of Lewy body (LB) and Alzheimer (AD) lesions, both being more severe in DLB, but much less frequent and less severe in PDND. The objective of this study was to investigate the morphological differences between these three groups. 290 patients with pathologically confirmed PD were reviewed. 190 of them had clinical dementia; 110 met the neuropathological criteria of PDD and 80 of DLB. The major demographic and clinical data were obtained from medical records. Neuropathology included semiquantitative assessment of LB and AD pathologies including cerebral amyloid angiopathy (CAA). PDD patients were significantly older than PDND and DLB ones (83.9 vs 77.9 years, p < 0.05); the age of DLB patients was between them (80.0 years), while the disease duration was shortest in DLB. Brain weight was lowest in DLB, which showed higher Braak LB scores (mean 5.2 vs 4.2) and highest Braak tau stages (mean 5.2 vs 4.4 and 2.3, respectively). Thal Aβ phases were also highest in DLB (mean 4.1 vs 3.0 and 1.8, respectively). Major findings were frequency and degree of CAA, being highest in DLB (95% vs 50% and 24%, with scores 2.9 vs 0.7 and 0.3, respectively), whereas other small vessel lesions showed no significant differences. Striatal Aβ deposits also differentiated DLB from the other groups. This and other studies of larger cohorts of PD patients indicate that the association of CAA and cortical tau—but less—LB pathologies are associated with more severe cognitive decline and worse prognosis that distinguish DLB from PDD and PDND. The particular impact of both CAA and tau pathology supports the concept of a pathogenic continuum ranging from PDND to DLB + AD within the spectrum of age-related synucleinopathies. [ABSTRACT FROM AUTHOR]

Background: The insula is the predominant brain region impaired in behavioral variant frontotemporal dementia (bvFTD). However, structural and functional changes in the sub-insula in the asymptomatic stage of bvFTD are unknown. Objective: To describe structural and functional changes in insula subregions in asymptomatic carriers of the P301L mutation of the microtubule-associated protein tau (MAPT) gene and patients with bvFTD. Methods: Six asymptomatic MAPT P301L mutation carriers and 12 MAPT negative control subjects of the same pedigree were enrolled, along with 30 patients with a clinical diagnosis of bvFTD and 30 matched controls. All subjects underwent hybrid positron emission tomography/magnetic resonance imaging. Atlas-based parcellation using a fine-grained Brainnetome Atlas was conducted to assess gray matter (GM) volume, metabolism, and metabolic connectivity in the sub-insula (region of interest). Results: There was no significant GM atrophy or hypometabolism in insula subregions in asymptomatic MAPT P301L carriers, although decreased metabolic connectivity between vIa-middle temporal gyrus, vIa-temporal poles, dIa-middle temporal gyrus and dIa-temporal poles; and increased connectivity between vIa-orbitofrontal, vIa-dorsal lateral superior frontal gyrus, and dIa-orbitofrontal and dIa-dorsal lateral superior frontal gyrus were observed. Patients with bvFTD had significant atrophy and hypometabolism in all insula subregions and decreased metabolic connectivity in the whole brain, including vIa/dIa-middle temporal and vIa/dIa-temporal poles. The standardized uptake value ratios of vIa and dIa were negatively associated with Frontal behavior inventory disinhibition scale scores. Conclusion: Metabolic connectivity is altered in vIa and dIa subregions of the sub-insula in MAPT P301L mutation carriers before the occurrence of atrophy, hypometabolism, and clinical symptoms. [ABSTRACT FROM AUTHOR]

We have recently published the notion of the "vitals" of Parkinson's, a conglomeration of signs and symptoms, largely nonmotor, that must not be missed and yet often not considered in neurological consultations, with considerable societal and personal detrimental consequences. This "dashboard," termed the Chaudhuri's vitals of Parkinson's, are summarized as 5 key vital symptoms or signs and comprise of (a) motor, (b) nonmotor, (c) visual, gut, and oral health, (d) bone health and falls, and finally (e) comorbidities, comedication, and dopamine agonist side effects, such as impulse control disorders. Additionally, not addressing the vitals also may reflect inadequate management strategies, leading to worsening quality of life and diminished wellness, a new concept for people with Parkinson's. In this paper, we discuss possible, simple to use, and clinically relevant tests that can be used to monitor the status of these vitals, so that these can be incorporated into clinical practice. We also use the term Parkinson's syndrome to describe Parkinson's disease, as the term "disease" is now abandoned in many countries, such as the U.K., reflecting the heterogeneity of Parkinson's, which is now considered by many as a syndrome. [ABSTRACT FROM AUTHOR]

Neuronal intranuclear inclusion disease (NIID) is a rare but probably underdiagnosed neurodegenerative disorder due to pathogenic GGC expansions in the NOTCH2NLC gene. In this review, we summarize recent developments in the inheritance features, pathogenesis, and histopathologic and radiologic features of NIID that subvert the previous perceptions of NIID. GGC repeat sizes determine the age of onset and clinical phenotypes of NIID patients. Anticipation may be absent in NIID but paternal bias is observed in NIID pedigrees. Eosinophilic intranuclear inclusions in skin tissues once considered pathological hallmarks of NIID can also present in other GGC repeat diseases. Diffusion-weighted imaging (DWI) hyperintensity along the corticomedullary junction once considered the imaging hallmark of NIID can frequently be absent in muscle weakness and parkinsonism phenotype of NIID. Besides, DWI abnormalities can appear years after the onset of predominant symptoms and may even disappear completely with disease progression. Moreover, continuous reports of NOTCH2NLC GGC expansions in patients with other neurodegenerative diseases lead to the proposal of a new concept of NOTCH2NLC-related GGC repeat expansion disorders (NRED). However, by reviewing the previous literature, we point out the limitations of these studies and provide evidence that these patients are actually suffering from neurodegenerative phenotypes of NIID. [ABSTRACT FROM AUTHOR]

Background: White matter hyperintensities, a neuroimaging marker of small-vessel cerebrovascular disease and apolipoprotein ε4 (APOE4) allele, are important dementia risk factors. However, APOE4 as a key effect modifier in the relationship between white matter hyperintensities and grey matter volume needs further exploration. Methods: One hundred ninety-two early-stage dementia (including mild cognitive impairment and mild dementia) and 259 cognitively unimpaired participants from a neurocognitive research cohort with neuroimaging data, APOE genotyping, and neuropsychological assessments were studied. We investigated independent and interactive effects of white matter hyperintensities and APOE4 on whole-brain voxel-wise grey matter volume using voxel-based morphometry (uncorrected p < 0.001; minimum cluster size = 100 voxels). We further assessed interactive effects between APOE4 and white matter hyperintensities on global cognition, memory, and executive function in early-stage dementia and cognitively unimpaired participants. Results: Independent of APOE4 status, higher white matter hyperintensity load was associated with greater grey matter atrophy across frontal, parietal, temporal, and occipital lobes in cognitively unimpaired and early-stage dementia subjects. However, interaction analyses and independent sample analyses revealed that APOE4 non-carriers demonstrated greater white matter hyperintensity-associated grey matter atrophy compared to APOE4 carriers in both cognitively unimpaired and early-stage dementia groups. Additional confirmatory analyses among APOE4 non-carriers demonstrated that white matter hyperintensities resulted in widespread grey matter loss. Analyses of cognitive function demonstrated that higher white matter hyperintensity load was associated with worse global (Mini-Mental State Examination, Montreal Cognitive Assessment) and executive function (Color Trails 2) in APOE4 non-carriers compared to APOE4 carriers in early-stage dementia but not cognitively unimpaired participants. Conclusions: The association between white matter hyperintensities and grey matter loss is more pronounced in APOE4 non-carriers than APOE4 carriers in the cognitively unimpaired and early-stage dementia stages. Furthermore, white matter hyperintensity presence results in poorer executive function in APOE4 non-carriers compared to APOE4 carriers. This finding may have significant impact on the design of clinical trials with disease modifying therapies. [ABSTRACT FROM AUTHOR]

Background and purpose: A broad list of variables associated with mild cognitive impairment (MCI) in Parkinson disease (PD) have been investigated separately. However, there is as yet no study including all of them to assess variable importance. Shapley variable importance cloud (ShapleyVIC) can robustly assess variable importance while accounting for correlation between variables. Objectives of this study were (i) to prioritize the important variables associated with PD‐MCI and (ii) to explore new blood biomarkers related to PD‐MCI. Methods: ShapleyVIC‐assisted variable selection was used to identify a subset of variables from 41 variables potentially associated with PD‐MCI in a cross‐sectional study. Backward selection was used to further identify the variables associated with PD‐MCI. Relative risk was used to quantify the association of final associated variables and PD‐MCI in the final multivariable log‐binomial regression model. Results: Among 41 variables analysed, 22 variables were identified as significantly important variables associated with PD‐MCI and eight variables were subsequently selected in the final model, indicating fewer years of education, shorter history of hypertension, higher Movement Disorder Society–Unified Parkinson's Disease Rating Scale motor score, higher levels of triglyceride (TG) and apolipoprotein A1 (ApoA1), and SNCA rs6826785 noncarrier status were associated with increased risk of PD‐MCI (p < 0.05). Conclusions: Our study highlighted the strong association between TG, ApoA1, SNCA rs6826785, and PD‐MCI by machine learning approach. Screening and management of high TG and ApoA1 levels might help prevent cognitive impairment in early PD patients. SNCA rs6826785 could be a novel therapeutic target for PD‐MCI. ShapleyVIC‐assisted variable selection is a novel and robust alternative to traditional approaches for future clinical study to prioritize the variables of interest. [ABSTRACT FROM AUTHOR]

Blood neurofilament light chain (NfL) is an easily accessible, highly sensitive and reliable biomarker for neuroaxonal damage. Currently, its role in Parkinson's disease (PD) remains unclear. Here, we demonstrate that blood NfL can distinguish idiopathic PD from atypical parkinsonian syndromes (APS) with high sensitivity and specificity. In cross-sectional studies, some found significant correlations between blood NfL with motor and cognitive function, whereas others did not. In contrast, prospective studies reported very consistent associations between baseline blood NfL with motor progression and cognitive worsening. Amongst PD subtypes, especially postural instability and gait disorder (PIGD) subtype, symptoms and scores are reliably linked with blood NfL. Different non-motor PD comorbidities have also been associated with high blood NfL levels suggesting that the neuroaxonal damage of the autonomic nervous system as well as serotonergic, cholinergic and noradrenergic neurons is quantifiable. Numerous absolute NfL cutoff levels have been suggested in different cohort studies; however, validation across cohorts remains weak. However, age-adjusted percentiles and intra-individual blood NfL changes might represent more valid and consistent parameters compared with absolute NfL concentrations. In summary, blood NfL has the potential as biomarker in PD patients to be used in clinical practice for prediction of disease severity and especially progression. [ABSTRACT FROM AUTHOR]

The increasing availability of molecular genetic testing has changed the landscape of both genetic research and clinical practice. Not only is the pace of discovery of novel disease‐causing genes accelerating but also the phenotypic spectra associated with previously known genes are expanding. These advancements lead to the awareness that some genetic movement disorders may cluster in certain ethnic populations and genetic pleiotropy may result in unique clinical presentations in specific ethnic groups. Thus, the characteristics, genetics and risk factors of movement disorders may differ between populations. Recognition of a particular clinical phenotype, combined with information about the ethnic origin of patients could lead to early and correct diagnosis and assist the development of future personalized medicine for patients with these disorders. Here, the Movement Disorders in Asia Task Force sought to review genetic movement disorders that are commonly seen in Asia, including Wilson's disease, spinocerebellar ataxias (SCA) types 12, 31, and 36, Gerstmann‐Sträussler‐Scheinker disease, PLA2G6‐related parkinsonism, adult‐onset neuronal intranuclear inclusion disease (NIID), and paroxysmal kinesigenic dyskinesia. We also review common disorders seen worldwide with specific mutations or presentations that occur frequently in Asians. [ABSTRACT FROM AUTHOR]

Background: A delay in the detection of mild cognitive impairment (MCI) in the community delays the opportunity for early intervention. Accurate tools to detect MCI in the community are lacking. The Visual Cognitive Assessment Test (VCAT) is a visual based cognitive test useful for multilingual populations without the need for translation. Objective: Here, we evaluate the usefulness of VCAT in detecting MCI in a community population in Singapore. Methods: We recruited 301 participants from the community who completed a detailed neuropsychological assessment and 170 of them completed a 3T magnetic resonance imaging (MRI) brain scan. We performed a receiver operating characteristics analysis to test the diagnostic performance of VCAT compared to Montreal Cognitive Assessment (MoCA) in distinguishing MCI from cognitively normal (CN) by measuring area under the curve (AUC). To test for the association of VCAT with structural MRI, we performed a Pearson's correlation analysis for VCAT and MRI variables. Results: We recruited 39 CN and 262 MCI participants from Dementia Research Centre (Singapore). Mean age of the cohort was 63.64, SD = 9.38, mean education years was 13.59, SD = 3.70 and majority were women (55.8%). VCAT was effective in detecting MCI from CN with an AUC of 0.794 (95% CI 0.723–0.865) which was slightly higher than MoCA 0.699 (95% CI 0.621–0.777). Among subjects with MCI, VCAT was associated with medial temporal lobe atrophy (ρ = –0.265, p = 0.001). Conclusions: The VCAT is useful in detecting MCI in the community in Singapore and may be an effective measure of neurodegeneration. [ABSTRACT FROM AUTHOR]

Background: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients – mostly female – with GRN mutations; the prevalence was 1.2% –2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD. [ABSTRACT FROM AUTHOR]

Background: Parkinson's disease (PD) is a heterogeneous movement disorder with patients manifesting with either tremor-dominant (TD) or postural instability and gait disturbance (PIGD) motor subtypes. Small nerve fiber damage occurs in patients with PD and may predict motor progression, but it is not known whether it differs between patients with different motor subtypes. Objective: The aim of this study was to explore whether there was an association between the extent of corneal nerve loss and different motor subtypes. Methods: Patients with PD classified as TD, PIGD, or mixed subtype underwent detailed clinical and neurological evaluation and corneal confocal microscopy (CCM). Corneal nerve fiber density (CNFD), corneal nerve branch density (CNBD), and corneal nerve fiber length (CNFL) were compared between groups, and the association between corneal nerve fiber loss and motor subtypes was investigated. Results: Of the 73 patients studied, 29 (40%) had TD, 34 (46%) had PIGD, and 10 (14%) had a mixed subtype. CNFD (no./mm2, 24.09 ± 4.58 versus 28.66 ± 4.27; p < 0.001), CNBD (no./mm2, 28.22 ± 11.11 versus 37.37 ± 12.76; p = 0.015), and CNFL (mm/mm2, 13.11 ± 2.79 versus 16.17 ± 2.37; p < 0.001) were significantly lower in the PIGD group compared with the TD group. Multivariate logistic regression showed that higher CNFD (OR = 1.265, p = 0.019) and CNFL (OR = 1.7060, p = 0.003) were significantly associated with the TD motor subtype. The receiver operating characteristic (ROC) analysis demonstrated that combined corneal nerve metrics showed excellent discrimination between TD and PIGD, with an area under the curve (AUC) of 0.832. Conclusion: Greater corneal nerve loss occurs in patients with PIGD compared with TD, and patients with a higher CNFD or CNFL were more likely to have the TD subtype. CCM may have clinical utility in differentiating different motor subtypes in PD. [ABSTRACT FROM AUTHOR]

Objective: Frontotemporal dementia (FTD) encompasses a spectrum of neurodegenerative disorders, including behavioural variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA) and non‐fluent variant PPA (nfvPPA). While a strong genetic component is implicated in FTD, genetic FTD in Asia is less frequently reported. We aimed to investigate the frequency of Southeast Asian FTD patients harbouring known genetic FTD variants. Methods: A total of 60 FTD‐spectrum patients (25 familial and 35 sporadic) from Singapore and the Philippines were included. All underwent next‐generation sequencing and repeat‐primed PCR for C9orf72 expansion testing. Neurofilament light chain (NfL) levels were measured in a subset of patients. Results: Overall, 26.6% (16/60 cases) carried pathogenic or likely pathogenic variants in a FTD‐related gene, including: MAPT Gln351Arg (n = 1); GRN Cys92Ter (n = 1), Ser301Ter (n = 2), c.462 + 1G > C (n = 1); C9orf72 expansion (35–70 repeats; n = 8); TREM2 Arg47Cys (n = 1); and OPTN frameshift insertion (n = 2). Genetic mutations accounted for 48% (12/25) of patients with familial FTD, and 11.4% (4/35) of patients with sporadic FTD. C9orf72 repeat expansions were the most common genetic mutation (13.3%, 8/60), followed by GRN (6.7%, 4/60) variants. Within mutation carriers, plasma NfL was highest in a C9orf72 expansion carrier, and CSF NfL was highest in a GRN splice variant carrier. Interpretation: In our cohort, genetic mutations are present in one‐quarter of FTD‐spectrum cases, and up to half of those with family history. Our findings highlight the importance of wider implementation of genetic testing in FTD patients from Southeast Asia. [ABSTRACT FROM AUTHOR]

Objective biomarkers for Parkinson's Disease (PD) could aid early and specific diagnosis, effective monitoring of disease progression, and improved design and interpretation of clinical trials. Although alpha-synuclein remains a biomarker candidate of interest, the multifactorial and heterogenous nature of PD highlights the need for a PD biomarker panel. Ideal biomarker candidates include markers that are detectable in easily accessible samples, (ideally blood) and that reflect the underlying pathological process of PD. In the present study, we explored the diagnostic and prognostic PD biomarker potential of the SIMOA neurology 4-plex-A biomarker panel, which included neurofilament light (NFL), glial fibrillary acid protein (GFAP), tau and ubiquitin C-terminal hydrolase L1 (UCHL-1). We initially performed a serum vs plasma comparative study to determine the most suitable blood-based matrix for the measurement of these proteins in a multiplexed assay. The levels of NFL and GFAP in plasma and serum were highly correlated (Spearman rho-0.923, p < 0.0001 and rho = 0.825, p < 0.001 respectively). In contrast, the levels of tau were significantly higher in plasma compared to serum samples (p < 0.0001) with no correlation between sample type (Spearman p > 0.05). The neurology 4-plex-A panel, along with plasma alpha-synuclein was then assessed in a cross-sectional cohort of 29 PD patients and 30 controls. Plasma NFL levels positively correlated with both GFAP and alpha-synuclein levels (rho = 0.721, p < 0.0001 and rho = 0.390, p < 0.05 respectively). As diagnostic biomarkers, the control and PD groups did not differ in their mean NFL, GFAP, tau or UCHL-1 plasma levels (t test p > 0.05). As disease state biomarkers, motor severity (MDS-UPDRS III) correlated with increased NFL (rho = 0.646, p < 0.0001), GFAP (rho = 0.450, p < 0.05) and alpha-synuclein levels (rho = 0.406, p < 0.05), while motor stage (Hoehn and Yahr) correlated with increased NFL (rho = 0.455, p < 0.05) and GFAP (rho = 0.549, p < 0.01) but not alpha-synuclein levels (p > 0.05). In conclusion, plasma was determined to be most suitable blood-based matrix for multiplexing the neurology 4-plex-A panel. Given their correlation with motor features of PD, NFL and GFAP appear to be promising disease state biomarker candidates and further longitudinal validation of these two proteins as blood-based biomarkers for PD progression is warranted. [ABSTRACT FROM AUTHOR]