45 results
Search Results
2. Discussion On Preliminary Scientific Education In The Medical Curriculum. Opening Papers
- Author
-
Hickson, Sydney J., Keith, Arthur, Rutherford, E., Smith, J. Lorrain, and Smithells, Arthur
- Published
- 1920
3. Appearance of Mendel's Paper in American Libraries
- Author
-
Dorsey, M. J.
- Published
- 1944
4. Guide to the Literature on Tetrahymena: A Companion Piece to Elliott's "General Bibliography"
- Author
-
Corliss, John O.
- Published
- 1973
- Full Text
- View/download PDF
5. Denver: 128th Annual Meeting
- Published
- 1961
6. Preview of the 121st Meeting, AAAS, Berkeley, California, 26-31 December 1954
- Published
- 1954
7. The Texas Academy of Science
- Author
-
Parks, H. B.
- Published
- 1936
8. In Science Fields
- Published
- 1964
- Full Text
- View/download PDF
9. New Books.
- Subjects
LISTS ,BOOKS ,LIFE sciences ,DOMESTIC animals ,BIOCHEMISTRY ,SEROLOGY ,BIOLOGY ,ZOOLOGY ,IMMUNOLOGY - Abstract
The article presents a list of books related to science. It includes "Comparative Nutrition of Man and Domestic Animals," Vol. 2, by H. H. Mitchell, "Biochemistry of Semen and of the Male Reproductive Tract," by Thaddeus Mann, "Taxonomic Biochemistry and Serology," edited by Charles A. Leone, "An Introduction to Animal Biology," 6th Ed., by Dale C. Braungart and Rita Buddeke, "Watchers, Pursuers, and Masqueraders: Animals and Their Vision," by Edith Raskin, and "The Biochemical Aspects of Hormone Action," edited by Albert B. Eisenstein.
- Published
- 1964
- Full Text
- View/download PDF
10. <em>Candida krusei</em> Cytochrome <em>c</em> : a Correction to the Sequence.
- Author
-
Lederer, Florence
- Subjects
CANDIDA ,PROTEINS ,GLUTAMINE ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
11. Molecular Weight and Quaternary Structure of Yeast L-Lactase Dehydrogenase (Cytochrome b2).
- Author
-
Jacq, C. and Lederer, F.
- Subjects
DEHYDROGENASES ,MOLECULAR weights ,AMINO acids ,CYTOCHROME c ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b
2 [ABSTRACT FROM AUTHOR]- Published
- 1970
- Full Text
- View/download PDF
12. Molecular Weight and Quaternary Structure of Yeast L-Lactase Dehydrogenase (Cytochrome b2).
- Author
-
Jacq, C. and Lederer, F.
- Subjects
- *
DEHYDROGENASES , *MOLECULAR weights , *AMINO acids , *CYTOCHROME c , *BIOLOGY , *CHEMISTRY , *BIOCHEMISTRY - Abstract
Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]
- Published
- 1970
- Full Text
- View/download PDF
13. The Nucleotide Sequence of Methionine Transfer RNAM.
- Author
-
Cory, Suzanne and Marcker, K.A.
- Subjects
METHIONINE ,ESCHERICHIA coli ,TRANSFER RNA ,NUCLEOTIDE sequence ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNA
M , was purified from Escherichia coli strain CA265 labelled with32> P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH , where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]- Published
- 1970
- Full Text
- View/download PDF
14. Purification and Partial Characterisation of Rat-Liver Nuclear DNA Polymerase.
- Author
-
Hainer, Michael E., Wickremasinghe, R. Gitendra, and Johnston, Irving R.
- Subjects
DNA polymerases ,LIVER ,ENZYMES ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
15. Alkylation of Phosphates and Stability of Phosphate Triesters in DNA.
- Author
-
Bannon, Pierre and Verly, Walter
- Subjects
ALKYLATION ,PHOSPHATES ,ALKYLATING agents ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
16. The Use of Glucosamine as a Metabolic Probe in the Rat Diaphragm.
- Author
-
Lien Do Khac, Monique, Eboué-Bonis, Dominique, Chambaut, Anne-Marie, and Clauser, Hubert
- Subjects
GLUCOSAMINE ,INSULIN ,METABOLITES ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
1. The action of insulin on [
14 C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
17. An Unusual Group of Lysine-Rich Histones from Gonads of a Sea Cucumber, <em>Holothuria tubulosa</em>.
- Author
-
Phelan, James J., Subirana, Juan A., and Cole, R. David
- Subjects
GONADS ,HOLOTHURIA ,HISTONES ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
18. Another New Biology.
- Author
-
Sokal, Robert R.
- Subjects
BIOLOGY ,MOLECULAR biology ,BIOCHEMISTRY ,NEUROBIOLOGY ,SCIENTIFIC discoveries ,CYBERNETICS ,DIFFERENTIATION (Sociology) ,BIOLOGICAL evolution ,LIFE sciences - Abstract
The article discusses the development of an entirely new biology, based on advances in molecular biology and biochemistry. The study of neurobiology, both chemical and cybernetic, is recognized as the new biology of the coming decade. The science of development is looming on the edge of new discoveries and insights into the differentiation process. It explores the approaches to evolutionary biology, which requires quantitative techniques for the teaching of systematics, ecology, and evolutionary theory.
- Published
- 1970
- Full Text
- View/download PDF
19. Microbial Genetics in the USSR
- Author
-
Suskind, Sigmund R.
- Published
- 1960
20. INTERNATIONAL SYMPOSIUM ON ATOMIC AND MOLECULAR QUANTUM MECHANICS PROCEEDINGS AT SANIBEL ISLAND, 14-19 JANUARY, 1963
- Published
- 1963
21. AIBS ADHERENT SOCIETIES.
- Subjects
NONPROFIT organizations ,SOCIETIES ,PHYCOLOGY ,ASSOCIATIONS, institutions, etc. ,LIFE sciences ,TAXONOMY ,BIOCHEMISTRY ,CYTOLOGY ,BIOLOGY - Abstract
The article provides information about the Phycological Society of America (PSA) which was organized in 1946 and incorporated as an independent, nonprofit organization in 1964. It is an adherent society of the American Institute of Biological Sciences and an affiliate of the Botanical Society of America and the National Research Council. The PSA promotes the advancement of phycology and fosters research in taxonomy, morphology, cytology, ecology, physiology and biochemistry of the algae in the laboratory and in natural environments.
- Published
- 1966
- Full Text
- View/download PDF
22. LSD HINDERS ANTIBODY SYNTHESIS.
- Subjects
LSD (Drug) ,ASSOCIATIONS, institutions, etc. ,MENTAL health ,IMMUNOGLOBULINS ,INFECTION ,RESEARCH ,BIOCHEMISTRY ,BIOLOGY - Abstract
The article discusses the research conducted by Edward W. Voss, Jr., which provided evidence that d-lysergic acid (LSD) seriously hinders the ability of the body to recover from infection or disease. Voss states that antibody-producing spleen and lymph node cells incubated in the presence of minute quantities of LSD showed nearly total inhibition of antibody secretion. He concluded that either LSD or a metabolic byproduct of the drug may accumulate in tissue and exert these effects. Voss report was supported by the National Institutes of Mental Health and the Pharmaceutical Manufacturers Association.
- Published
- 1973
23. Studies on Lipase.
- Author
-
Ramachandran, S., Yip, Y.K., and Wagle, S.R.
- Subjects
LIPASES ,POTASSIUM phosphates ,CHROMATOGRAPHIC analysis ,BIOCHEMISTRY ,CHEMISTRY ,BIOLOGY - Abstract
Lipase from different tissues was extracted in potassium phosphate buffer containing sodium deoxycholate and purified by column chromatography on Sephadex and Sepharose gels. A 500fold purification was achieved by this procedure. This purified enzyme has an estimated molecular weight greater than 3 × 10
6 , and it runs as a single protein band in polyacrylamide preparative disc gel electrophoresis. After acetone — ether treatment of the etude rat pancreactic lipase extract. the resulting enzyme has an estimated molecular weight less than 3 × 104 , similar to those reported in the literature. The purified enzyme catalyzes the hydrolysis of long and short chain fatty acid glycerol esters. Phenoxybenzamine and phentolamine were found to inhibit the hydrolysis of the long chain fatty acid glycerol esters by the high molecular weight lipase, while that by the low molecular weight lipase was not inhibited. When administered to rats in vivo, phenoxybenzaamine and phentolamine inhibited the hydrolysis of tripalmitin by the epididymal fat lipase: but the pancreatic or intestinal lipase activity was not affected. [ABSTRACT FROM AUTHOR]- Published
- 1970
- Full Text
- View/download PDF
24. Molecular Weight and Quaternary Structure of Yeast L-Lactase Dehydrogenase (Cytochrome b2).
- Author
-
Monteilhet, C. and Risler, J.L.
- Subjects
CYTOCHROME b ,YEAST ,LACTASE ,DEHYDROGENASES ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
An X-ray diffraction study has been performed by the powder technique on two crystalline forms of yeast cytochrome b
2 . Type II (DNA-free) cytochrome b2 crystallizes in the trigonal system, the parameters of the unit cell being a = 168.2 Å and c = 112.0 Å, whereas type I (DNA-containing) cytochrome b2 crystallizes in the tetragonal system with a = 99.1 Å and c = 87.0 Å. Measurement of the crystal density and of the partial specific volume of the protein (found to be 0.754 cm³ g at 25°) enables a precise determination of the molecular weight of cytochrome b2 to be obtained. In this respect, the values 234 6000 - 8000 and 235000 - 10000 were found for type II and type I crystals respectively. These results, although in complete concordance, are quite different from the previously accepted value (approx. 180000 from sedimentation studies based on v = 0.71 cm³ /g). Space-groups and protein contents of the crystals show that this protein is composed of at least two, or even four, identical protomers. [ABSTRACT FROM AUTHOR]- Published
- 1970
- Full Text
- View/download PDF
25. Isolation and Characterization of Poreine Proelastase.
- Author
-
Gertler, Arich and Birk, Yehudith
- Subjects
ELASTASES ,PANCREAS ,GLOBULINS ,ELASTIN ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
1. Porcine proelastase was purified from frozen pancreases by extraction at pH 4.5, precipitation with (NH
4 )2 SO4 , isolation of the pH 5.7 insoluble euglobulin fraction, selective (pH dependent) adsorption on elastin and chromatography on CM-cellulose at pH 4.5. The active fraction was dialyzed and freeze dried. All the steps of purification except the last one were performed in presence of trypsin and chymotrypsin inhibitor AA from soybeans. All the process was done at 4°.2. The proelastase thus obtained was found to be pure by acrylamide gel electrophoresis and ultracentrifugation. The extinction coefficient of the freeze-dried material, E1 cm 1% at 280 nm was 17.0. The pure preparation was free of α-N-benzoyl-L-benzoyl-L-arginine [ABSTRACT FROM AUTHOR]- Published
- 1970
- Full Text
- View/download PDF
26. SOME ASPECTS OF THE COMPARATIVE BIOCHEMISTRY OF HUMAN KERATINS.
- Author
-
Scott, Allene
- Subjects
KERATIN ,PROTEIN fractionation ,BIOCHEMISTRY ,BIOLOGY ,CHEMISTRY ,MEDICAL sciences - Abstract
A series of comparative extractions of keratins has been carried out to provide a basis of comparison between the various resulting protein fractions. A method (modified from Matoltsy) utilizing homogenization at -4°C, in borate sodium hydroxide buffer, pH 9.6 was found to be generally satisfactory. Keratins so treated yielded two electrophoretically homogeneous main fractions, one with a high protein and low SH sulphur content and another with a lower protein, high SH content. An occasional third fraction was obtained, consisting of nuoleoprotein. Whole epidermis itself yielded three fractions, the first being identical with that of keratin, whilst the other two bore sufficient relation, to second fraction of keratin to suggest that the latter was derived from a partial combination of the two remaining whole epidermal fractions. These findings suggested a route of keratin formation. Psoriatic scales (a parakeratin) and psoriatic epidermis both gave a series of subfractions for fraction 2, suggesting that the normal contribution from fraction 3 did not occur. This was borne out by the presence of excess free SH groups and DNA which was found even in fraction 1. [ABSTRACT FROM AUTHOR]
- Published
- 1965
- Full Text
- View/download PDF
27. Polyribosome-Bound and Free-Cytoplasmic-Hemoglobin-Messenger RNA in Differentiating Avian Erythroblasts.
- Author
-
Spohr, Georges, Kayibanda, Boniface, and Scherrer, Klaus
- Subjects
RIBOSOMES ,ERYTHROCYTES ,DUCKS ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Cytoplasmic messenger-like RNA not associated with ribosomes has been investigated in immature duck erythrocytes and compared with polyribosome-bound messenger RNA. It is shown that 9-S RNA of the same electrophoretic mobility as the polyribosomal 9-S globin messenger is present free in the cytoplasm. Its rate of synthesis and decay is consistent with a role as a precursor of polyribosomal 9-S globin messenger. mRNA species different from 9-S RNA, among them a predominant 12-S species, are found associated with polyribosomes as well as in the free cytoplasmic pool. The free cytoplasmic mlRNA pool is more heterogeneous compared to the polyribosomal mRNAs, suggesting a translational control qualitativeiy and quantitatively selecting among the free cytoplasmic mlRNAs for those to be translated. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
28. The Effect of Structural Modifications of ATP on the Yeast-Hexokinase Reaction.
- Author
-
Hohnadel, David C. and Cooper, Cecil
- Subjects
GLUCOKINASE ,YEAST ,ADENOSINE triphosphate ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The specificity of yeast hexokinase for ATP was examined with the aid of a number of synthetic and natural analogs. The main features observed are: 1. The presence of a 2-amino group either alone or in combination with a 6-amino or 6-hydroxyl group inhibits catalysis. 2. The replacement of one or both hydrogen atoms of the 6-amino group with methyl groups does not have a large effect on either binding or catalysis. 3. The replacement of the nitrogen at position 7 with a carbon atom has virtually no effect. 4. The movement of the glycosidic bond from the N
9 to the N³ position has only a moderate effect on both Km and V. 5. The presence of both of the 2'- and 3'-cis hydroxyls in the ribose is important for catalysis. 6. The replacement of ribose with arabinose or glucose produces a large decrease in catalysis. experiments were carried out with the ATP analog containing glucose instead of ribose. It was found to be competitive for ATP and uncompetitive for glucose under the conditions used. These results are consistent with an ordered reaction mechanism. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
29. Evidence for Induced Fit of a Pseudo-Substrate Aspartate Aminotransferase.
- Author
-
John, Robert A. and Tudball, Norman
- Subjects
ASPARTATE aminotransferase ,HEART ,SERINE ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
1. Cytoplasmic aspartate aminotransferase from pig heart catalyses β-elimination of L-serine-o-sulphate and β-chloro-L-alanine. The rates of these reactions have been compared with the rates of the same reactions catalysed by free pyridoxal 5'-phosphate and CuCl
2 . 2. The effect of formate on the two enzyme-catalysed reactions has been studied and it has been shown that this anion competitively inhibits the serine sulphate reaction and activates the chloroalanine reaction by increasing kcat considerably. 3. The β-elimination of both these compounds is accompanied by progressive inactivation of the enzyme but whereas formate decreases the rate of inactivation by serine sulphate it increases the rate of inactivation by chloroalanine, 4. It is proposed that formate binds to the active site of the enzyme in a position normally occupied by the β-carboxyl group of aspartate, the carboxyl group of glutamate or the sulphate group of serine sulphate and that binding of the appropriate anion induces a change in the active site which accounts simultaneously for increased catalytic activity and increased inactivation. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
30. On the Presence of a Non-Trimethylated iso-1 Cytochrome <em>c</em> in a Wild-Type Strain of <em>Saccharomyces cerevisiae</em>.
- Author
-
Foucher, Marcelle, Verdière, Jacqueline, Lederer, Florence, and Slonimski, Piotr P.
- Subjects
SACCHAROMYCES cerevisiae ,CYTOCHROME c ,ION exchange chromatography ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Ion-exchange chromatography of the total cytochrome c extracted from a wild-type laboratory strain of Saccharomyces cerevisiae shows the presence of two minor cytochrome c peaks, besides the already known iso-1 and iso-2 cytochromes c. Their amino acid composition is very similar to that of iso-1, but one of them lacks the ε-N-trimethylated lysine residue characteristic of yeast cytochromes c, thus excluding, at least for this peak, an artifactual origin. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
31. Incorrect Aminoacylations Catalysed by the Phenylalanyl- and Valyl-tRNA Synthetases from Yeast.
- Author
-
Kern, Daniel, Giegé, Richard, and Ebel, Jean-Pierre
- Subjects
PHENYL compounds ,YEAST ,LIGASES ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
It has been found that purified phenylalanyl- and valyl-tRNA synthetases from yeast catalyse the mischarging of numerous heterologous Escherichia coli and even of homologous yeast tRNAs when special aminoacylation conditions are used. For instance E. coli tRNA
Ala , tRNAVal , tRNALys and yeast tRNAAla , tRNAVal can be incorrectly aminoacylated by yeast phenylalanyl-tRNA synthetase, whereas E. coli tRNAAla , tRNAMet , tRNAIle , tRNAThr and yeast tRNAAla , tRNAPhe can be mischarged by yeast valyl-tRNA synthetase. The production of errors is highly dependant on the experimental conditions used, as their number and their level is increased when the Mg2+ /ATP ratio or the enzyme concentration in the medium is increased or when the reactions are performed in the presence of dimethylsulfoxide. In the ease of phenylalanyl-tRNA synthetase, conditions can be found where practically all E. coli tRNAs are wrongly aminoacylated, although at different levels. On the other hand, in the case of homologous systems some errors can only be detected when purified tRNAs are used, thus suggesting, when total tRNA is used, a competition between the cognate and non-cognate tRNAs which minimises the mischarging. The comparison of the sequences of the cognate and non cognate tRNAs which are aminoacylated either by the yeast phenylalanyl- or valyl-tRNA synthetase led us to ascribe some importance to several regions inside of these tRNAs, for instance (a) the dihydrouracil arm, (b) the terminal part of the amino-acid acceptor stem and (c) the extra-loop. These regions should be essentially necessary for the establishment of the correct tri-dimensional conformation necessary for the recognition by the aminoacyl-tRNA synthetases. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
32. Hydrosoluble Complexes of Sterols, Sterol Esters and Their Precursors from <em>Zea mays</em> L.
- Author
-
Rohmer, Michel, Ourisson, Guy, and Brandt, Roger D.
- Subjects
STEROLS ,ESTERS ,CORN ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The study undertaken shows the existence of water-soluble complexes of sterols, sterol esters and their precursors (triterpenes and 4α-methylsterols) in a higher plant, Zea mays L. The leaves, roots and culture medium were treated separately in order to investigate the role and nature of these complexes. The sterols found in the water-soluble form represent 0.1-1% by weight of the total sterols in the plant. The composition of the hydrosoluble fraction of the sterols and their precursors is different from that of the lipid-soluble fraction, cholesterol, sitosterol and isofucosterol being preferentially complexed compared to campesterol and stigmasterol. This complex was found in the microsomal supernatant after homogenisation and also in the culture medium. The sterols are released from the complex by a treatment with pyrogallol under basic conditions or after repeated extraction with petroleum ether. The complex is precipitated with ethanol but not with trichloroacetic acid. The behaviour of several sterols on treatment with a solution of starch was investigated. Starch was able to complex with a large number of phytosterols unspecifically. The implication of this complex for the transport of sterols, for the biosynthesis of steroids and the ecological impact is discussed. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
33. Rodent and Human Acid &alpha-Glucosidase.
- Author
-
de Barsy, Thierry, Jacquemin, Paul, Devos, Pierre, and Hers, Henri-Géry
- Subjects
GLUCOSIDASES ,GLYCOGEN storage disease ,IMMUNOGLOBULINS ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The lysosomal acid α-glucosidase has been purified more than 10000-fold from rat and mice liver and from human placenta. The kinetic properties of the human enzyme are similar to those previously described for the rodent enzyme, with the main exception of the absence of inhibition by an excess of maltose. Antibodies were obtained by injection of the pure rat liver, mouse liver or human placental α-glucosidase to rabbits. The property of the enzyme of hydrolysing glycogen or to catalyse transglucosylation from maltose to glycogen could be nearly completely inhibited by the antibodies whereas the hydrolysis of small molecular substrates was much less inhibited. Within the same species, the same amount of enzyme was inhibited by a given amount of antibodies, whatever the tissue used as a source of enzyme. A partial cross-reactivity was observed from species to species. The presence of an immunologically reacting protein in tissues from patients with type-II-glycogenosis could not be demonstrated either by double-diffusion test or by antibodies consumption. Similar negative results were also obtained with normal human liver in which acid α-glucosidase has been inactivated at alkaline pH. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
34. Thermochemistry of Lysozyme-Inhibitor Binding.
- Author
-
Bjurulf, Carin and Wadsö, Ingemar
- Subjects
SACCHARIDES ,LYSOZYMES ,THERMOCHEMISTRY ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The binding of saccharide inhibitors to lysozyme has been studied using a microcalorimetric method. Measurements have been performed with N-acetyl-D-glucosamine (pH 5 and 25 and 40 °C), tri[N-acetyl-D-glucosamine] (pH 2, 5 and 7.6 at 25 °C and pH 5 at 40 °C) and with tetra[N-acetyl-D-glucosamine] (pH 2, 5 and 7.6 at 25 °C). From the results of the calorimetric measurements values for ΔG
0 , ΔH0 , ΔS0 and ΔCp 0 were derived for the binding processes. In addition to the saccharide-binding reactions, some model experiments were performed. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
35. Metabolism of Isolated Kidney Tubules.
- Author
-
Guder, Walter G. and Wieland, Otto H.
- Subjects
PARATHYROID hormone ,KIDNEY tubules ,FATTY acids ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The effects of parathyroid hormone, adenosine 3':5'-monophosphate (Ado-3':5'-P) and oleate on renal metabolism have been studied in isolated kidney-cortex tubules from starved rats. Substrate uptake and glucose formation have been determined with L-lactate, pyruvate, glutamate, and glycerol as substrates. The results indicate that parathyroid hormone and Ado-3':5'-P increase renal gluconeogenesis by the same mechanism, which however, differs from the effects brough about by free fatty acids: 1. Parathyroid hormone and Ado-3':5'-P increased glucose formation from L-lactate, pyruvate and glutamate. The stimulatory effect of parathyroid hormone was always smaller compared with that of Ado-3':5'-P. Glucose formation from L-lactate was shown to be stimulated with hormone doses as low as 1-10 nM. 01cate had an increasing effect on glucose formation from L-lactate and glycerol but no effect on glucose formation from 10 mM pyruvate and inhibited gluconeogenesis from glutamate. 2. The stimulatory action of parathyroid hormone and Ado-3':5'-P was accompanied by an increase in substrate uptake, whereas oleate decreased substrate uptake. 3. The effects of parathyroid hormone and Ado-3':5'-P on kidney-tubule metabolism were not additive, when both substances were added together. 4. All effects of oleate were found to be unchanged in the presence of parathyroid hormone and Ado-3':5'-P or both. The results suggest two different mechanisms which may regulate renal gluconeogenesis additively. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
36. Studies on Rat-Liver Ribosomes, Ribosomal Subparticles and RNA Fixed with Formaldehyde.
- Author
-
Dessev, George N. and Grancharov, Konstantin
- Subjects
RIBOSOMES ,LIVER ,FORMALDEHYDE ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Rat liver polysomes, single ribosomes, EDTA-produced subparticles and free ribosomal RNA were treated with formaldehyde and their properties were studied. The following results were obtained. 1. RNA can be isolated from fixed polysomes or subparticles by exhaustive digestion with pronase. Such RNA shows a normal electrophoretic behaviour in agar gel. 2. In free RNA treated with formaldehyde the mobility of 18-S and 28-S RNA fractions is reduced; latent breaks are not revealed by heating; sensitivity towards ribonuclease is increased. No such effects are observed with RNA treated with formaldehyde while in the particles. 3. In fixed polysomes or single ribosomes the two subparticles appear to be covalently bound through their proteins. No intermolecular bonding occurs between 18-S and 28-S RNA either fixed polysomes or in free RNA. The fixed ribosomes and subparticles can be fractionated by agar gel electrophoresis and give profiles similar to those of untreated particles. These resets may prove useful in combining CsCl density gradient fractionation with gel electrophoretic methods. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
37. Studies on the Heterogeneity of Mouse-Globin Messenger RNA.
- Author
-
Lanyon, W. George, Paul, John, and Williamson, Robert
- Subjects
RETICULOCYTES ,POLYACRYLAMIDE ,GLOBIN genes ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
Mouse reticulocyte messenger (9-S) RNA has been prepared by treatment of polysomes with sodium dodecylsulphate. On 6% polyacrylamide gels, two sharp and one more diffuse component can be resolved in the 9-S region, Messenger RNA prepared from 14-S mRNA. protein from EDTA-treated polysomes contains only the diffuse component. This component has priming activity for both α- and β-globin chains, and evidence is presented that it can be partially resolved into separate messengers for each chain. The two sharp components, which migrate more slowly than the globin mRNA, are associated with the 30-S ribosomal subunit after EDTA treatment, have no translational activity in a duck reticulocyte cell-free protein-synthesis system, and (unlike the diffuse component) are not destroyed by gentle sonication of polysomes to monosomes. The non-coding components comprise approximately one-third of the RNA in the 9-S region of most RNA preparations from mouse reticulocytes. The diffuse (coding) 9-S component from 14-S mRNA · protein runs as a sharp symmetrical peak in formamide-acrylamide gel electrophoresis, suggesting that there may be variation in secondary structure in aqueous solution rather than in molecular weight. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
38. Reconstitution of Qβ Replicase Lacking Subunit α with Protein-Synthesis-Interference Factor i.
- Author
-
Kamen, Robert, Kondo, Masatoshi, Römer, Werner, and Weissmann, Charles
- Subjects
PROTEIN synthesis ,RNA ,PROTEINS ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
We have isolated a form of Qβ replicase lacking subunit α and shown that it is deficient in the utilization of Qβ-plus strand RNA as template but competent to utilize Qβ-minus strands, poly(C) and "6-S" RNA. The functional identity of subunit α and protein-synthesis-inhibition factor i was proven by their equivalent capacity to restore full Qβ RNA-directed activity of α-less replicase. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
39. Conformation of Lysozyme in Aqueous Solution.
- Author
-
Hampe, Oscar Geraldo
- Subjects
LYSOZYMES ,PROTEINS ,CHROMATOGRAPHIC analysis ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The ionic strength, concentration, and temperature effects on the association-dissociation properties of lysozyme in aqueous solution have been studied by gel chromatography. The following results were obtained: 1. Increasing ionic strength leads to an increase m inter-conversion rate between the monomeric and associated forms. Between distilled water and 0.01 ionic strength, lysozyme shows a low velocity of interconversion, whereas between 0.01 and 0.2 rates are observed which are rapid as compared with the column fractionation time. 2. Analysis of concentration dependence indicates the formation of more highly associated forms than the darner. The data can be fitted within experimental error by an indefinite association with the same equilibrium constant for the addition of each successive monomer. 3. The equilibrium ratio for the slow polymerization process measured at temperatures between 15 ° and 40 °C yields the apparent thermodynamic quantities, ΔG°, ΔH
0 , and ΔS0 for the association reaction. This data is consistent with a hydrophobic interaction between lysozyme monomers and Sephadex gel matrix. It is suggested that the adsorption involves the tryptophan residues of the active centre. The enthalpy of the polymerization process is interpreted in terms of a conformational change of the same order of magnitude as on the bonding of N-acetylglucosamine to the enzyme. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
40. Regulation of D-Triokinase and NAD-Linked Glycerol-Dehydrogenase Activities in Rat Liver.
- Author
-
Veneziale, Carlo M.
- Subjects
PROTEIN kinases ,DEHYDROGENASES ,LIVER ,BIOLOGY ,CHEMISTRY ,BIOCHEMISTRY - Abstract
The specific activities expressed as µmol×g wet wt
-1 min-1 of D-triokinase and NADlinked glycerol dehydrogenase, with D-glyceraldehyde as substrate, were determined in the 27 500 × g supernatant fraction of livers from rats subjected to various dietary and hormonal programs. The specific activity of triokinase varied over a three-fold to four-fold range, being lowest in livers of diabetic rats fed a Purina Chow arid highest in livers of intact rats fed 72% fructose diets containing casein; total triokinase activity per liver was five-fold to six-fold greater in the latter group than in the former group. The specific activity of triokinase also increased in livers of rats fed diets of 72% glucose or 72% dextrin plus 18% casein. Fructose feeding caused a decrease in specific activity of glycerol dehydrogenase. Glucagon had no effect on the specific activity of either enzyme in livers of fasted rats. Cortisone tended to increase the specific activity of triokinase as well as its total activity in livers of rats fed the Purina Chow. After only 48 h of a 72% fructose-18% casein diet, liver weight was increased 50% relative to livers of rats fed the Purina Chow. Triokinase is subject to regulation in livers of adult male rats. The data indicate that the NAD-linked glycerol dehydrogenase is also subject to regulation but to a lesser extent. If glucagon does stimulate the flux of carbon in the triokinase or the NAD-linked glycerol dehydrogenase reactions, it is not as the result of increases iii enzyme concentrations as determined by assayable activity measurements. [ABSTRACT FROM AUTHOR]- Published
- 1972
- Full Text
- View/download PDF
41. The Theory of Alternative Substrates in Enzyme Kinetics and Its Application to Yeast Hexokinase.
- Author
-
Ricard, Jacques, Noat, Georges, Got, Claude, and Borel, Maguy
- Subjects
ENZYMES ,GLUCOKINASE ,YEAST ,BIOCHEMISTRY ,BIOLOGY ,CHEMISTRY - Abstract
The theory of alternative substrates has been thoroughly investigated. The reciprocal rate equations, for ordered and random kinetic mechanisms, in the presence of an alternative substrafe, have been developed. The conditions in which those equations give rise to either hyperbolic or linear reciprocal plots have been established. Degeneracy and constraint conditions of the various kinetic models have also been derived. Definite conclusions concerning the relevant mechanism can be obtained only if the Dalziel coefficients pertaining to the substrate are different from those corresponding to the alternative substrate. It follows from this, that the method termed "isotope competition", cannot be used to make a choice among various two-substrate mechanisms, and appears to be unfounded. The theory of alternative substrates has been applied to the study of yeast hexokinase. The results obtained are at variance with a random mechanism. They do agree, on the other hand, with a compulsory order of substrate binding on the enzyme, glucose being bound first. [ABSTRACT FROM AUTHOR]
- Published
- 1972
- Full Text
- View/download PDF
42. Interrelationships of Cancer Chemotherapy and Molecular Biology.
- Author
-
Nichol, C.A.
- Subjects
CANCER chemotherapy ,MOLECULAR biology ,CANCER treatment ,DRUG therapy ,DRUGS ,BIOCHEMISTRY ,CANCER cells ,ANTINEOPLASTIC agents ,BIOLOGY - Abstract
The article focuses on the interrelationships between molecular biology and cancer chemotherapy. It talks about the need for more effective drugs and the challenge to find means for effective prevention, detection and treatment of cancer. The presence of drug receptors in cancer cells and the ability of drugs acting upon quantitative metabolic differences to kill cancer cells are discussed. The article also discusses the use of drugs as probes for metabolic dissection and the applications of anticancer drugs to other fields of biology.
- Published
- 1967
- Full Text
- View/download PDF
43. Competition in Science
- Author
-
Hagstrom, Warren O.
- Published
- 1974
44. The Model Biology Curriculum
- Author
-
Novak, Alfred
- Published
- 1966
- Full Text
- View/download PDF
45. From Bench to Bedside: The Biologist in Drug Development
- Author
-
McKinney, Gordon R. and Stavely, Homer E.
- Published
- 1966
- Full Text
- View/download PDF
Discovery Service for Jio Institute Digital Library
For full access to our library's resources, please sign in.