Search

Presents upcoming research papers on biochemistry to be published in "European Journal of Biochemistry." Discussion of the molecular cloning and sequencing of a cDNA encoding the acyl carrier protein; Exploration of the primary structure of human thyroglobulin; Examination of the reversible activation of hydrogenase from Escherichia coli.

Presents a list of forthcoming papers to be published in 1980 issues of the "European Journal of Biochemistry." Subjects; Authors.

Lists forthcoming papers to be featured in the "European Journal of Biochemistry."

Presents a list of papers scheduled to be published in the "European Journal of Biochemistry," as of August 15, 1992. Topics; Authors.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Lists research papers scheduled for publication in the "European Journal of Biochemistry," in 1989. Topics; Authors; Data presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers scheduled to be pubilshed in the "European Journal of Biochemistry," in 1988. Subjects; Authorship.

Presents a list of forthcoming papers scheduled for publication in the "European Journal of Biochemistry," in 1988. Topics; Authors; Studies and data to be presented.

Lists the forthcoming papers to be published in the "European Journal of Biochemistry."

Lists titles of research papers to be published in the "European Journal of Biochemistry."

Presents a list of forthcoming papers on biochemistry which appeared in the January 1983 issue of the "European Journal of Biochemistry."

The deoxyoctanucleotide (5′-3′)d(A-A-G-G-A-G-G-T), which is complementary to the 3′ end of 16-S RNA, inhibits the formation of the complex between the 30-S subunit and MS2 RNA described in the preceding paper. If the complex is preformed, the octanucleotide cannot prevent entry of the complex into the ribosome cycle upon supplementation with the components for protein synthesis. The subunit · MS2-RNA complex is unable to bind the octanucleotide. It is concluded that in the subunit · phage-RNA initiation precursor the 16-S terminus is base-paired with a complementary MS2 RNA sequence. Edeine, aurintricarboxylic acid and antibodies against ribosomal protein S1 prevent the association of phage RNA with 30-S subunits. These compounds do not, however, inhibit the binding of (5′-3′)d(A-A-G-G-A-G-G-T) to 30-S subunits. It is concluded that the formation of the complex between MS2 RNA and 30-S subunits does not depend solely on the Shine and Dalgarno base-pairing reaction. [ABSTRACT FROM AUTHOR]

With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]

Adult bovine aortic endothelial (ABAE) cells, exposed to serum-free medium, specifically bind 125I-labeled human high-density lipoprotein (125I-HDL). Addition of human lipoprotein-deficient serum (LPDS) reduces the specific binding of 125I-HDL in a concentration-dependent manner, such that LPDS at a concentration of 6 mg protein/ml almost completely inhibits the specific binding of 125I-HDL. ABAE cultures exposed to 125I-labeled LPDS (125I-LPDS) specifically bind two peptides, which appear as minor iodinated components in 125I-LPDS. The binding of these two components is abolished in the presence of excess amounts of unlabeled LPDS or HDL. Preincubation of ABAE cells with 25-hydroxycholesterol (25-HC) results in an increase in the binding of the two 125I-LPDS components, similar to the increase observed in 125I-HDL binding in the presence of 25-HC. These two LPDS components comigrate on sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) with apolipoproteins A-I and A-IV of molecular masses 28 kDa and 43 kDa respectively. Furthermore, these two proteins were transfered from the SDS gel to nitrocellulose paper and interacted specifically with anti-(A-I) and anti-(A-IV) sera respectively. When ABAE cultures, pretreated with 25-HC in the presence of LPDS, are subjected to cell-surface iodination, the A-IV appears as one of the major proteins on the cell surface accessible to iodination. The interaction of A-IV with the cell surface of 25-HC-treated cells is not specific to ABAE cells and appears also in human skin fibroblasts. Analysis of the relative amounts of various apolipoproteins in the 125I-HDL bound to ABAE cells demonstrates a decrease in the relative amount of iodinated A-II concomitant with increase in the relative amounts of the other iodinated apolipoproteins, when compared to the composition of the native 125I-HDL. These changes are similar whether the binding is done in the presence or absence of LPDS. It indicates that the decrease in 125I-HDL binding in the presence of LPDS is not due to displacement of the iodinated apolipoproteins A-I and A-IV in the 125I-HDL by unlabeled A-I and A-IV present in LPDS. The results indicate that free apolipoproteins A-I and A-IV, present in LPDS, can displace HDL on the cell surface of ABAE cells. Thus, free A-I and A-IV, present in plasma, control the binding of HDL to endothelial cells and may regulate the process of cholesterol removal from the cells performed by HDL. [ABSTRACT FROM AUTHOR]

Virginiamycin S is an inhibitor of protein synthesis in vivo. In this paper we show by equilibrium dialysis that it binds specifically to the 50-S subunit of Escherichia coli ribosomes, with one binding site per subunit. This binding is not altered by the presence of chloramphenicol, tetracycline or puromycin but is competed for by erythromycin. Using the splitting-reconstitution method, it could be demonstrated that protein L16 is absolutely required for the binding of virginiamycin S to the 50-S subunit. [ABSTRACT FROM AUTHOR]

On mild acid hydrolysis of lipolysaccharide from Shigella dysenteriae type 3 the O-specific polysaccharide (hapten) was obtained which appeared to be acidic branched hexosaminoglycan. The repeating unit of this polysaccharide represents a pentasaccharide composed of two D-galactose residues, N-acetyl-D-galactosamine, D-glucose and unidentified acidic component. On the basis of methylation analysis, periodate oxidation, partial acid hydrolysis and chromic anhydride oxidation it is concluded that the structure of the chemical repeating unit of polysaccharide is -3)β-D-GalNAcp(1-3)α-D-Galp(1-6)-D-Galf(1- ↑ 14A(1-6)α-D-Glcp. where Glcp is glucopyranose, Galp is galactopyranose, Galf is galactofuranose, GaiNAcp is 2-acetamido-2-deoxygalactopyranose and where the configuration of galactofuranoside glycosidic linkage and the structure of the acidic monosaccharide A are not known. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The neurohypophysial hormones of a chondrostean, the sturgeon (Acipenser sp.), have been purified by adsorption onto neurophysin, dissociation of the complex hormone-protein by trichloroacetic acid precipitation and isolation of active peptides, from the supernatant solution, by paper chromatoelectrophoresis. Arginine vasotocin has been characterized by amino acid composition, chromatographic and electrophoretic migrations and pharmacological properties as well. The amount of arginine vasotocin (about 50 nmol per g pituitary powder) is intermediary between those found for bony fishes about 1000 nmo]/g) and cartilaginous fishes (about 5 nmol/g). A second hormone, which can be classified in the oxytocin-likc type by its electrophoretic nigration and its pharmacological properties, has been disclosed. The very weak amount did not allow chemical identification. However the chromatographic behaviour and the pharmacological ‘profile’ indicate that this hormone differs from the six known oxytocin-like peptides. [ABSTRACT FROM AUTHOR]

Beside the pre-existing lipoxygenase (LOX-1) present in quiescent grains, a new lipoxygenase (LOX-1) is induced in embryos of germinating barley (Holtman, W. L. Van Duijin, G., Sedee, N. J. A. & Douma, A. C. (1996) Plant phsiol. III, 569 -576 ]. The fact that LOX-1 and LOX-2 from different products after incubation with linoleic acid, the (9S)- and (13S)-hydroperoxides, respectively [Van Aarle, P.G. M., De Barse, M. M. J., Veldink, G. A. 7 Vliegenthart, J. F. G. (1991) FEBS lett. 280, 159 - 162; Doderer, A., Kokkelink, I., Van der Veen, S., Valk, B. E., Schram. A. W. & Douma. A. C. (1992) Biochim. Biophys. Acta 1120, 97 - 104]. and differ in temporal expression, suggest different physiological functions for the two isoenzymes at the onset of germination. We aimed to obtain more information about these functions by studying the substrate and product specificities of both isoenzymes. Analyses of the products formed from linoleic acid confirmed that LOX-1 oxygenated at C9, and LOX-2 at C13. When testing more complex substrates, it was found that both LOX-1 and LOX-2 were capable of metabolizing esterified fatty acids. Km values from both isoenzymes for free fatty acids were much lower than for esterified fatty acids (7 - 35- fold for LOX-1 versus 2 - 8 fold for LOX-2). Interestingly, LOX-1 showed significantly higher Km values for esterified fatty acids than did LOX-2. This was reflected by analyses of the products formed from di- and tri-linoleoylglcerol: LOX-2 formed higher amounts of oxygenated polyunsaturated fatty acids within the esterified lipids than did LOX-1, with a corresponding larger extent of oxygenation. In order to identify potential endogenous substrates, we analyzed free and esterified lipids in total lipid extracts from barley after different periods of germination for LOX-derived products. The results indicated that esterified fatty acids were preferentially metabolized by LOX-2 activity. Analysis of the positional specificity within the lipids after alkaline hydrolysis revealed that only (13S)-hydroxy derivatives were formed, indicating the in vivo action of LOX-2 is capable of oxygenating storage lipids and suggest that during the onset of germination LOX-2 may be involved in oxygenation of esterified polyunsaturated fatty acids in barley seeds. We suggest that the oxygenation of these lipids precedes the onset of their catabolism and that the degradation product. (9Z11.11E,13S)-13-hyrdroxy-octadecadienoic acid, serves as an endogenous substrate for β-oxidation and therefore as a carbon source for the growing barley embryo. [ABSTRACT FROM AUTHOR]

As a step towards understanding the role of nuclear ribonucleoprotein particles (hnRNA · proteins) in the nucleocytoplasmic transfer of heterogenous nuclear RNA sequences destined to become the cytoplasmic messenger RNA, the phosphorylation in vivo of the protein moiety of these hnRNA · proteins from HeLa cells has been studied. After exposure of HeLa cells to [32P]orthophosphate in vivo, purified hnRNA · proteins were found to contain radioactivity covalently bound to proteins in the form of serine and threonine phosphate esters. The association of these phosphoproteins with hnRNA was demonstrated by sedimentation analysis in sucrose gradients, isopyenic banding in cesium chloride density gradients and chromatography on oligo(dT)-cellulose. The pattern of radioactive phosphorylated species has been analysed by electrophoresis on sodium dodecylsulphate/polyacrylamide slab gels followed by autoradiography. Although some hot- trichloroacetic-acid-resistant 32P radioactivity was present throughout the gel, the highest amount of label was found associated with four discrete bands of molecular weights 28000, 30000, 37000 and 52000. Incorporation of 32P into hnRNA proteins could be detected after labeling periods as short as 15 min, the same species being labeled after 1 and 24-h labeling times. Although all the above species appear to be present in hnRNA · proteins of different size classes, as resolved by sedimenta- tion through sucrose gradients, their relative proportion is not reproducibly constant. Exposure of hnRNA · proteins to conditions of increasing ionic strength led to the ready disso- ciation of the 28000-Mr species at variance with other labeled species which appeared to be more firmly bound to hnRNA than the bulk of proteins. Upon treatment with pancreatic and T1 ribonucleases, the 28000-Mr species was also preferentially released while the 37000-Mr one was the main phosphorylated species remaining associated with core structures containing an RNA component resistant to nucleases which is now under further characterization. [ABSTRACT FROM AUTHOR]

Antibodies elicited by a synthetic immunogen, (Glu60Ala40)n -[Ala-DGlu(Lys-DAla-DAla)]5.1, related to a major class of peptidoglycan precursors, were purified by an affinity column of Sepharose 4B, to which the hapten, Ala-DGlu(Lys-DAla-DAla), was covalently attached and were then coupled to Sepharose 4B. Low-molecular-weight [14C]alanine-labeled products secreted by Micrococcus luteus cells grown in the presence of penicillin G were applied to the antibody-coupled gel. The bound material, which should be univalent to the antibody, was eluted completely by 0.02 mM α-tert-butyl- oxycarbonyl-lysyl-D-alanyl-D-alanine. High-molecular-weight uncross-linked soluble peptidoglycan secreted by M. luteus cells grown in the presence of penicillin G was completely bound to the affinity column, regardless of whether the soluble peptidoglycan was labeled in its alanine moieties or in its glucosamine and muramic acid residues A minor fraction of the bound soluble peptidoglycan was released with 0.02 mM tripeptide (‘paucivalent’ fraction). The remainder of the bound material was eluted with 2 mM tripeptide, indicating that a major portion of the high-molecular-weight material was ‘multivalent’. When glycan-labeled soluble peptidoglycan was stored in buffered saline at -5 °C for several months, a fraction of the labeled material was no longer bound to the affinity gel. Digestion of this non-binding fraction, as well as the paucivalent and multivalent fractions with hen egg-white lyso- zyme, was consistent with the affinity chromatographic data. These results indicate that an amidase present in these preparations cleaved different amounts of peptide from the soluble peptidoglycan preparations, producing strands which are polydisperse with respect to their peptide substitution. [ABSTRACT FROM AUTHOR]

Red kangaroo (Macropus rufus) ribonuclease was isolated from pancreatic tissue by affinity chromatography. The amino acid sequence was determined by automatic sequencing of overlapping large fragments and by analysis of shorter peptides obtained by digestion with a number of proteolytic enzymes. The polypeptide chain consists of 122 amino acid residues. Compared to other ribonucleases, the N-terminal residue and residue 114 are deleted. In other pancreatic ribonucleases position 114 is occupied by a cis proline residue in an external loop at the surface of the molecule. Other remarkable substitutions are the presence of a tyrosine residue at position 123 instead of a serine which forms a hydrogen bond with the pyrimidine ring of a nucleotide substrate, and a number of hydrophobic- hydrophilic interchanges in the sequence 51–55, which forms part of an α-helix in bovine ribo-nuclease and exhibits few substitutions in the placental mammals. Kangaroo ribonuclease contains no carbohydrate, although the enzyme possesses a recognition site for carbohydrate attachment in the sequence Asn-Val-Thr (62–64). The enzyme differs at about 35–40% of the positions from all other mammalian pancreatic ribonucleases sequenced to date, which is in agreement with the early divergence between the marsupials and the placental mammals. From fragmentary data a tentative sequence of red-necked wallaby (Macropus rufogriseus) pancreatic ribonuclease has been derived. Eight differences with the kangaroo sequence were found. [ABSTRACT FROM AUTHOR]

Examination of the role of Escherichia coli dnaG function in different stages of M13 phage DNA synthesis by ultracentrifugal analysis of intracellular phage DNA in a thermosensitive dnaG mutant shows that: (a) the formation of parental double-strand replicative-form DNA (rfDNA) from the infecting virus is independent of dnaG function (b) the synthesis of progeny rfDNA requires dnaG product; (c) after a pool of rfDNA is made up, dnaG function is not required for the progeny single- strand DNA (ssDNA) synthesis. The ssDNAs produced under nonpermissive condition are mostly circular and biologically functional. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]

A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]

1. The action of insulin on [14C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]

Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]

The cell wall of Brevibacterium sp. VKM Ac-2118 isolated from a frozen (mean annual temperature −12 °C) late Pliocene layer, 1.8–3 Myr, Kolyma lowland, Russia, contains mannitol teichoic acid with a previously unknown structure. This is 1,6-poly(mannitol phosphate) with the majority of the mannitol residues bearing side phosphate groups at O-4(3). The structure of the polymer was established by chemical methods, NMR spectroscopy, and MALDI-TOF mass spectrometry. [ABSTRACT FROM AUTHOR]

The field of apoptosis is unusual in several respects. Firstly, its general importance has been widely recognized only in the past few years and its surprising significance is still being evaluated in a number of areas of biology. Secondly, although apoptosis is now accepted as a critical element in the repertoire of potential cellular responses, the picture of the intra-cellular processes involved is probably still incomplete, not just in its details, but also in the basic outline of the processes as a whole. It is therefore a very interesting and active area at present and is likely to progress rapidly in the next two or three years. This review emphasizes recent work on the molecular mechanisms of apoptosis and, in particular, on the intracellular interactions which control this process. This latter area is of crucial importance since dysfunction of the normal control machinery is likely to have serious pathological consequences, probably including oncogenesis, autoimmunity and degenerative disease. The genetic analysis of programmed cell death during the development of the nematode Caenorhabditis elegans has proved very useful in identifying important events in the cell death programme. Recently defined genetic connections between C. elegans cell death and mammalian apoptosis have emphasized the value of this system as a model for cell death in mammalian apoptosis have emphasised the value of this system as a model for cell death in mammalian cells, which, inevitably, is more complex. The signals inducing apoptosis are very varied and the same signals can induce differentiation and proliferation in other situations. However, some pathways appear to be of particular significance in the control of cell death; recent analysis of the apoptosis induced through the cell-surface Fas receptor has been especially important for immunology. Two gene families are dealt with in particular detail because of their likely importance in apoptosis control. These are, first, the genes encoding the interleukin-1β-converting enzyme family of cysteine proteases and, second, those related to the proto-oncogene bcl-2. Both of these families are homologous to cell death genes in C. elegans. In mammalian cells the number of members of both familish which have been identified is growing rapidly and considerable effort is being directed towards establishing the roles played by each member and the ways in which they interact to regulate apoptosis. Other genes with established roles in the regulation of proliferation and differentiation are also important in controlling apoptosis. Several of these are known proto-oncogenes, e.g. c-myc, or tumour suppressors, e.g. p53, an observation which is consistent with the importance of defective apoptosis in the development of cancer. Viral manipulation of the apoptosis of host cells frequently involves interactions with these cellular proteins. Finally, the biochemistry of the closely controlled cellular self-destruction which ensues when the apoptosis programme has been engaged is also very important. The biochemical changes involved in inducing phagocytosis of the apoptotic cell, for example, allow the process to be neatly integrated within the tissues, under physiological conditions. Molecular defects in this area too may have important pathological consequences. [ABSTRACT FROM AUTHOR]

Focuses on the construction of a three-dimensional model of manganese peroxidase from Phanerochaete chrysosporium, using lignine peroxidase as the structural scaffold. Model refinement by molecular mechanisms calculation; Assessment of the quality of the model on the basis of the propensity of the amino acids to be inserted into regular secondary-structure elements.

Describes the cloning of PMAP-37, an antibacterial peptide from pig myeloid cells. Characteristics of the preproregion of the peptide; Growth of the strains of Gram-negative and Gram-positive bacteria.

Studies the expression and characterization of Geotrichum candidum (GC) lipase I gene. Sequence variation within the nitrogen-terminal 194 amino acids of the GC lipase; Comparison of the specificity profile with lipase II.

Examines the mathematical analysis of enzymic reaction systems by using the optimization principles. Importance of the mathematical models of metabolic networks in theoretical biology; Aspects of the irreversible two-step kinetic mechanism; Investigation of the structural design of biochemical reaction systems.

Improved methodology was used to establish that the phosphorylation of a serine located 10 residues from the N-terminus of glycogen synthase (N10) increases from 0.12 mol · mol-1 to 0.54 mol · mol-1 in vivo in response to adrenalin. The only ‘N10 kinase’ detected in muscle extracts was casein kinase-1 (CK1), although its activity was unaffected by injection of adrenalin in vivo or by incubation with cyclic-AMP-dependent protein kinase and MgATP in vitro. Prior phosphorylation of the serine residue N7 by phosphorylase kinase increased sixfold the rate of phosphorylation of glycogen synthase by CK1, and altered the specificity of CK1 so that it phosphorylated the serine residue N10 specifically. Stoichiometric phosphorylation of N7 decreased the activity ratio (± glucose 6-phosphate) of glycogen synthase from 0.80 to 0.45, and subsequent phosphorylation of N10 to 0.8 mol · mol-1 produced a further decrease to 0.17, demonstrating that N10 phosphorylation inhibits glycogen synthase. The major ‘N10 phosphatase’ in skeletal muscle extracts was identified as the glycogen-associated form of protein phosphatase-1 (PP1G), accounting for approximately 75% of the N10 phosphatase activity in the extracts and about 90% of the activity in isolated glycogen particles. Phosphorylation of N10, after prior phosphorylation of N7, decreased the rate of dephosphorylation of N7. These results, in conjunction with previous findings, establish that adrenalin inhibits glycogen synthase by increasing the phosphorylation of N7, N10 and three further serines located 30,4 and 38 residues from the start of the C-terminal CNBr peptide (termed the region C30-C38). They also indicate that increased phosphorylation of N10, the region C30-C38, and perhaps N7, is initiated through the inhibition of PP1G by adrenalin, which results from phosphorylation of its glycogen-targetting subunit by cyclic-AMP-dependent protein kinase [Hubbard, M. J. & Cohen, P. (1989) Eur. J. Biochem. 186, 711–716]. The conclusion that direct phosphorylation of glycogen synthase by cyclic-AMP-dependent protein kinase makes little contribution to inhibition by adrenalin, is at variance with the teachings of the major textbooks of biochemistry. [ABSTRACT FROM AUTHOR]

1. The summation theorem C1J + ... + CnJ = 1 for flux control coefficients C[ is shown to be equivalent to the assumption that flux J is a homogeneous function of degree 1 of enzyme concentrations E1, ..., En, that is to the assumption J (tE1, ..., tEn) = tJ (E1, ... , En) for any t ≠ 0. Likewise, the summation theorem C1Xj + ... + CnXj = 0 for concentration control coefficients CiXj is equivalent to homogeneity of degree 0 of steady-state metabolite concentrations Xj, or to Xj (tE1 ,..., En) = Xj (E1, ..., En). From this equivalence it is obvious that metabolic control analysis applies only to homogeneous systems. 2. The summation theorem for flux control coefficients is shown to be equivalent to that for concentration control coefficients, provided all reaction rates vi are homogeneous functions of enzyme concentrations Ei. 3. The equivalence between homogeneity of flux J and the summation theorem for flux control coefficients is used to analyse branching of fluxes in metabolic pathways in terms of flux control coefficients. [ABSTRACT FROM AUTHOR]

Calmodulin contains several binding sites for hydrophobic compounds. The apparent specificity of various ‘calmodulin antagonists’ for these sites was investigated. The Ki values for the inhibition of calmodulin-activated cyclic-nucleotide phosphodiesterase and myosin light-chain kinase was determined. In addition, the Kd values of the same compounds for binding to calmodulin were measured. The compounds could be separated into four. groups. Group I and II compounds inhibited competitively the activation of the phosphodiesterase and myosin light-chain kinase by calmodulin. Group I compounds inhibited the activation of the phosphodiesterase and myosin light-chain kinase at identical concentrations. In contrast, group II compounds inhibited the activation of the phosphodiesterase at 5–10-fold lower concentrations than that of myosin light-chain kinase. Group III compounds inhibited the activation of these enzymes by an uncompetitive mechanism. Group IV compounds inhibited the activation of the phosphodiesterase with Ki values above 10 μM and did not affect the activation of myosin light-chain kinase. Binding of [3H]bepridil to calmodulin under equilibrium conditions yielded one high-affinity site (apparent Kd 0.4 μM) and four low affinity sites (apparent Kd 44 μM). Group I compounds interfered with the binding of bepridil to the high and low-affinity sites in a competitive manner. Group II compounds interfered in a non-competitive manner with the high-affinity site and apparently competed only with one of the low-affinity sites. Group III compounds did not compete with any of the bepridil-binding sites. Nimodipine, a group III compound, bound to one site on calmodulin with a Kd value of 1.1 μM. Other dihydropyridines competed with [3H]nimodipine for this site. The group I and II compounds, trifluoperazine and prenylamine, did not affect the binding of [3H]nimodipine. These data show that ‘calmodulin antagonists’ can be differentiated into at least three distinct groups. Kinetic and binding data suggest that the three groups bind to at least three different sites on calmodulin. Selective occupation of these sites may inhibit specifically the activation of distinct enzymes. [ABSTRACT FROM AUTHOR]

Changes in the concentration of several metabolites and enzymes related to carbohydrate metabolism were measured during the growth of Saccharomyces cerevisiae on a mineral medium containing glucose as the limiting nutrient. When about 50% of the original glucose was used the exponential phase ended and the culture entered a ‘transition’ phase before the complete exhaustion of glucose. In this transition phase several metabolic changes occurred. cAMP, that decreased along growth, reached a constant value of about 0.7 nmol/g dry weight. A pronounced drop in fructose-6-phosphate-2-kinase activity and in the concentration of fructose 2,6-bisphosphate and fructose 1,6-bisphosphate was observed accompanied by a less marked decrease in hexose monophosphates. Trehalase activity also dropped and reached a minimal value at the onset of the stationary phase when synthesis of trehalose began. Glycogen concentration and glycogen synthase activity increased sharply during the transition phase. Plasma membrane ATPase began to increase at the middle of the exponential phase and then, coincident with the glucose exhaustion, a 90% decrease in the measurable activity was observed. [ABSTRACT FROM AUTHOR]

We have monitored the thermotropic behavior of mixed dimyristoylglycerophosphoserine (Myr2GroPSer)/dimyristoylglycerophosphocholine (Myr2GroPCho) and Myr2GroPSer/dipalmitoylglycerophosphocholine (Pam2GroPCho) vesicles in the presence of blood-clotting factor Va, using 1,6-diphenyl-1,3,5-hexatriene as a lipid probe. The Ca2+-independent interaction of factor Va with these vesicles caused a small increase (1-2&geg;C) in the phase transition temperature, regardless of whether Myr2GroPChe was the lower or higher-melting component of the mixed vesicles. The major effect of factor Va was to increase the polarization of diphenylhexatriene when the mixed vesicles were in the liquid crystalline phase. The protein did not change the anisotropy in the bilayer gel state. The increase in the polarization value above the transition temperature closely correlated with the amount of phospholipid-bound factor Va, as verified by a direct binding technique. In addition, we found that the affinity of factor Va for Myr2GroPSer/Myr2GroPCho and Myr2GroPSer/Pam2GroPCho greatly increased at temperatures above the transition temperatures. Time-dependent fluorescence anisotropy measurements of diphenylhexatriene embedded in vesicles in the liquid crystalline state give fluorescence decay curves which can best be fitted by two exponential functions with two rotational correlation times and a constant term. Vesicles composed of Myr2GroPSer exhibit more ordering than Myr2GroPCho vesicles. However, the order parameter of mixed vesicles composed of 40% Myr2GroPSer and 60% Myr2GroPCho (mol/mol) approached that of Myr2GroPCho. Factor Va dramatically increased the longer rotational correlation time of diphenylhexatriene embedded in mixed vesicles in the liquid crystalline state from 3.7 ns to about 17 ns. The second rank-order parameter increased only slightly, but the calculated steady-state auisotropy increased by twofold. These results indicate that the acidic phospholipid-dependent binding of factor Va to mixed vesicles has an ordering effect on the acyl chains of the acidic phospholipids in the outer layer, but leaves the bulk of the phospholipids, mainly phosphatidylcholine, unaltered. None of the factor-Va-induced alterations in the anisotropy parameters point to the occurrence of lateral phase separation. [ABSTRACT FROM AUTHOR]

A specific ribonuclease was detected and purified to homogeneity from six-day-old larvae of the insect Ceratitis capitata and its homogeneity was checked by analysis in polyacrylamide gels in the presence of sodium dodecyl sulfate. The nuclease specifically degrades poly(U) and poly(C) whilst it fails to do so with other single-stranded homopolyrihonucleotides. The enzyme has a pH optimum in the region 7–9 and relative molecular mass of about 25000. The effect of this ribonuclease on the integrity of RNAs isolated from six-day-old larvae or rat liver was also studied. [ABSTRACT FROM AUTHOR]

Hyoscyamine 6β-hydroxylase, a 2-oxoglutarate-dependent dioxygenase that catalyzes the hydroxylation of l-hyoscyamine to 6β-hydroxyhyoscyamine in the biosynthetic pathway leading to scopolamine [Hashimoto, T. & Yamada, Y, (1986) Plant Physiol. 81, 619–625] was purified 310-fold from root cultures of Hyoscyamus niger L. The enzyme has an average Mr of 4l000 as determined by gel filtration on Superose 12 and exhibited maximum activity at pH 7.8. l-Hyoscyamine and 2-oxoglutarate are required for the enzyme activity, with respective Km values of 35 μM and 43 μM. Fe2+, catalase and a reductant such as ascorbate significantly activated the enzyme. 2-Oxoglutarate was not replaced by any of ten other oxo acids tested, nor was Fe2+ by nine other divalent cations tested. The enzyme was inhibited moderately by EDTA, Tiron and various oxo acids and aliphatic dicarboxylic adds, and strongly by nitroblue tetrazolium and divalent cations Mn2+, Co2+, Ni2+, Cu2+, Zn2+, Cd2+ and Hg2+. Several pyridine dicarboxylates and o-dihydroxyphenyl derivatives inhibited the hydroxylase. Pyridine 2,4-dicarboxylate and 3,4-dihydroxybenzoate are competitive inhibitors with respect to 2-oxoglutarate with the respective Ki values of 9 μM and 90 μM. Several alkaloids with structures similar to l-hyoscyamine were hydroxylated by the enzyme at the C-6 position of the tropane moiety. The enzyme preparation also epoxidized 6,7-dehydrohyoscyamine, a hypothetical precursor of scopolamine, to scopolamine (Km 10 μM). This epoxidation reaction required the same co-factors as the hydroxylation reaction and the epoxidase activities were found in the same fractions with the hydroxylase activities during purification. Two possible pathways for scopolamine biosynthesis are discussed in the light of the hydroxylase and epoxidase activities found in the partially purified preparation of hyoscyamine 6β-hydroxylase. [ABSTRACT FROM AUTHOR]

Mitochondrial transcription and processing of transcripts have been investigated at different stages of release from glucose repression in resting cells of Saccharomyces cerevisiae. Transcripts were identified by hybridization with nick-translated or terminally labelled gene-specific probes. This allowed the determination of the steady-state levels of individual transcripts in the mitochondrial RNA population. Results showed different gene-specific patterns of response to respiratory induction: no increase in the level of transcripts (oxi2); a rapid increase in the steady-state levels of all transcripts (cob); a very strong increase in the processing of the high-molecular-mass precursors (oxi3 and oli2); an increase in the level of stable circular transcripts (oxi3). As a whole the results indicate specific and differentiated effects of release from glucose repression on the expression of the different mitochondrial genes and demonstrate the importance of processing events in mitochondrial regulation. [ABSTRACT FROM AUTHOR]

The Helical structures of d(C-G-C-A-m5C-G-T-G-mSC-G), d(m5C-G-C-A-m5C-G-T-G-C-G) and d(C- 2aminoA-C-G-T-G) were studied in aqueous solution at various salt concentrations and temperatures by 1H-NMR spectroscopy. In 0.1 M NaCl solution only the B form was evidenced for these DNA fragments whereas in 4 M NaCI both B and Z forms, in slow exchange on the NMR time scale, were observed. Under these conditions the Z form accounted for less than 60% of the decamer conformation; conversely d(C-G)3 hexamers containing methylated cytidines were predominantly in the Z form (> 90%) [Tran-Dinh et al. (1984) Biochemistry 23, 1362: Cavailles et al. (1984) J. Biomol. Struct. Dyn. I. 1347–1371]. On the other hand, d(C-2aminoA-C-G-T-G) in which the d(2ammoA) · dT base pair forms three hydrogen bonds, was found to adopt the Z conformation in 4M NaCI solution which was not the case for d(C-A-C-G-T-G) (unpublished results). The present study shows that the B ⇄ Z transition in solution is highly sequence-dependent and that correlation exists between the stability of the duplexes (essentially governed by the number of hydrogen bonds between complementary bases) and their ability to adopt the Z conformation. [ABSTRACT FROM AUTHOR]

Basic fibroblast growth factor (bFGF), a potent mitogen for arterial smooth muscle cells has been shown to play a fundamental role in the pathogenesis of arteriosclerosis and restenisos by stimulating the proliferation of vascular smooth muscle cells. We found that partially phosphorothioate-modified 15-redisue antisense oligodeoxynucleotides complementary to bFGF mRNA at 0.1-2.0 μM clock growth and division of cultured human and bovine coronary smooth muscle cells I a dose-dependent manner. The effect is sequence specific at low (0.1-0.5 μM) nontoxic concentrations. It is associated with inhibition of expression of pericellular and intracellular bFGF, with a decreased de novo synthesis of bFGF and is partly reversible by the addition of exogenous (recombinant) bFGF. The antisense effect lasts 48-72h and diminishes therafter. If the antisense oligodeoxynucleotide medium is replaced by an oligonucleotide-free medium after 24 h. the [³H]thymidine incorporation rate returns to control levels. Under the same conditions, the corresponding sense oligodeoxynucleotide exerts negligible nonspecific inhibitoty actions. The antiproliferative potency of the 15-residue antisense oligodeoxynucleotide is markedly enhanced by adding 3-4 nobase-pairing guanosine residues at the 5'- and 3'-termini of the 15-residue antisense oligonucleotide. [ABSTRACT FROM AUTHOR]

A human monocyte-activating CC chemokine has been identified based on sequences in an expressed sequence tag (EST) cDNA database. The protein shows highest sequence identity to th macrophage inflammatory protein (MIP) group of chemokines, particularly MIP-3 (76.7$) and MIP-1α (75.4%), and has been named MIP-5. Model building confirms that the protein has a similar three dimensional structure to other chemokines, but has an additional third disulphide bond. Northern blot analysis and reverse-transcriptase PCR show that the mRNA for MIP-5 is expressed at a high levels in liver, intestine and in lung leukocytes. MIP-5 induces chemotaxis of human monocytes. T-lymphocytes and, to a lesser degree, eosinophilsat nanomolar concentrations; it has no effect on neutophil migration. In receptor-binding assays. MIP-5 shows IC50 values of 12 mM for competition with 125I-MIP-1α for binding to CC-chemokine receptor (CCR)1, and 2.5 nM for competition with 125I-MCP-3 for inding to CCR3. It shows no ability to compete with ligand for binding to the two interleukin (IL)-8 receptors (CXC-chemokine receptors 1 and 2) or to CCR2, CCR4 or CCR5. Consistent with this binding data, MIP-5 wa sonly able to induce calcium fluxes in CHO cells stably transfected with CCR1 or CCR3. [ABSTRACT FROM AUTHOR]

The interaction of recombinant ascorbate peroxidase (APX) with its physiological substrate, ascorbate. has been studied by electronic and NMR spectroscopies, and by phenylhydrazine-modification experiments. The binding interaction for the cyanide-bound derivative (APX-CN) is consistent with a 1:1 stoichiometry and is characterised by an equilibrium dissociation binding constant. Kd, of 11.6.&plusmnl;0,4 μM (pH 7.002, μ = 0.10 M, 25.0°C). Individual distances between the non-exchangeable substrate protons of APX-CN and the haem iron were determined by paramagnetic-relaxation NMR measurements, and the data indicate that the ascorbate binds 0.90-1.12 nm from the haem iron. The reaction of ferric APX with the suicide substrate phenylhydrazine yields predominantly (60%) a covalent haem adduct which is modified at the C20 carbon, indicating that substrate binding and oxidation is close to the exposed C20 position of the haem. as observed for other classical peroxidases. Molecular-modelling studies, using the NNMderived distance restraints in conjunction with the crystal structure of the enzyme [Patterson. W. R, & Poulos. T L, (1995) Biochemistry 34, 4331-4341], are consistent with binding of the substrate close to the C20 position and a possible functional role for alanine 134 (proline in other class-III peroxidases) is implicated. [ABSTRACT FROM AUTHOR]

In the present study, we synthesized 14C-labelled 5-nitro-l.2.4-triazol-3-one (NTO) and investigated its hepatic metabolism by dexamethasone-induced murine hepatic microsomes. Under the nitrogen atmosphere. 5-amino-l.2.4-triazol-3-one was the only detected metabolite of NTO. The microsomal nitroreductase activity was dependent on NADPH, totally inhibited by carbon monoxide and partially inhibited by oxygen. In aerobic conditions, beside a low amount of amine, the major metabolite formed is the 5-hydroxy-triazolone, urazole. This compound resulted from the oxidative denitrification of NTO, which produced equivalent amount of nitrite. This reaction, like the nitroreductase activity, was dependent on NADPH and totally inhibited by carbon monoxide. Both nitroreduction and oxidative denitrification were inhibited by imidazole-related inhibitors: miconazole and methimazole, and to a less extent by N-octylamine. The microsomal denitrification was induced by the treatment of mrs with dexamethasone and phenobarbital. The microsomal reductase activity is present in untreated rat microsomes, and recovered with various inducers. The results of this study indicate the role played by cytochrome P-450 in the metabolism of NTO. supported by its transformation with reconstituted cytochrome P-450 systems. [ABSTRACT FROM AUTHOR]

The fatty acid specificity of phospholipase D purified from germinating sunflower seeds was studied using mixed micelles with variable detergent/phospholipid ratios. The main advantage of this approach is that since the substrate is integrated in the detergent micelles, comparisons can be made between the kinetic constants of a wide range of phosphatidylcholine (PtdCho) compounds with various fatty acid contents. Phospholipase D is subject to interracial activation as it is most active on water-insoluble substrates. It is not active on sphingomyelin and only slightly on lysophosphatidylcholine. By fitting the curves based on the experimental kinetic data, the interfacial dissociation constant of phospholipase D. the maximum hydrolysis rate Vm and the kinetic constant Kbm were determined with the micellar substrate. The specificity of various substrates was examined by comparing the Vm/KKbm values, and it was noted that sunflower phospholipase D is most active on medium-chain fatty PtdCho compounds. With long-chain natural phospholipids, the specificity of phospholipase D was slightly dependent on the level of fatty acid unsaturation. The pure enzyme was able to hydrolyse the sunflower phospholipids present m mixed detergent micelles but not the phospholipids integrated in the natural sunflower oil body structure. We concluded, however, that during the germination of sunflower seeds, phospholipase D might be involved in the degradation of oil bodies, since other factors present in crude seed extracts may make phospholipids accessible to the enzyme. [ABSTRACT FROM AUTHOR]