Additional file 2 of Loss of thymidine phosphorylase activity disrupts adipocyte differentiation and induces insulin-resistant lipoatrophic diabetes

Additional file 2: Table S2. List of predicted off-target sequences of the CRISPR/Cas9 editing strategy, with mismatch position and genomic location. The CRISPOR web tool ( http://crispor.tefor.net/ ) is well recognized to predict the risk of off-target sequences by providing a cutting frequency determination (CFD) specificity score ranging from 1 to 100. The higher the number, the lower the risk of off-target effects. It is based on the accurate CFD off-target model from Doench JG et al. (Nat Biotechnol 2016 Feb;34(2):184-196), which recommends guides with a CFD specificity score > 50. The gRNA used herein to target TYMP exon 5 has a CFD score of 84. This gRNA did not match perfectly any other genomic region. The table below provides a list of potential off-target sequences with up to three mismatches with the gRNA used (CAGAGATGTGACAGCCACCG). Notably, off-targets are considered if they are flanked by an NGG motif, which corresponds to the PAM sequence allowing the Cas9 to cut DNA.