Development of polymerase chain reaction for identification of phytopathogenic fungi Fusarium oxysporum.

The article presents the results of research on the development of test system by the method of polymerase chain reaction with real-time detection for the identification of phytopathogenic fungi Fusarium oxysporum. These fungi are cosmopolitan for many types of agricultural (wheat, soybeans, peas, alfalfa) and fruit and vegetable crops (tomatoes, cucumbers) in various geographical areas. The authors selected for the work a section of genome that encodes endopolygalacturonase-Fusarium oxysporum isolate TD586 (pg1) gene. Specific primers were selected (f) 5'-3' GGGATCTGGGAGTACGGTTGC and (r) 3'-5' CCTACAGGCAGCGTTGAAGC and a protocol for setting up the reaction has been developed, including preliminary denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Studying the sensitivity of the test system, the authors selected a probe (GCTATTGCGGCTTTGCTGC), fluorescent dye-ROX, quencher-BHQ-2. The scientific development was tested on 28 field strains and 1 reference strains (Fusarium oxysporum VKM No. F-140) which was tested on 28 field strains and 1 reference strains with a 15 positive result. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]