Methodology of development and approbation of a test system for identification of Penicillium expansum based on polymerase chain reaction (real-time).

The article shows the results of research on the development of a test system by polymerase chain reaction with «real-time» detection for the identification of phytopathogenic fungi Penicillium expansum, which cause apple disease – blue mold. It can infect a wide range of hosts, including pears, strawberries, tomatoes, corn and rice. P. expansum produces the carcinogenic metabolite patulin, which levels in food are regulated by the governments of many countries. The authors selected a section of genome, the gene patF Penicillium expansum strain NRRL 35695. It is a cluster of genes that mediates the biosynthesis of patulin, a derivative of tetraquetide mycotoxin acetate. The test system for Penicillium expansum includes specific primers: upstream primer (f) 5'-3' GTGGGTCCGCAGGCCTTTAT, downstream primer (r) 3'-5' GCCCATTCTCCATCGACCAC. Reaction setting protocol: pre-denaturation – 95 0C-5 minutes (1 cycle); denaturation-95 0C-5 sec, annealing-60 0C-15 sec (50 cycles). Probe: GCCCATTCTCCATCGACCAC, fluorescent dye – ROX, quencher-BHQ2. The optimal concentration of primers equal to 7 pM of each primer per reaction has been established. The optimal concentration of the probe is 0.4 pM. The approbation of the scientific development was carried out on 29 strains of Penicillium spp. isolated from samples of apples, eggplants, onions, strawberries, grapes, peaches with signs of spoilage, and soil samples from various natural geographical zones of the Russian Federation, and presumably typed as Penicillium expansum by dichotomous keys. It was established that only 15 belong to this species on the basis of conducted studies. The study was carried out according to the thematic plan-task of the Ministry of agriculture of the Russian Federation, the registration number of the INIS RTD 122030200367-8. [ABSTRACT FROM AUTHOR]