Search

Graphical abstract, Highlights • Virus-induced infections like SARS-CoV-2 is a serious threat to human health and economics. • SARS-CoV-2 sheds out through stools making a possible faecal-oral route of transmission to environment matrix. • Detection of enteric viruses in the environmental samples is extremely challenging. • Integrating two or more disinfection strategies provides an effective inactivation method for viral pathogens., The unprecedented global spread of the severe acute respiratory syndrome (SARS) caused by SARS-CoV-2 is depicting the distressing pandemic consequence on human health, economy as well as ecosystem services. So far novel coronavirus (CoV) outbreaks were associated with SARS-CoV-2 (2019), middle east respiratory syndrome coronavirus (MERS-CoV, 2012), and SARS-CoV-1 (2003) events. CoV relates to the enveloped family of Betacoronavirus (βCoV) with positive-sense single-stranded RNA (+ssRNA). Knowing well the persistence, transmission, and spread of SARS-CoV-2 through proximity, the faecal-oral route is now emerging as a major environmental concern to community transmission. The replication and persistence of CoV in the gastrointestinal (GI) tract and shedding through stools is indicating a potential transmission route to the environment settings. Despite of the evidence, based on fewer reports on SARS-CoV-2 occurrence and persistence in wastewater/sewage/water, the transmission of the infective virus to the community is yet to be established. In this realm, this communication attempted to review the possible influx route of the enteric enveloped viral transmission in the environmental settings with reference to its occurrence, persistence, detection, and inactivation based on the published literature so far. The possibilities of airborne transmission through enteric virus-laden aerosols, environmental factors that may influence the viral transmission, and disinfection methods (conventional and emerging) as well as the inactivation mechanism with reference to the enveloped virus were reviewed. The need for wastewater epidemiology (WBE) studies for surveillance as well as for early warning signal was elaborated. This communication will provide a basis to understand the SARS-CoV-2 as well as other viruses in the context of the environmental engineering perspective to design effective strategies to counter the enteric virus transmission and also serves as a working paper for researchers, policy makers and regulators.

Replication perturbations activate DNA damage tolerance (DDT) pathways, which are crucial to promote replication completion and to prevent fork breakage, a leading cause of genome instability. One mode of DDT uses translesion synthesis polymerases, which however can also introduce mutations. The other DDT mode involves recombination-mediated mechanisms, which are generally accurate. DDT occurs prevalently postreplicatively, but in certain situations homologous recombination is needed to restart forks. Fork reversal can function to stabilize stalled forks, but may also promote error-prone outcome when used for fork restart. Recent years have witnessed important advances in our understanding of the mechanisms and DNA structures that mediate recombination-mediated damage-bypass and highlighted principles that regulate DDT pathway choice locally and temporally. In this review we summarize the current knowledge and paradoxes on recombination-mediated DDT pathways and their workings, discuss how the intermediate DNA structures may influence genome integrity, and outline key open questions for future research.

Highlights • The conjugative transfer mechanism of broad-host-range, Enterococcus sex pheromone and Clostridium plasmids is reviewed. • Comparisons with Gram-negative type IV secretion systems are presented. • The current understanding of the unique Streptomyces double stranded DNA transfer mechanism is reviewed., Bacterial conjugation presents the most important means to spread antibiotic resistance and virulence factors among closely and distantly related bacteria. Conjugative plasmids are the mobile genetic elements mainly responsible for this task. All the genetic information required for the horizontal transmission is encoded on the conjugative plasmids themselves. Two distinct concepts for horizontal plasmid transfer in Gram-positive bacteria exist, the most prominent one transports single stranded plasmid DNA via a multi-protein complex, termed type IV secretion system, across the Gram-positive cell envelope. Type IV secretion systems have been found in virtually all unicellular Gram-positive bacteria, whereas multicellular Streptomycetes seem to have developed a specialized system more closely related to the machinery involved in bacterial cell division and sporulation, which transports double stranded DNA from donor to recipient cells. This review intends to summarize the state of the art of prototype systems belonging to the two distinct concepts; it focuses on protein key players identified so far and gives future directions for research in this emerging field of promiscuous interbacterial transport.

New methods to identify trace amount of infectious pathogens rapidly, accurately and with high sensitivity are in constant demand to prevent epidemics and loss of lives. Early detection of these pathogens to prevent, treat and contain the spread of infections is crucial. Therefore, there is a need and urgency for sensitive, specific, accurate, easy-to-use diagnostic tests. Versatile biofunctionalized engineered nanomaterials are proving to be promising in meeting these needs in diagnosing the pathogens in food, blood and clinical samples. The unique optical and magnetic properties of the nanoscale materials have been put to use for the diagnostics. In this review, we focus on the developments of the fluorescent nanoparticles, metallic nanostructures and superparamagnetic nanoparticles for bioimaging and detection of infectious microorganisms. The various nanodiagnostic assays developed to image, detect and capture infectious virus and bacteria in solutions, food or biological samples in vitro and in vivo are presented and their relevance to developing countries is discussed.

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.