Search

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. [ABSTRACT FROM AUTHOR]

Type 1 diabetes (T1D) is a complex disease driven by the immune system attacking the insulin-producing beta cells in the pancreas. Understanding the role of different T cell subpopulations in the development and progression of T1D is crucial. By employing flow cytometry to compare the characteristics of T cells, we can pinpoint potential indicators of treatment response or therapeutic inefficacy. Our study reveals elevated prolactin (PRL) levels in T1D patients, along with a decreased production of key cytokines. Additionally, PD1 appears to play a significant role in T1D. Notably, PRL levels correlate with an earlier disease onset and a specific T cell phenotype, hinting at the potential influence of PRL. These findings highlight the need for further research to identify promising cellular targets for more effective and tailored therapies. [ABSTRACT FROM AUTHOR]

Podstawowym celem artykułu jest naświetlenie okoliczności towarzyszących powstawaniu rzeźb pomnikowych tworzonych przez polskie rzeźbiarki. Międzywojenny okres ich działalności został skonfrontowany z twórczością kobiet należących do kolejnego pokolenia rzeźbiarek uprawiających ten rodzaj sztuki już po II wojnie światowej. Uważna refleksja pozwoli dostrzec działanie mechanizmu, w którym zarówno uwarunkowania kulturowe jak i system administracyjno-urzędowy przyczyniły się do procesu wyznaczania symbolicznych granic działalności rzeźbiarskiej kobiet i odgradzania ich sztuki od sfery publicznej. Przemiany społeczne po 1918 r. umocniły pozycję kobiet pragnących rozwijać własne kariery zawodowe. Na arenę artystyczną wkroczyła wówczas grupa gruntownie wykształconych rzeźbiarek, wśród których znalazły się te, które zaczęły uprawiać swoją twórczość w obrębie sztuki pomnikowej. Dotychczas była to strefa całkowicie zarezerwowana dla mężczyzn i to właśnie tam patriarchalne tradycje zakorzenione były najgłębiej. Wejście do środowiska opartego na dominującej pozycji mężczyzn wymuszało na kobietach konieczność konfrontacji z zastanymi wzorcami oraz schematami myślowymi odnoszącymi się do ich uczestnictwa w kulturze. Ten rodzaj twórczości uprawiały międzywojenne artystki o ugruntowanej już wówczas pozycji: Zofia Trzcińska-Kamińska, Hanna Nałkowska, Janina Reichert czy Ludwika Nitchowa. Doskonale zapowiadające się kariery znakomitej większości z nich zostały przerwane przez wybuch II wojny światowej oraz wszelkie okoliczności związane z tym wydarzeniem. Kolejne pokolenie artystek formowało się w okresie tworzenia nowego systemu władzy, który tylko pozornie promował koncepcję wolności wśród obywatelek i obywateli. Dynamiczny dotąd proces zdobywania przez kobiety kolejnych swobód na polu rzeźby, w nowym ustroju uległ niemal całkowitemu wyhamowaniu. Komunistyczna ideologia pogłębiała hierarchie między płciami, które w ostateczności stały się podstawowym sposobem wyznaczania granic społecznych i izolowania kobiet od sfery publicznej, a więc i pozbawiania ich dostępu do realizacji o charakterze pomnikowym.

Federico Badalà,1 Elena Bona,1 Giulia Devincenzi,1 Kouros Nouri-Mahdavi2 1Micro Chirurgia Oculare, Eye Clinic, Milan, Italy; 2Glaucoma Division, Stein Eye Institute, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, CA, USACorrespondence: Federico Badalà, Email med@microchirurgiaoculare.comPurpose: To determine long-term efficacy and safety of an extended macular vision intraocular lens (IOL) implanted in patients with dry age-related macular degeneration (AMD) and visually insignificant cataracts.Design: Retrospective observational case series.Setting: MicroChirurgia Oculare, Italy.Methods: A retrospective case series of patients with dry AMD and visually insignificant cataracts undergoing phacoemulsification and implantation of an extended macular vision IOL designed to optimize image quality up to 10° from the foveal center (EyeMax Mono, Sharpview Ophthalmology, London, UK). Criteria for implantation were visually insignificant cataract (NC1 according to LOCS III classification) with dry age-related macular degeneration. Hypermetropia was targeted in most eyes to provide magnification when corrected with spectacles. Primary outcome measures were changes in corrected distant and secondary outcome measures included near visual acuity (CDVA and CNVA, respectively) between baseline and latest follow-up and safety outcomes.Results: 113 eyes of 86 patients (mean age 70.3± 7.9 years) were included (mean follow-up: 48.3± 25.1 months). Mean CDVA improved by 0.22 logMAR (11 ETDRS letters), from 0.53± 0.4 to 0.31± 0.3 (n=113, p< 0.001). Similarly, mean CNVA improved by 0.08 logMAR (4 ETDRS letters), from 0.45± 0.2 to 0.37± 0.2 (n=77, p< 0.001). Eleven eyes had AMD with extensive atrophy, and their mean CDVA improved by 0.32 logMAR (16 ETDRS letters). Three eyes (2.7%) experienced loss of more than one line in logMAR CDVA and four eyes (5.2%) experienced loss of more than one line in logMAR CNVA. No complications or instances of IOL exchange were reported.Conclusion: Visual improvement in eyes with visually insignificant cataract and AMD who underwent phacoemulsification and were implanted with EyeMax Mono IOL appears to be influenced by the IOL optical design. Vision enhancement in eyes with visually insignificant cataracts underscores the IOL’s ability to optimize use of healthy retinal areas. Prospective studies with control groups are needed to confirm these findings.Keywords: AMD, Age macular degeneration, extended macular vision IOL, IOL, preferred retinal locus, PRL

Copyright of Historia i Polityka is the property of Nicolaus Copernicus University in Torun and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The prolactin (PRL) hormone is a major regulator of mammary gland development and lactation. However, it remains unclear whether and how PRL contributes to mammary epithelial cell proliferation and secretion. The Boer and Macheng black crossbred goats are superior in reproduction, meat, and milk, and are popular in Hubei province. To elucidate the mechanisms of PRL on mammary growth and lactation, to improve the local goat economic trade, we have performed studies on these crossbred goats during pregnancy and early lactation, and in goat mammary epithelial cells (GMECs). Here, we first found that the amino acid transporters of SNAT1 and SNAT2 expression in vivo and in vitro were closely associated with PRL levels, the proliferation and secretion of GMECs; knockdown and over-expression of SNAT1/2 demonstrated that PRL modulated the proliferation and lactation of GMECs through regulating SNAT1/2 expression. Transcriptome sequencing and qPCR assays demonstrated the effect of PRL on the transcriptional regulation of SNAT1 and SNAT2 in GMECs. Dual-luciferase reporter gene assays further verified that the binding of the potential PRL response element in the SNAT1/2 promoter regions activated SNAT1/2 transcription after PRL stimulation. Additionally, silencing of either PRLR or STAT5 nearly abolished PRL-stimulated SNAT1/2 promoter activity, suggesting PRLR–STAT5 signaling is involved in the regulation of PRL on the transcriptional activation of SNAT1/2. These results illustrated that PRL modulates the proliferation and secretion of GMECs via PRLR–STAT5-mediated regulation of the SNAT1/2 pathway. This study provides new insights into how PRL affects ruminant mammary development and lactation through regulation of amino acid transporters. [ABSTRACT FROM AUTHOR]

Przyjęte metody badań historycznych miały za zadanie odpowiedzieć na pytanie, czy państwa wschodnie sąsiadujące z Austrią, ograniczone swym systemem gospodarczym i politycznym, mogły liczyć na pomoc w zakresie inicjowania reform politycznych. Dysproporcje pomiędzy demokratycznym Zachodem i komunistycznym Wschodem wpływały na Wiedeń niekorzystnie. Przyjęta teza badawcza dotyczy możliwości i skali zaangażowania Austrii na rzecz reform gospodarczych w Polsce. Austriacy uznali, że równomierny rozwój wschodnich sąsiadów służył rozwojowi Drugiej Republiki i konsekwentnie go wzmacniali. Austria wielokrotnie potwierdzała chęć pomocy Polsce, nie tylko humanitarnej, ale także dyplomatycznej i gospodarczej, bez konieczności negatywnej oceny działań władz komunistycznych. Dlatego charakterystyka Austrii w polskich dokumentach dyplomatycznych i oficjalnych komunikatach prasowych z lat 1985–1989 to obraz sojusznika i partnera. Przykładem skrzętnie wykorzystywanym przez polskie władze było oficjalne stanowisko Austrii i jej negatywna ocena sankcji gospodarczych nałożonych na Polskę przez Zachód. Narracja została podzielona na dwa okresy. Pierwszy dotyczy lat 1985–1986 i relacjonuje odradzanie stosunków po wprowadzeniu stanu wojennego w Polsce. Drugi etap dotyczy wspólnych działań w latach prowadzących do przełomu i „jesieni ludów”. Polityka rządu austriackiego wzmocniła funkcjonujący reżim i przedłużyła rozkład polskiego systemu politycznego. W nieoficjalnych rozmowach reformy gospodarcze w Polsce oceniano w Austrii jako powierzchowne i przewidywano załamanie gospodarcze, mogące mieć katastrofalne skutki dla całej Europy. Władze polskie wykorzystywały wpływy i pozycję neutralnej republiki do realizacji własnych celów, zwłaszcza do legitymizacji swoich rządów. Bilans stosunków dwustronnych w końcowym etapie zimnej wojny okazał się dla obu krajów niekorzystny.

Celem artykułu jest przybliżenie roli Józefa Tejchmy podczas kryzysu grudniowego 1970 r. Praca analizuje działania Tejchmy, próbując określić wagę roli odegranej przez niego oraz jego postawę w dniach kryzysu. Przedstawia jego dążenia do szybkiego zakończenia starć i zminimalizowania rozlewu krwi, a także postawę podczas strajku łódzkich włókniarek w lutym 1971 r.

Rationale: Chronic stress exposure disrupts the medial prefrontal cortex's (mPFC) ability to regulate impulses, leading to the loss of control over alcohol drinking in rodents, emphasizing the critical role of this forebrain area in regulating alcohol consumption. Moreover, chronic stress exposure causes lateralization of mPFC functions with volumetric and functional changes, resulting in hyperactivity in the right hemisphere and functional decrease in the left. Objectives: This study investigated the inhibitory role of the left prelimbic cortex (LPrL) on ethanol consumption induced by chronic social defeat stress (SDS) in male mice and to examine if inactivation of the LPrL causes disinhibition of the right mPFC, leading to an increase in ethanol consumption. We also investigated the role of lateralization and neurochemical alterations in the mPFC related to ethanol consumption induced by chronic SDS. To this end, we examined the activation patterns of ΔFosB, VGLUT2, and GAD67 in the left and right mPFC. Results: Temporarily blocking the LPrL or right PrL (RPrL) cortices during acute SDS did not affect male mice's voluntary ethanol consumption in male mice. When each cortex was blocked in mice previously exposed to chronic SDS, ethanol consumption also remained unaffected. However, male mice with LPrL lesions during chronic SDS showed an increase in voluntary ethanol consumption, which was associated with enhanced ΔFosB/VGLUT2-positive neurons within the RPrL cortex. Conclusions: The results suggest that the LPrL may play a role in inhibiting ethanol consumption induced by chronic SDS, while the RPrL may be involved in the disinhibition of ethanol consumption. [ABSTRACT FROM AUTHOR]

The work of Andrzej Pilipiuk does not seem to pose significant interest to researchers of Polish literature, as evidenced by the negligible number of scientific texts on the novels written by this author. He seems to depreciate his literary output by calling himself mockingly the Great Hack Author. In the meantime, his books enjoy unflagging interest of readers who appreciate the prose writer’s ingenuity in creating new stories. This article aims to change the way people find this work, showing that the writer has a lot to do offer when it comes to literary research. For this reason, I analyze the space of the bazaar in the series Wampir z... [Vampire of...] in terms of Foucauldian heterotopia. In the article I also take into account the literature describing the real Różycki bazaar, which inspired a prose writer to present the structure of this unusual place. In the course of the analysis will prove that this area (both real and literary) operates according to specific rules, and functioning within its boundaries without knowing them is almost impossible. Thus, it is what Michel Foucault called a heterotopia. An interpretation made in this way will also allow ‘open’ the work of writer Andrzej Pilipiuk to interdisciplinary research methods.

Loanwords are lexical terms borrowed from foreign languages by transliterating the original sound of the borrowed words with the recipient language's consonants and vowels. This paper focuses on lexical borrowing in the Korean language from a diachronic perspective. Based on approximately 9,500 Korean loanwords extracted from a corpus of women's magazine articles of residential sections (the Korean Contemporary Residential Culture Corpus), we investigated the alteration of loanword usage from 1970 to 2015. Having introduced our definition of Korean loanwords in phonological and morphological terms, we performed statistical analysis particularly with type/token frequency and cultural/core loanwords, along with semantic analysis with Period Representative Loanword (PRL). We argue that, in addition to its gradual and rapid increase over time, Korean loanword usage underwent a remarkable evolution in the 1990s. [ABSTRACT FROM AUTHOR]

Copyright of Studia Paedagogica Ignatiana is the property of Jesuit University Ignatianum in Krakow and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Recenzja

W 1948 r. do Głównego Urzędu Kontroli Prasy, Publikacji iWidowisk trafiły dwa zbiory felietonów autorstwa Władysława Smólskiego, które otrzymały aż dziesięć recenzji, w tym dziewięć negatywnych. Maszynopisy przekazano do kontroli w kwietniu 1948 r., a kolejne w następnych miesiącach, kiedy kontrola słowa stawała się coraz bardziej restrykcyjna. Celem artykułu jest ukazanie negatywnych recenzji cenzorskich sporządzonych w GUKPPiW, a także przedstawienie sytuacji, w jakiej znalazł się wówczas pisarz, który jeszcze przed wybuchem II wojny światowej dał się poznać jako autor m.in. fars i humoresek.

Celem artykułu jest wskazanie na przemianę autorytetu politycznego Stefana Żółkiewskiego w autorytet naukowy. Za podstawę badań służą materiały archiwalne dotyczące postawy głównego bohatera oraz pracy w Komitecie Centralnym PZPR. Poprzez analizę działalności politycznej Żółkiewskiego (której głównym punktem są wydarzenia z Marca ’68) autor stara się wskazać, że wpływ badacza na uczniów i współpracowników był wynikiem nie tylko utraty pozycji politycznej, lecz także konsekwentnego wyboru aksjologicznego.

Copyright of Historia i Polityka is the property of Nicolaus Copernicus University in Torun and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Review of Historical Sciences / Przegląd Nauk Historycznych is the property of Wydawnictwo Uniwersytetu Lodzkiego and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Scientific Journal of the Institute for Women's Studies / Studiów Kobiece is the property of Humanica Publishing House and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Prace Filologiczne. Literaturoznawstwo is the property of University of Warsaw and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Perspectives on Culture / Perspektywy Kultury is the property of Jesuit University Ignatianum in Krakow and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The text aims to provide an insight into the everyday automotive life of owners of passenger cars during the last two decades of the Polish People's Republic. The turning point of the 1960s and 1970s in the communist bloc countries marked a shift towards consumption, with a particular emphasis on individual motorization. In Poland, the new ruling team under Edward Gierek announced a significant increase in the production of passenger cars. The licensing agreement for manufacturing the Fiat 126p at the Passenger Car Factory was intended to be a milestone in the development of individual motorization. The people enthusiastically embraced the government's plans, and there was a mass prepayment for the 'maluch' (Fiat 126p). Unfortunately, throughout the two decades discussed, it was impossible to meet the popular demand for this car fully. The altered sales system in 1981 failed due to production shortages, and the waiting period extended to even ten years. As a result, Poles turned massively towards car markets. Acquiring a car and its subsequent maintenance involved specific expenses. Therefore, the possibilities of obtaining and using a car were tied to a certain income level. The sharp increase in the number of cars significantly impacted leisure activities, especially the development of automotive tourism. [ABSTRACT FROM AUTHOR]

Magnesium (Mg2+) is the most abundant divalent cation in cells and plays key roles in almost all biological processes. CBS‐pair domain divalent metal cation transport mediators (CNNMs) are a newly characterized class of Mg2+ transporters present throughout biology. Originally discovered in bacteria, there are four CNNM proteins in humans, which are involved in divalent cation transport, genetic diseases, and cancer. Eukaryotic CNNMs are composed of four domains: an extracellular domain, a transmembrane domain, a cystathionine‐β‐synthase (CBS)‐pair domain, and a cyclic nucleotide‐binding homology domain. The transmembrane and CBS‐pair core are the defining features of CNNM proteins with over 20 000 protein sequences known from over 8000 species. Here, we review the structural and functional studies of eukaryotic and prokaryotic CNNMs that underlie our understanding of their regulation and mechanism of ion transport. Recent structures of prokaryotic CNNMs confirm the transmembrane domain mediates ion transport with the CBS‐pair domain likely playing a regulatory role through binding divalent cations. Studies of mammalian CNNMs have identified new binding partners. These advances are driving progress in understanding this deeply conserved and widespread family of ion transporters. [ABSTRACT FROM AUTHOR]

Artykuł prezentuje w ujęciu historycznoliterackim powieść szpiegowską okresu PRL. Analiza książek z serii „Labirynt” wskazuje, że funkcja propagandowa dominuje w nich nad rozrywkową, co jest charakterystyczne dla różnych obszarów kultury popularnej w PRL. Serię „Labirynt” wydawało w latach 1957–1991 Wydawnictwo Ministerstwa Obrony Narodowej. Ukazywały się w niej „zwykłe” powieści milicyjne, ale przede wszystkim powieści szpiegowskie. Podobnie jak powieść milicyjna, również powieść szpiegowska w PRL obok funkcji rozrywkowej musiała spełniać funkcję propagandową. Przejawia się to m.in. nawiązaniem do konwencji wczesnych powieści szpiegowskich w literaturze europejskiej z przełomu XIX i XX wieku, czyli przedstawianiem PRL jako kraju, który tylko broni się przed szpiegami, sam natomiast nie wykrada tajemnic innych państw. Równie daleki od rzeczywistości i wyłącznie propagandowy był obraz Polski jako kraju wytwarzającego liczne wynalazki i technologie, na które polują szpiedzy z Zachodu. Propagandowy charakter ma też obraz wroga i skontrastowany z nim wizerunek własnych agentów. Szpiedzy z BND czy CIA nie cofają się przed morderstwami, są bezwzględni także dla swoich współpracowników i ogólnie reprezentują bardzo niski poziom moralny. Często są byłymi nazistami, a zależy im tylko na zarobku. Z kolei funkcjonariusze kontrwywiadu PRL to ludzie ideowi, z oddaniem służący ojczyźnie, przewyższający pod każdym względem swych przeciwników, także na płaszczyźnie życia prywatnego. Każda z tych historii kończy się oczywiście zwycięstwem „naszych” i – podobnie jak powieść milicyjna – nie pozostawia czytelnikowi żadnych wątpliwości co do tego, po czyjej stronie są w tym konflikcie wszystkie racje – zarówno polityczne, jak i moralne.

Lesio to piąta powieść kryminalna Joanny Chmielewskiej, która stanowi w jej pisarstwie pozycję wyjątkową. Podjęta w artykule interpretacja ma ukazać zarówno sposoby przekształcenia modelu powieści kryminalnej, jak i wydobyć jej humorystyczna dominantę. W analizie tekstu stosowano metody badań strukturalnych połączone z elementami socjologii literatury. Powieść odbiega od ukształtowanego wcześniej wzorca zmianą struktury narracyjnej z pierwszoosobowej na trzecio-osobową oraz mocniejszym wyeksponowaniem ludycznego obrazu świata. Autorka akcentowała aspekt humorystyczny, wysuwając go przed kryminalną intrygę i skupiając się na kreacji bohatera oraz na wywołanych jego działaniami komicznych zdarzeniach. Twórczość Chmielewskiej wyodrębniał stosowany przez nią typ komizmu, który odróżniał jej utwory od „klasycznego” kryminału. W Lesiu nastąpiła zmiana konwencji – kryminał „serio” zastąpiła zabawa w kryminał. Autorka konwencjom powieści kryminalnej, nadawała nowe znaczenia i odwołując się do obiegowych motywów gatunku (zbrodnia (nie)doskonała, napad na pociąg), banalizuje je i ośmiesza. Kolejne części artykułu skupiają się na: charakterystyce bohatera; aspektach komediowych; parodii i stylizacjach językowych, których tłem są stosunki społeczno-kulturowe w PRL w latach siedemdziesiątych XX wieku. Istotną przyczyną zwrotu pisarzy i czytelników w stronę „zabawnej sensacji” zdaje się rodzaj oswajania negatywnie kojarzonej przez wielu Polaków niezbyt odległej przeszłości. Kpina z aparatu sprawiedliwości, pokazywanie nieudolnych policjantów, opieszałość organów ścigania łączą się z apologią zwykłego obywatela, który „domowymi sposobami” radzi sobie w tej rzeczywistości. Powieść Chmielewskiej znalazła licznych naśladowców i kontynuatorów po roku 1989 w nurcie groteskowym powieści kryminalnej. Lesio stanowi ważny przykład rozmaitości gatunkowej powieści kryminalnej, zmienności form i funkcji aspektu ludycznego w jej strukturze.

Abstract The prolactin receptor gene (PRLR) may contribute to polycystic ovarian syndrome (PCOS) since it plays important roles in physiological ovarian functions. PRLR-knockout mice have irregular cycles and subfertility and variants in or around the PRLR gene were associated in humans with female testosterone levels and recurrent miscarriage. We tested 40 variants in the PRLR gene in 212 Italian families phenotyped by type 2 diabetes (T2D) and PCOS and found two intronic PRLR-variants (rs13436213 and rs1604428) significantly linked to and/or associated with the risk of PCOS. This is the first study to report PRLR as a novel risk gene in PCOS. Functional studies are needed to confirm these results.

Background: The COVID-19 pandemic has had effects beyond the respiratory system, impacting health and quality of life. Stress-related to the pandemic has led to temporary menstrual pattern changes in around one-third of women. These changes, likely driven by stress and anxiety, can result in problematic heavy bleeding, causing anemia and negatively affecting women's well-being. This also places a substantial socioeconomic burden on individuals, families, healthcare, and society. Objectives: This study examined the impact of COVID-19 infection on the hormone levels (estradiol, prolactin, follicle-stimulating hormone, and luteinizing hormone) and heavy menstrual bleeding in Iraqi premenopausal women infected for at least four months. Patients and Methods: This case-control study was conducted from November 2021 to April 2022, involving 100 married women aged 18 to 40. Participants were divided into two groups: 50 women with heavy bleeding post-COVID-19 infection (infection duration of at least four months) and 50 non-infected women. Results: Comparing the Mean ± SD of the two groups, showed that the LH levels were statistically highly significant in women who suffered heavy bleeding post-COVID-19 infection compared to non-COVID-19 women, with a p-value of 0.000. There was no statistically significant difference in FSH levels between the two groups. The PRL levels were significantly higher for women who suffered substantial bleeding following COVID-19 infection compared to non-COVID-19 women, with a p-value of 0.003. Moreover, The E2 was significantly higher in women who suffered excessive bleeding following COVID-19 infection than non-infected women. Conclusion: This study suggests that COVID-19 may temporarily disrupt menstrual patterns, possibly due to stress and anxiety affecting the hypothalamus-pituitary-ovary axis. This disruption can manifest as elevated levels of gonad hormones (LH, PRL, and E2) and, in some cases, lead to heavy bleeding after a coronavirus infection. Received Oct. 2022 Accepted Oct. 2023 Published Jan. 2024

Sini San (SNS) is used to treat liver depression and is applied in both food and herbal medicine. Hyperprolactinemia (HPRL) is a common endocrine disorder, and patients with HPRL are usually associated with depressive symptoms. However, whether SNS is effective in treating HPRL combined with liver depression and its underlying mechanisms are unknown. We applied network pharmacology and molecular docking to predict the mechanism of SNS for the treatment of liver-depressed HPRL. Therapeutic effects were validated in animal models and cells. Metabolomics was also used to evaluate the effect of SNS on liver-depressed HPRL. Network pharmacology and molecular docking analysis showed that AKT1, TNF and IL6 were the key targets, and SNS improved depressive behaviors, regulated sex hormone levels, and improved ovarian morphology. Combined network pharmacology and metabolomics analyses showed that SNS could act by regulating lipid metabolism. In addition, SNS significantly reduced the release of prolactin (PRL) in rat pituitary tumor MMQ cells. Overall, SNS can significantly treat HPRL liver depression at both animal and cellular levels, and effectively alleviate the related symptoms by regulating lipid metabolism. AKT1, TNF and IL6 may be key targets.

W 1946 r. władze Polski Ludowej zdecydowały się na wyjątkowe dopuszczenie do sprawowania wymiaru sprawiedliwości przez osoby, które ukończyły utworzone przez Ministra Sprawiedliwości średnie szkoły prawnicze. Absolwenci tych szkół nie legitymowali się dyplomem wyższych studiów prawniczych. Nie odbywali też aplikacji sądowej. Przed podjęciem nauki w takich szkołach byli w większości absolwentami jedynie siedmiu klas szkoły powszechnej. Szkoła Prawnicza w Szczecinie funkcjonowała w latach 1950–1951. Kształcenie w niej było silnie zideologizowane w duchu marksizmu-leninizmu, a uzewnętrznianie bądź deklarowanie wiary religijnej przez słuchaczy spotykało się ze zdecydowaną reakcją kierownictwa szkoły i mogło zakończyć się nawet skreśleniem z listy słuchaczy. Celem niniejszego artykułu jest omówienie „przypadków klerykalizmu” wśród słuchaczy Szkoły Prawniczej w Szczecinie, co autor czyni, odwołując się do akt archiwalnych szkoły zgromadzonych w Archiwum Państwowym w Szczecinie. Co istotne, absolwenci tej szkoły niejednokrotnie obejmowali w krótkim czasie wysokie urzędy w lokalnym wymiarze sprawiedliwości oraz stanowili większość członków „Grupy Agitatorów” komórki PZPR przy Sądzie Wojewódzkim w Szczecinie.

Copyright of Miedzy Oryginalem a Przekladem is the property of Ksiegarnia Akademicka Sp. zo.o and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Tematem artykułu jest działalność polityczna i wybory ideowe Konstantego Łubieńskiego (1910–1977), który swoją aktywność zawodową rozpoczynał w około piłsudczykowskim ruchu „mocarstwowym”. Zawsze wrażliwy społecznie, już przed 1939 r. zastanawiał się nad sposobami poprawy warunków życia robotników i ludności wiejskiej. W czasie II wojny światowej działał w podziemiu, dochodząc do stanowiska dowódcy obwodu Mielec Armii Krajowej. Akcja „Burza”, w której brał udział i aresztowanie przez Sowietów skłoniły go do poszukiwania nowych form działania. Po ucieczce z niewoli udzielał się w Stronnictwie Pracy, a następnie w grupie „Dziś i Jutro”, gdzie zasłynął proklamującym współpracę katolików z komunistami artykułem List otwarty do Pana Juliusza Łady. Dopiero w 1956 r., w dobie „odwilży”, poczuł się rozczarowany postawą Bolesława Piaseckiego, opuścił Stowarzyszenie „PAX” i został jednym z przywódców grupy „secesji”. Był liderem środowiska „bezpartyjnej lewicy demokratycznej”, które z tygodnika „Za i Przeciw” usunął Jan Frankowski. Po tych wydarzeniach Łubieński związał się z ruchem „Znak”, pracując w jego kole poselskim i warszawskim Klubie Inteligencji Katolickiej. Był zwolennikiem odejścia od neopozytywizmu, a jako ideowy socjalista opowiadał się za bliższą współpracą środowiska z władzami. Doprowadziło to do rozłamu w „Znaku”, którego symbolem stało się – afirmujące zmiany w konstytucji w 1976 r. – przemówienie sejmowe Łubieńskiego i wstrzymanie się od głosu nad ich akceptacją przez Stanisława Stommę. Łubieński, rozbijając „Znak” i tworząc Polski Klub Inteligencji Katolickiej, osiągnął sukces u schyłku życia, nie zdążywszy politycznie zdyskontować jego rezultatów.

Prolactin (PRL) is a protein hormone of the anterior pituitary and has a diverse role in different aspects of amphibian life - in courtship, reproduction, larval development and in other physiological functions. The expression of PRL receptor mRNA is reported in skin, gill, liver, gut, kidney, gonads and many other organs of different groups of amphibians. PRL stimulates growth and inhibits the metamorphosis of larvae of several species of amphibians. PRL causes seasonal changes in sex accessory structures and secondary sexual characteristics. PRL affects metabolic regulation and suggests phylogenic conservation of its receptors. Plasma PRL concentration changes during the annual reproductive cycle in many amphibians. In courtship behavior of newt, PRL also induces the synthesis of the newt courtship pheromones. PRL acts on skin and its function is also associated with water drive in amphibians. PRL causes water retention in amphibians. PRL acts centrally or peripherally to induce the courtship behavior. The key goal of the paper is to understand the roles of PRL in various aspect of amphibian life, like in aspects of morphology, behaviour, physiological functions and how PRL interfere amphibian life in presence and absence of other chemical and biological factors. [ABSTRACT FROM AUTHOR]

Formed in October 1957, the Christian Social Association was founded on the basis of a breakaway group in the 'PAX' Association, referred to as 'secession'. In late September and early October 1957, its leader, Jan Frankowski, removed from the editorial board of the group's weekly Za i Przeciw leading 'secession' activists, who styled themselves 'nonaffiliated democratic left'. He established a small Catholic organisation which had a loyalist programme, and which was intended not to cause trouble for the authorities, gaining some political and economic concessions in return. However, Frankowski did not want to come into open conflict with the Church, a stance that irritated the communists, who wanted to strengthen the association in order to use it to fight the Episcopate and other Catholic groups. In the 1960s an opposition to Frankowski emerged within the organisation's leadership, seeking to activate the association. In 1968, the president of the association lost Zenon Kliszka's patronage, which, in the atmosphere of the March political purge, facilitated his dismissal. Zygmunt Filipowicz, an MP, became the new head of the organisation, but he drew his support from several activists who were in conflict with each other. The course of events within the association and the struggle between volatile coalitions resulted in 1972 in a clash between the general secretary, Kazimierz Morawski, and Stanislaw Jan Rostworowski, MP, both seeking to become the organisation's president. Both were Ministry of Internal Affairs agents and their conflict led to chaos throughout the organisation. In the end, with the support of the communists, Morawski became the president, while Rostworowski was marginalised. The Christian Social Association was unable to win political independence or genuinely increase its importance within the country's political system, and Rostworowski's attempts to change this state of affairs had a significant impact on his defeat. [ABSTRACT FROM AUTHOR]

The author of the article analyses the media discourse of late socialist Poland through the lens of eroticised images. By doing so, the author puts forward a framework for understanding the media discourse of that period as a form of a constrained sexual revolution. The source base consists of the contents of two men's magazines published between 1987 and 1989 (Pan [Gentleman] and Playboy) as well as the TV show Sexcesses produced in 1985. Such sources allow us to critically analyse the key features of the discussions about sexuality in 1980s media. On the one hand, the article highlights the notable liberalisation of visual discourse that took place in the 1980s and the profound impact it had on Polish society. On the other -- it points to several constraints of this project. While in 1980s Poland heterosexual men were increasingly able to perform and reaffirm their sexual identities, the sexual revolution abetted by the official media did little to question the patriarchal social norms and left no room for emancipation outside this heteronormative framework. Women were portrayed as passive objects of the male gaze, while any suggestions of homoeroticism were dismissed outright. The article contains a critical analysis of such approaches, with the author arguing that the Polish sexual revolution had an inherently heteronormative and gendered character. [ABSTRACT FROM AUTHOR]

The object of the study is to present the legal construction of sanitary law during the existence of People’s Republic of Poland. To this end, extensive remarks have been made on the distinction of sanitary law from the perspective of the key features of administrative law and an attempt has been made to define sanitary law. It has been established that, despite its numerous distinctive features, sanitary law still belongs to the system of substantive administrative law. Two developmental currents of sanitary law during this period were indicated. The first was the systematic development of regulation, both in terms of detail and substantive layer, as well as the number of regulatory acts. The second manifested itself in the independence of the public law branches covered by the pre-war sanitary law and their exclusion from the competence of the sanitary administration. The process of changes in sanitary law, especially at the material-legal level in the period after the World War II, was called in the pages of this article the disintegration of sanitary law. The thesis has been put forward that, in terms of the system, the sanitary administration in a certain sense “owes” its existence to the period of the People’s Republic of Poland; the structure and levels of sanitary-epidemiological stations shaped during this period still function. The contemporary sanitary law is a peculiar hybrid of legal solutions partly from the inter-war period and partly from the period of the People’s Republic of Poland, however, while the inter-war period was characterised by a considerable - for those times - integration of the system, in the period of the People’s Republic of Poland the political doctrine of the centralised state, by means of adopted decrees and laws, did not consolidate the framework of sanitary law developed before the outbreak of the World War II. [ABSTRACT FROM AUTHOR]

Background. Prolactin (PRL) has been reported to be associated with oxidative stress, which is an important contributor leading to cell apoptosis. However, little is known about the mechanisms underlying the effects of PRL on cytotoxicity and oxidative stress in ovine ovarian granulosa cells (GCs). Methods. Ovine ovarian GCs were treated with 0, 4, 20, 100 and 500 ng/mL of PRL. Then, the cytotoxicity, cell viability, malondialdehyde (MDA), reactive oxygen species (ROS), superoxide dismutase (SOD) and total antioxidant capacity (T-AOC) of GCs were detected. Additionally, 500 ng/mL PRL was chosen as the high PRL concentration (HPC) due to its high cytotoxicity and oxidative stress. Proteomic and metabonomic were performed to examine the overall difference in proteins and metabolic pathways between C (control: 0 ng/mL PRL) and P groups (500 ng/mL PRL). Results. The results indicated that GCs treated with 4 ng/mL PRL significantly decreased (P <0:05) the cytotoxicity, ROS and MDA, increased (P <0:05) the cell viability, SOD and T-AOC, and the GCs treated with 500 ng/mL PRL showed the opposite trend (P <0:05). Supplementation with 500 ng/mL PRL significantly increased the proteins of MT-ND1, MAPK12, UBA52 and BCL2L1, which were enriched in ROS and mitophagy pathways. Pathway enrichment analysis showed that the pentose phosphate pathway was significantly enriched in the P group. Conclusion. A low concentration of PRL inhibited cytotoxicity and oxidative stress. HPC induced oxidative stress in ovine ovarian GCs via the pentose phosphate pathway by modulating the associated proteins MT-ND1 in ROS pathway and UBA52, MAPK12 and BCL2L1 in mitophagy pathway, resulting in cytotoxicity. [ABSTRACT FROM AUTHOR]

Copyright of Autobiografia is the property of University of Szczecin Press / Wydawnictwo Naukowe Uniwersytetu Szczecinskiego and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Prolactin (PRL) has been reported to influence reproductive performance and cell apoptosis. However, its mechanism remains unclear. Hence, in the present study, ovine ovarian granulosa cells (GCs) were used as a cell model to investigate the relationship between PRL concentration and GC apoptosis, as well as its possible mechanisms. We examined the relationship between serum PRL concentration and follicle counts in sexually mature ewes. GCs were isolated from adult ewes and treated with different concentrations of PRL, while 500 ng/mL PRL was selected as the high concentration of prolactin (HPC). Then, we applied the transcriptome sequencing (RNA-Seq) combined with a gene editing approach to explore the HPC contributing to cell apoptosis and steroid hormones. The apoptosis of GCs gradually increased at PRL concentrations above 20 ng/mL, while 500 ng/mL PRL significantly decreased the secretion of steroid hormones and the expression of L-PRLR and S-PRLR. The results indicated that PRL regulates GC development and steroid hormones mainly through the target gene MAPK12. The expression of MAPK12 was increased after knocked-down L-PRLR and S-PRLR, while it decreased after overexpressed L-PRLR and S-PRLR. Cell apoptosis was inhibited and the secretion of steroid hormones increased after interfering with MAPK12, while the overexpression of MAPK12 showed the opposite trend. Overall, the number of follicles gradually decreased with increasing PRL concentration. HPCs promoted apoptosis and inhibited steroid hormone secretion in GCs by upregulating MAPK12 through reducing L-PRLR and S-PRLR. [ABSTRACT FROM AUTHOR]

Phosphatase of regenerating liver (PRL) is frequently overexpressed in various malignant cancers and is known to be a driver of malignancy. Here, we demonstrated that PRL overexpression causes mitotic errors that accompany spindle misorientation and aneuploidy, which are intimately associated with cancer progression. Mechanistic analyses of this phenomenon revealed dysregulation of the energy sensor kinase, AMP-activated protein kinase (AMPK), in PRL-induced mitotic errors. Specifically, immunofluorescence analysis showed that levels of phosphorylated AMPK (P-AMPK), an activated form of AMPK, at the kinetochore were reduced by PRL expression. Moreover, artificial activation of AMPK using chemical activators, such as A769662 and AICAR, in PRL-expressing cells restored P-AMPK signals at the kinetochore and normalized spindle orientation. Collectively, these results indicate the crucial importance of the activation of kinetochore-localized AMPK in the normal progression of mitosis, which is specifically perturbed by PRL overexpression. Key words: cancer, AMPK, PRL, kinetochore, mitotic errors

Artykuł koncentruje się na omówieniu serii powieści Alfreda Szklarskiego o Tomku Wilmowskim w kontekście zmieniających się konwencji powieści przygodowych dla młodzieży. W pierwszej części autor skupia się na klasycznych utworach podróżniczych z przełomu wieków oraz polskiej powieści kolonialnej. Następnie analizuje jeden z utworów przygodowych napisanych przez Szklarskiego w okresie okupacji oraz rozpatruje powieść Tomek w tarapatach jako ogniwo pośrednie między twórczością wojenną a cyklem o Wilmowskich. W dalszej kolejności omawia typy utworów przygodowych popularnych w okresie PRL-u. W części ostatniej, wykorzystując kategorie przygody, bohatera i nieprawdopodobieństwa, poddaje refleksji sposób, w jaki na kartach cyklu ujawniają się klasyczne cechy tekstów przygodowych.

Objective: This study aims to assess anti-Müllerian hormone (AMH), luteinizing to follicle-stimulating hormone ratio (LH: FSH), total testosterone (TT), and prolactin (PRL) levels among PCOS. In addition, we determine if AMH can be used as a predictor of PCOS among Sudanese women. Methods: There were 600 women enrolled in this observational cross-sectional study, 300 of whom had PCOS, and 300 of whom healthy women; PCOS was diagnosed using the Rotterdam criteria. On days 2– 4 of the menstrual cycle, serum LH, FSH, AMH, TT, and PRL levels were measured for all participants. Diagnostic performance of these parameters for PCOS was determined by receiver operating characteristic (ROC) curve. Results: Significantly higher means among PCOS regarding their BMI, AMH; LH: FSH ratio; TT; PRL, whereas significantly inverse in FSH compared with normal ovulatory women. On ROC analysis, AMH had the largest operating characteristic curve at cut-off > 3.95 ng/mL; AUC = 0.999 with Youden's index 0.99%, followed by LH: FSH ratio at cut-off 0.749; AUC=0.932; Youden's index 0.813%, TT cut-off 0.82 mIU/L, AUC=0.852 with Youden's index 0.58, while PRL showed the lowest AUC=0.627 with cut-off 15.3 ng/mL, Youden's index was 0.18%, P. value< 0.001. Conclusions: Sudanese women with PCOS had higher serum AMH level, LH:FSH ratio, and TT level. Moreover, AMH level has better discriminative power and good diagnostic potency for the diagnosis of PCOS among Sudanese. [ABSTRACT FROM AUTHOR]

OBJECTIVE: The prolactin (PRL) system plays important behavioral, social, and metabolic roles, such as mediating social bonding and insulin secretion. Inherited dysfunction of the PRL pathway-related genes is associated with psychopathology and insulin resistance. We have previously suggested that the PRL system might be implicated in the comorbidity of psychiatric (depression) and type 2 diabetes (T2D) owing to the pleiotropy of PRL pathway-related genes. To our knowledge, no PRL variants have so far been reported in patients with either major depressive disorder (MDD) and/or T2D. PATIENTS AND METHODS: In this study, we analyzed 6 variants within the PRL gene and tested them for the presence of parametric linkage and/or linkage disequilibrium (LD, i.e., linkage and association) with familial MDD, T2D, and their comorbidity. RESULTS: We found, for the first time, that the PRL gene and its novel risk variants are linked to and in LD (i.e., linkage and association) with familial MDD, T2D, and MDD-T2D comorbidity. CONCLUSIONS: PRL might play a key role in mental-metabolic comorbidity and can be considered a novel gene in MDD and T2D. [ABSTRACT FROM AUTHOR]

Phosphatases of regenerating liver (PRLs) are dual‐specificity protein phosphatases. The aberrant expression of PRLs threatens human health, but their biological functions and pathogenic mechanisms are unclear yet. Herein, the structure and biological functions of PRLs were investigated using the Caenorhabditis elegans (C. elegans). Structurally, this phosphatase in C. elegans, named PRL‐1, consisted of a conserved signature sequence WPD loop and a single C(X)5R domain. Besides, by Western blot, immunohistochemistry and immunofluorescence staining, PRL‐1 was proved to mainly express in larval stages and express in intestinal tissues. Afterward, by feeding‐based RNA‐interference method, knockdown of prl‐1 prolonged the lifespan of C. elegans but also improved their healthspan, such as locomotion, pharyngeal pumping frequency, and defecation interval time. Furthermore, the above effects of prl‐1 appeared to be taken without acting on germline signaling, diet restriction pathway, insulin/insulin‐like growth factor 1 signaling pathway, and SIR‐2.1 but through a DAF‐16‐dependent pathway. Moreover, knockdown of prl‐1 induced the nuclear translocation of DAF‐16, and upregulated the expression of daf‐16, sod‐3, mtl‐1, and ctl‐2. Finally, suppression of prl‐1 also reduced the ROS. In conclusion, suppression of prl‐1 enhanced the lifespan and survival quality of C. elegans, which provides a theoretical basis for the pathogenesis of PRLs in related human diseases. [ABSTRACT FROM AUTHOR]

This article attempts to describe the first Polish subculture that appeared in the Polish People's Republic in 1948-1956. Bikiniarze were characterized on the basis of 300 issues of the "Przekrój" magazine, published during the apogee of this subculture. The choice of this journal is justified by the desire to look at bikiniarze through the prism of a magazine which in communist times served as a "safety valve" and was not the right hand of the Polish authorities, which demanded the creation of a negative image of bikiniarze as presented in party press publications such as: "Sztandar Młodych", "Trybuna Ludu", or "Po Prostu". The characteristics of the subculture focus mainly on the image of a man - a bikiniarz, who is a symbol of this subculture and includes both a specific way of dressing and behaving, as well as lifestyle. The article also touches on the issue of a certain ambiguity of "Przekrój" itself, which is visible in the example of the magazine's attitude towards this subculture. This magazine played a certain game with censorship and resorted to various measures to smuggle non-propaganda content, including those about bikiniarze, who were oppressed by the authorities on its pages. This was done, for instance, by using: satire, fairy tales or poems. [ABSTRACT FROM AUTHOR]

The model of socialist housing policy in Poland, which was shaped in the post-war period, changed as a result of the transformation associated with the political system after 1989. The aim of the publication is to identify and analyse the legal regulations on the organisation and tasks of the state administration in the field of housing management in the years 1944–1989. The characteristics of the housing situation in the Polish People’s Republic and the model of the socialist housing economy, influenced by the patterns coming from the Soviet Union, will be presented. Conclusions will be formulated on the tasks of the state administration in satisfying the housing needs of citizens in the Polish People’s Republic. [ABSTRACT FROM AUTHOR]