Search

There are quite systematic data of the ophthalmic manifestations in SARS-CoV-2, on the presence of conjunctivitis in patients with COVID-19, as well as on the detection of viruses in the lacrimal fluid and eye tissues. And, although ophthalmic manifestations are considered rather rare for COVID-19 and are not included in the list of important for diagnosis, there is not enough reliable data on the inflammatory processes of the eye’s anterior part and their connection with COVID-19, as well as those arising against the background of the treatment.Purpose. To study the development of inflammatory diseases of the anterior part of the eye in patients who have undergone the new coronavirus infection COVID-19.resu. In the Department of Infectious and Allergic Eye Diseases of the Helmholts National Medical Research Center of Eye Diseases, 88 patients with confirmed transferred new coronavirus infection COVID-19 of varying severity were observed. The main method of laboratory diagnostics is the detection of SARS-CoV-2 RNA in swabs from the nasopharynx, the patient’s sputum. Serodiagnostics of COVID-19 includes the determination of IgG-, IgM-antibodies to SARS-CoV-2 in the blood in an enzyme-linked immunosorbent assay.Results. Acute conjunctivitis associated with COVID-19 is quite rare and is an early sign of the disease. In the complex nonspecific topical therapy of viral conjunctivitis in COVID-19, along with etiopathogenetic systemic treatment, local eye medications with immunomodulatory and antiviral activity should be used. Conjunctivitis during a pandemic may be the only sign of COVID-19. The development of allergic conjunctivitis in COVID-19 is possibly associated not only with the effect of a viral agent, but also depends on the toxic effect of drugs used in the complex treatment of this disease. The increase in the number of patients with episcleritis after the postponed coronavirus infection needs further detailed study, with the analysis of laboratory data from this group of patients and the accumulation of clinical material.Conclusion. Ophthalmic manifestations in COVID-19 are very different, affecting various structures of the eye, occur at different periods — both during the course of the disease and after clinical recovery, and, of course, need further consideration, study and structuring.

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Background: Vaginal candidiasis is common in during pregnancy. It may lead to complications like abortions, premature birth, low birth weight, chorioamnionitis and fungal systemic neonatal infection. The aim of present study was identification of Candida species by mycological and molecular methods in pregnant women with vaginal candidiasis. Methods: This cross-sectional study was performed on 80 pregnant women with or without clinical symptoms of vulvovaginal candidiasis referred to Shahid Noorani Talesh Hospital, Gilan University of Medical Sciences, Iran, from April to December 2015 (8 months). All specimens were examined by direct microscopy and culture on CHROMagar Candida medium for isolation and differentiation of major clinical-significant Candida species (spp.). Cultured media were incubated at 35 °C for 48 hours and evaluated based on color and number of grown colonies. If no growth was observed, the media were incubated for several additional days. Subcultures were done on Sabouraud dextrose agar (Merck, Germany) and Corn meal agar with Tween 80 media (Micromedia, Hungary) for further study. Identification of Candida spp. carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Results: In this study, vulvovaginal candidiasis was observed in 20 (25%) patients. Twenty-two isolates were obtained from culture of specimens on CHROMagar Candida medium (Paris, France). The most common isolated species was Candida albicans 16 (72.8%) and followed by Candida glabrata 5 (22.7%), Candida tropicalis 3 (13.6%) and Candida krusei 1 (4.5%) cases. Two patients had mixed infection with 2 different Candida species (C. albicans and C. glabrata) While using PCR-RFLP method, the Candida species were identified as 13 (59.1%) Candida albicans, 5 (22.7%) Candida glabra, 3 (13.6%) Candida tropicalis and 1 (4.5%) Candida krusei cases, respectively. In direct examination were seen yeast budding cells and pseudohyphae in 8 culture positive specimens. In the present study, results of conventional mycological method in differentiation of Candida spp. were consistent with molecular results in 80% of cases. There was also significant correlation between vulvovaginal candidiasis with clinical symptoms (P

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia. [ABSTRACT FROM AUTHOR]

Background: Vaginal candidiasis is common in during pregnancy. It may lead to complications like abortions, premature birth, low birth weight, chorioamnionitis and fungal systemic neonatal infection. The aim of present study was identification of Candida species by mycological and molecular methods in pregnant women with vaginal candidiasis. Methods: This cross-sectional study was performed on 80 pregnant women with or without clinical symptoms of vulvovaginal candidiasis referred to Shahid Noorani Talesh Hospital, Gilan University of Medical Sciences, Iran, from April to December 2015 (8 months). All specimens were examined by direct microscopy and culture on CHROMagar Candida medium for isolation and differentiation of major clinicalsignificant Candida species (spp.). Cultured media were incubated at 35 °C for 48 hours and evaluated based on color and number of grown colonies. If no growth was observed, the media were incubated for several additional days. Subcultures were done on Sabouraud dextrose agar (Merck, Germany) and Corn meal agar with Tween 80 media (Micromedia, Hungary) for further study. Identification of Candida spp. carried out by polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) method. Results: In this study, vulvovaginal candidiasis was observed in 20 (25%) patients. Twenty-two isolates were obtained from culture of specimens on CHROMagar Candida medium (Paris, France). The most common isolated species was Candida albicans 16 (72.8%) and followed by Candida glabrata 5 (22.7%), Candida tropicalis 3 (13.6%) and Candida krusei 1 (4.5%) cases. Two patients had mixed infection with 2 different Candida species (C. albicans and C. glabrata) While using PCR-RFLP method, the Candida species were identified as 13 (59.1%) Candida albicans, 5 (22.7%) Candida glabra, 3 (13.6%) Candida tropicalis and 1 (4.5%) Candida krusei cases, respectively. In direct examination were seen yeast budding cells and pseudohyphae in 8 culture positive specimens. In the present study, results of conventional mycological method in differentiation of Candida spp. were consistent with molecular results in 80% of cases. There was also significant correlation between vulvovaginal candidiasis with clinical symptoms (P<0.0001), including diabetes mellitus (P<0.014), and taking antibacterial drugs (P<0.003) in pregnant women. Conclusion: PCR-RFLP was able to identify correctly the Candida spp. as a complementary method. [ABSTRACT FROM AUTHOR]

Background: BK virus (BKV) is ubiquitous in human beings. Virus reactivation may occur in immunocompromised settings. The aim of this study was to compare BKV excretion in acquired immunocompromised children (kidney transplant recipients and steroid resistant nephrotic syndrome) with normal population. Materials and Methods: One hundred and thirty one participants less than 20 years were recruited in the case-control study from June 2009 to December 2010. The participants consisted of 40 patients with steroid resistant nephrotic syndrome (subgroup 1), 39 kidney transplant recipients (subgroup 2) and 52 normal populations as control group. The first morning urine samples were analyzed in duplicate by conventional polymerase chain reaction (PCR) method for BKV. Results: Nine participants out of 131 had positive results for BKV. Three patients in subgroup 1 (7.5%), two patients in subgroup 2 (5.1%) and six people (11.5%) in the control group had positive PCR results for urinary BKV. No significant difference was noted among groups, P = 0.53. The mean of glomerolar filtration rates in participants with positive and negative results for BKV were 125.5 ± 30.8 ml/min/m2 and 132.2 ± 42.5 ml/min/m2 respectively, P = 0.8. Conclusion: Acquired immunocompromised conditions did not increase the chance of urine BKV excretion in our study.

Background: BK virus (BKV) is ubiquitous in human beings. Virus reactivation may occur in immunocompromised settings. The aim of this study was to compare BKV excretion in acquired immunocompromised children (kidney transplant recipients and steroid resistant nephrotic syndrome) with normal population. Materials and Methods: One hundred and thirty one participants less than 20 years were recruited in the case‑control study from June 2009 to December 2010. The participants consisted of 40 patients with steroid resistant nephrotic syndrome (subgroup 1), 39 kidney transplant recipients (subgroup 2) and 52 normal populations as control group. The first morning urine samples were analyzed in duplicate by conventional polymerase chain reaction (PCR) method for BKV. Results: Nine participants out of 131 had positive results for BKV. Three patients in subgroup 1 (7.5%), two patients in subgroup 2 (5.1%) and six people (11.5%) in the control group had positive PCR results for urinary BKV. No significant difference was noted among groups, P = 0.53. The mean of glomerolar filtration rates in participants with positive and negative results for BKV were 125.5 ± 30.8 ml/min/m² and 132.2 ± 42.5 ml/min/m² respectively, P = 0.8. Conclusion: Acquired immunocompromised conditions did not increase the chance of urine BKV excretion in our study. [ABSTRACT FROM AUTHOR]

Rapid informative methods for assessing the species and quantitative composition of the microflora of the periodontal and oropharyngeal covering tissues are necessary for operative diagnostics, including those of the dentofacial system. The use of classical bacteriological methods, including seeding, incubation, counting and identification of microorganisms takes up to 5 days, resulting in a significant delay in obtaining the necessary information, which makes it difficult to carry out operative treatment measures. Therefore, the search for means and methods of operative microbiological control is urgent. The present work is devoted to substantiation of MSMM (mass spectrometry of microbial markers) technology application as a means of microbiological control of periodontal and other oropharyngeal biotopes., Competing Interests: The authors declare no conflict of interest.

Umeda M, Miwa Z, Takeuchi Y, Ishizuka M, Huang Y, Noguchi K, Tanaka M, Takagi Y, Ishikawa I. The distribution of periodontopathic bacteria among Japanese children and their parents. J Periodont Res 2004; doi: 10.1111/j.1600-0765.2004.00754.x© Blackwell Munksgaard 2004It is not well known how periodontopathic bacteria colonize in the oral cavity during childhood. The purpose of this study was to investigate the distribution of periodontopathic bacteria in oral cavities of children and their parents and the relationship between the bacterial findings and clinical parameters.Fifty-six children (mean age: 8.3 ± 3.5, range: 1–15 years), including 15 with deciduous dentition, 26 with mixed dentition and 15 with permanent dentition, and their parents participated in this study. Whole saliva and dental plaque of the children and whole saliva of their parents were collected for detection of seven species of periodontopathic bacteria (Actinobacillus actinomycetemcomitans,Tannerella forsythensis(Bacteroides forsythus),Campylobacter rectus,Porphyromonas gingivalis,Prevotella intermedia,Prevotella nigrescensandTreponema denticola) using the polymerase chain reaction method. Clinical parameters including simplified Oral Hygiene Index and Papillary-Marginal-Attachment Index were recorded for the children and their accompanied parents.The detection frequencies ofT. forsythensis,C. rectus,P. nigrescens,T. denticola,A. actinomycetemcomitans and P. gingivalisin the oral cavities of children were 42.9%, 94.6%, 42.9%, 48.2%, 1.8% and 8.9%, respectively.T. forsythensis,P. gingivalisandT. denticolawere detected more frequently in the saliva of parents (54.8%, 54.8%, 88.1%, respectively) than in the saliva of children (25.5%, 7.3%, 41.8%, respectively). Different detection frequencies ofP. nigrescenswere found among the oral cavities of children with deciduous, mixed and permanent dentitions. In mixed dentition, females harboredT. forsythensismore frequently than males did. Children who harboredT. forsythensis,P. intermedia,P. nigrescensandT. denticolashowed high scores for oral debris measurement by simplified Oral Hygiene Index.T. forsythensis,P. intermediaandP. nigrescenswere detected more frequently in children whose parents were positive for these pathogens than in children whose parents were negative.High plaque retention seems to promote the colonization of periodontal pathogens in the oral cavities of children.T. forsythensis,P. intermediaandP. nigrescenswere detected more frequently in the oral cavities of children whose parents already harbored these bacteria. Familial transmission of these bacteria is suggested. [ABSTRACT FROM AUTHOR]

Background: Epithelial ovarian cancer (EOC) is a major gynecological problem in Morocco represents more than 70% of ovarian cancers. Its etiology remains poorly understood. This study aimed to determine the presence of HBV-DNA in fresh EOC specimens from Moroccan patients. Materials and Methods: HBV-DNA was examined from DNA extracts of 50 fresh biopsies specimens from patients with histologically proven EOC by using PCR method. Results: HBV-DNA was found to be positive in four patients (8%). All of the positive patients had serous adenocarcinoma (10.3%) and advanced stage disease. Conclusion: The results of this study suggest that hepatitis B virus may be involved in the etiology of ovarian cancer. [ABSTRACT FROM AUTHOR]