Search

ABSTRACT To investigate the clinical features and mutational spectrum underlying hypertrophic cardiomyopathy (HCM) in São Miguel Island (Azores, Portugal), we analyzed 37 adult patients (12 sporadic, 25 familial) with positive genetic tests. Seven disease‐causing variants were identified, being two novels, in three sarcomeric genes (MYH7, TNNT2, and MYBPC3) and one non‐sarcomeric gene (ALPK3). The novel variants, classified as likely pathogenic (LP), involved large multi‐exon deletions in MYBPC3 (exons 26–32 and 28–33). These deletions were found in heterozygosity in two young males who remained clinically stable, though early onset may predict a more severe prognosis. Segregation analysis in a consanguineous family revealed two new genotypes: a digenic heterozygous for MYH7:c.1750G>C (p.Gly584Arg; P) and TNNT2:c.842A>T (p.Asn281Ile; LP) variants, and a homozygous for the TNNT2 variant. The 70‐year‐old homozygous patient remained stable and without arrhythmic events, challenging the belief that homozygous variants have a worse prognosis. This study is the first molecular and clinical analysis of HCM in the Azores. [ABSTRACT FROM AUTHOR]

Breeding for dwarfing traits in sorghum is crucial. However, only three genes (Dw1–Dw3) that control plant height have been mapped. In this study, 634 sorghum cultivars were collected to investigate plant height and genotypes. Four were genotyped Dw1DW2Dw3 (wild type) but with different plant heights, and they were selected to construct two populations and map new dwarf genes. Bulked segregant analysis with whole-genome resequencing of the two populations identified the candidate gene in one same genomic region—on chromosome 7. Then, it was narrowed down to a region containing nine genes. Amino acid and DNA sequence analysis of the parent and offspring plants revealed that two novel allelic mutations in the Dw3 gene play a role in reducing the plant height—8R262 or 8R417, including 1 bp substitution and 2 bp deletions. Furthermore, we sequenced 19 cultivars that primarily exhibited a "one-dwarf" hybrid or wild-type and presumed another allelic mutation via the amino acid alignment of 8R019, 8R100, and 8R402, which was another one-base substitution. These results indicate that multiple types of allelic mutations in the Dw3 gene should be considered when identified or applied. [ABSTRACT FROM AUTHOR]

Glycogen storage diseases (GSDs) are abnormally inherited glycogen metabolism mainly affecting the liver, muscles, and heart. Deficiency of proteins involved in glycogen metabolism caused by genetic mutations are responsible for different subtype of GSDs. However, there are still some challenges in diagnosing GSD. This study includes 39 suspected GSDs patients from unrelated families in China. Next‐generation sequencing (NGS) was used to investigate the reason for their diseases at the genetic level. Finally, all 39 patients were diagnosed with GSDs, including 20 GSD‐Ia, 4 GSD‐VI, and 15 GSD IX (12 GSD‐IXa patients and 3 GSD‐IXb patients). Thirty‐two mutations in G6PC1, PYGL, PHKA2, and PHKB genes were identified, with 14 of them being novel variants. The pathogenicity of novel variants was classified according to ACMG guildlines and predicted by in slico algorithms. Mutations p.L216L and p.R83H in G6PC1 gene may be the hot spot mutation in Chinese. Hearing impairment is a rare clinical feature of GSD Ia, which has also been observed in our cohort. The severity of GSD VI and IX was indicated by our patients. Close follow‐up should be applied to GSD VI and IX patients. Our findings provided evidence for building the phenotype–genotype of GSDs and expanded the mutation spectrum of related genes. [ABSTRACT FROM AUTHOR]

The article discusses a case study of a 4-year-old boy with psychomotor delay, microcephaly, and other physical symptoms, but without cerebellar atrophy or other central nervous system abnormalities. The boy was found to have a compound heterozygous genotype of novel variants in the WDR73 gene, which is associated with a form of autosomal recessive Galloway-Mowat syndrome. This case sheds light on the role of WDR73 mutations in neurodevelopmental disabilities and provides insights into the pathogenic mechanisms of this gene. [Extracted from the article]

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug-resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensive resistance (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides the analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definitions. Sub-lineage 4.3 (52%) was the most frequent genotype, and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected twenty novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. A cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug resistance prediction, presenting the best accuracy values for five of the nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) or genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil and the genetic and clinical data correlations and demonstrated its utility for surveillance efforts regarding the spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates. [ABSTRACT FROM AUTHOR]

Abstract Background Pontocerebellar hypoplasia is an umbrella term describing a heterogeneous group of prenatal neurodegenerative disorders mostly affecting the pons and cerebellum, with 17 types associated with 25 genes. However, some types of PCH lack sufficient information, which highlights the importance of investigating and introducing more cases to further elucidate the clinical, radiological, and biochemical features of these disorders. The aim of this study is to provide an in-depth review of PCH and to identify disease genes and their inheritance patterns in 12 distinct Iranian families with clinically confirmed PCH. Methods Cases included in this study were selected based on their phenotypic and genetic information available at the Center for Comprehensive Genetic Services. Whole-exome sequencing (WES) was used to discover the underlying genetic etiology of participants' problems, and Sanger sequencing was utilized to confirm any suspected alterations. We also conducted a comprehensive molecular literature review to outline the genetic features of the various subtypes of PCH. Results This study classified and described the underlying etiology of PCH into three categories based on the genes involved. Twelve patients also were included, eleven of whom were from consanguineous parents. Ten different variations in 8 genes were found, all of which related to different types of PCH. Six novel variations were reported, including SEPSECS, TSEN2, TSEN54, AMPD2, TOE1, and CLP1. Almost all patients presented with developmental delay, hypotonia, seizure, and microcephaly being common features. Strabismus and elevation in lactate levels in MR spectroscopy were novel phenotypes for the first time in PCH types 7 and 9. Conclusions This study merges previously documented phenotypes and genotypes with unique novel ones. Due to the diversity in PCH, we provided guidance for detecting and diagnosing these heterogeneous groups of disorders. Moreover, since certain critical conditions, such as spinal muscular atrophy, can be a differential diagnosis, providing cases with novel variations and clinical findings could further expand the genetic and clinical spectrum of these diseases and help in better diagnosis. Therefore, six novel genetic variants and novel clinical and paraclinical findings have been reported for the first time. Further studies are needed to elucidate the underlying mechanisms and potential therapeutic targets for PCH.

Objective: To study the clinical profile and molecular diagnosis of children with severe early-onset non-syndromic monogenic obesity. Methods: The clinical and molecular data (performed using whole exome sequencing) of 7 children with early-onset (< 5 years) nonsyndromic monogenic obesity were extracted from the Obesity Clinic files and analysed retrospectively. Results: The median (IQR) age at presentation was 18 (10.5-27) months. Of the 7 patients, 5 were boys, 3 had a history of parental consanguinity, and 4 had a family history of severe early-onset obesity. All patients exhibited hyperphagia and showed signs of insulin resistance. Dyslipidaemia and fatty liver were observed in 4. The variants identified in 6 patients included 2 in leptin receptor, and one each in melanocortin 4 receptor, pro-opiomelanocortin, leptin, and neurotrophic tyrosine kinase receptor type 2 genes. Notably, 4 of these variants were novel. Conclusion: This case series provides valuable insights into the spectrum of genetic mutations associated with non-syndromic monogenic obesity in North Indian children. The findings underscore the significance of next-generation sequencing in identifying the aetiology of severe early-onset obesity. [ABSTRACT FROM AUTHOR]

Simple Summary: Cleidocranial dysplasia is a rare disease, manifested by anomalies in the skull, face, teeth, thorax, clavicle, extremities, and short stature. The disease is caused by mutations in the RUNX2 gene, which is involved in the differentiation of cells that give rise and formation of bones. In this study, the genetic material of four patients and their families was analyzed, with the purpose of identifying changes in the sequence of the RUNX2 gene, finding three new changes and one change already reported in the literature. One patient presented cataract and damage to the retina of the eye, and data were not reported in other patients. A bioinformatic analysis of the RUNX2 protein was carried out with the aim of predicting mechanisms, such as the function, stability, and conformation of the protein, and of trying to understand its relationship with the variable presentation of signs and symptoms in this condition. These results can be useful in the genetic counselling of patients. Cleidocranial dysplasia (CCD) is an autosomal dominant skeletal dysplasia characterized by persistent open skull sutures with bulging calvaria, hypoplasia, or aplasia of clavicles permitting abnormal opposition of the shoulders; wide public symphysis; short middle phalanx of the fifth fingers; and vertebral, craniofacial, and dental anomalies. It is a rare disease, with a prevalence of 1–9/1,000,000, high penetrance, and variable expression. The gene responsible for CCD is the Runt-related transcription factor 2 (RUNX2) gene. We characterize the clinical, genetic, and bioinformatic results of four CCD cases: two cases within Mexican families with six affected members, nine asymptomatic individuals, and two sporadic cases with CCD, with one hundred healthy controls. Genomic DNA analyses of the RUNX2 gene were performed for Sanger sequencing. Bioinformatics tools were used to predict the function, stability, and structural changes of the mutated RUNX2 proteins. Three novel heterozygous mutations (c.651_652delTA; c.538_539delinsCA; c.662T>A) and a previously reported mutation (c.674G>A) were detected. In silico analysis showed that all mutations had functional, stability-related, and structural alterations in the RUNX2 protein. Our results show novel mutations that enrich the pool of RUNX2 gene mutations with CCD. Moreover, the proband 1 presented clinical data not previously reported that could represent an expanded phenotype of severe expression. [ABSTRACT FROM AUTHOR]

Simple Summary: The fall armyworm (FAW) is a pest that can cause severe damage to crops, particularly maize and cotton, resulting in agricultural losses. It has developed resistance to various types of insecticides due to certain gene mutations in its body. Our study aims to investigate how these genes affect the pest's sensitivity to insecticides. We utilized amplicon sequencing to analyze 21 sites within six related genes and identified both known and unknown mutations. Subsequently, molecular docking simulations were employed to assess the impact of these mutations on the binding ability between insecticides and proteins. Our findings indicate that these mutations reduce the binding ability, potentially contributing to increased insecticide resistance. Thus, our study could unveil the variation and evolution of resistance genes in FAW. The fall armyworm (FAW), Spodoptera frugiperda, is a worldwide agricultural pest that invaded China in 2018, and has developed resistance to multiple insecticides. The evolution of insecticide resistance is facilitated by mutations of target genes responsible for conferring resistance. In this study, amplicon sequencing analyzed 21 sites in six resistance genes. In addition to known mutations, unknown variants were also found, including novel variants: F290C (ace-1 gene, 0.1% frequency), I1040T/V (CHSA gene, 0.1% frequency), A309T (GluCl gene, 0.1% frequency), and I4790T/V (RyR gene, 0.1% frequency). Additionally, molecular docking was employed to investigate the impact of the aforementioned new mutations on insecticide binding to proteins. The analyses indicated that the binding abilities were reduced, similar to the resistance mutations that were reported, implying these novel mutations may confer transitional resistance. This study may provide a foundation for understanding the functions of these novel mutations in the evolutionary processes that drive the emergence of insecticide resistance in this invasive species. [ABSTRACT FROM AUTHOR]

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Background and aims: The occurrence of thiamine metabolism dysfunction syndrome (THMD), a rare autosomal recessive condition, may be linked to various mutations found in the TPK1 and SLC19A3 genes. The disease chiefly manifests through ataxia, muscle hypotonia, abrupt or subacute onset encephalopathy, and a decline in developmental milestones achieved during the early stages of infancy. We present findings from an investigation that involved two individuals from Iran, both of whom experienced seizures along with ataxia and hypotonia. The underlying genetic causes were found with the use of next-generation sequencing (NGS) technology, which has facilitated the detection of causal changes in a variety of genetic disorders. Material and methods: The selection of cases for this study was based on the phenotypic and genetic information that was obtainable from the Center for Comprehensive Genetic Services. The genetic basis for the problems observed among the participants was determined through the application of whole-exome sequencing (WES). Subsequently, sanger sequencing was employed as a means of validating any identified variations suspected to be causative. Results: The first patient exhibited a homozygous mutation in the TPK1 gene, NM_022445.4:c.224 T > A:p.I75 N, resulting in the substitution of isoleucine for asparagine at position 75 (p.I75 N). In our investigation, patient 2 exhibited a homozygous variant, NM_025243.4:c.1385dupA:pY462X, within the SLC19A3 gene. Conclusions: Collectively, when presented with patients showcasing ataxia, encephalopathy, and basal ganglia necrosis, it is essential to account for thiamine deficiency in light of the potential advantages of prompt intervention. At times, it may be feasible to rectify this deficiency through the timely administration of thiamine dosages. Accordingly, based on the results of the current investigation, these variations may be useful for the diagnosis and management of patients with THMD.

Background: Stickler syndrome is a multisystemic disorder characterized by ophthalmological and non‐ophthalmological abnormalities, frequently misdiagnosed due to high clinical heterogeneity. Stickler syndrome type I (STL1) is predominantly caused by mutations in the COL2A1 gene. Methods: Exome sequencing and co‐segregation analysis were utilized to scrutinize 35 families with high myopia, and pathogenic mutations were identified. Mutant COL2A1 was overexpressed in cells for mechanistic study. A retrospective genotype–phenotype correlation analysis was further conducted. Results: Two novel pathogenic mutations (c.2895+1G>C and c.3505G>A (p.Val1169Ile)) and two reported mutations (c.1597C>T (p.Arg533*) and c.1693C>T (p.Arg565Cys)) in COL2A1 were identified causing STL1. These mutations are all in the G‐X‐Y triplet, and c.2895+1G>C contributed to aberrant RNA splicing. COL2A1 mutants tended to form large aggregates in the endoplasmic reticulum (ER) and elevated ER stress. Additionally, mutations c.550G>A (p.Ala184Thr) and c.2806G>A (p.Gly936Ser) in COL2A1 were found in high myopia families, but were likely benign, although c.2806G>A (p.Gly936Ser) is on G‐X‐Y triplet. Moreover, genotype–phenotype correlation analysis revealed that mutations in exon 2 mainly contribute to retinal detachment, whereas mutations in the collagen alpha‐1 chain region of COL2A1 tend to cause non‐ophthalmologic symptoms. Conclusion: This study broadens the COL2A1 gene mutation spectrum, provides evidence for ER stress caused by pathogenic COL2A1 mutations and highlights the importance of non‐ophthalmological examination in clinical diagnosis of high myopia. [ABSTRACT FROM AUTHOR]

Introduction: Recessive mutations in the CAPN3 gene can lead to limb-girdle muscular dystrophy recessive 1 (LGMD R1). Targeted next-generation sequencing facilitates the discovery of new mutations linked with disease, owing to its ability to selectively enrich specific genomic regions. Methods: We performed targeted next-generation sequencing of all exons of the CAPN3 gene in 4 patients with sporadic limb-girdle muscular dystrophy (LGMD) and further analyzed the effects of the novel identified variant using various software tools. Results: We found 5 variants in CAPN3 gene in 4 patients, c.82_83insC (insertion mutation) and c.1115+2T>C (splicing mutation) are reported for the first time in CAPN3 (NM_000070.2). The bioinformatics analysis indicated that these two novel variants affected CAPN3 transcription as well as translation. Discussion: Our findings reveal previously unreported splicing mutation and insertion mutation in CAPN3 gene, further expanding the pathogenic gene profile of LGMD. [ABSTRACT FROM AUTHOR]

Background: β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion: Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis. [ABSTRACT FROM AUTHOR]

Infantile hypotonia with psychomotor retardation and characteristic facies 1 (IHPRF1) is caused by biallelic mutations in the NALCN gene, the major ion channel responsible for the background Na + conduction in neurons. Through whole-exome sequencing (WES), we report three novel homozygous variants in three families, including c.1434 + 1G > A, c.3269G > A, and c.2648G > T, which are confirmed and segregated by Sanger sequencing. Consequently, intron 12's highly conserved splice donor location is disrupted by the pathogenic c.1434 + 1G > A variation, most likely causing the protein to degrade through nonsense-mediated decay (NMD). Subsequently, a premature stop codon is thus generated at amino acid 1090 of the protein as a result of the pathogenic c.3269G > A; p.W1090* variation, resulting in NMD or truncated protein production. Lastly, the missense mutation c.2648G > T; p.G883V can play a critical role in the interplay of functional domains. This study introduces recurrent urinary tract infections for the first time, broadening the phenotypic range of IHPRF1 syndrome in addition to the genotypic spectrum. This trait may result from insufficient bladder emptying, which may be related to the NALCN channelosome's function in background Na + conduction. This work advances knowledge about the molecular genetic underpinnings of IHPRF1 and introduces a novel phenotype through the widespread use of whole exome sequencing. [ABSTRACT FROM AUTHOR]

Aim: 17 α-hydroxylase/17,20-lyase deficiency (17-OHD) is an extremely rare autosomal recessive disorder that typically causes hypertension, hypokalaemia, primary amenorrhoea, and the absence of secondary sex characteristics in 46,XX individuals. Partial 17-OHD is even rarer than complete 17-OHD and is prone to missed diagnosis due to its subtler symptoms. The aim of this study was to help early detection and diagnosis of partial 17-OHD. Methods: We present a case of a 41-year-old female (46,XX) patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). This patient experienced hypertension, hypokalaemia and adrenal hyperplasia, but did not present with primary amenorrhoea or absence of secondary sex characteristics. Initially, she was misdiagnosed and underwent right and left adrenalectomy, but the procedures were ineffective. Afterward, she received a one-month treatment of 0.5 mg dexamethasone, which greatly relieved her symptoms. Additionally, we reviewed reports of thirteen other patients with partial 17-OHD in 46,XX individuals from the literature, totalling fourteen probands. Results: We found that primary amenorrhoea, hypertension, hypokalaemia, and ovarian cysts accounted for 15.4%, 42.9%, 38.5%, and 72.7% of these patients, respectively. In contrast, elevated serum progesterone was present in all patients. Conclusion: Based on our literature review, the absence of primary amenorrhoea, hypertension or hypokalaemia cannot rule out suspicion for 17-OHD in 46,XX individuals. However, an elevation in serum progesterone levels is a highly sensitive indicator for diagnosing 17-OHD. 17-OHD is a rare cause of secondary hypertension, often with hypokalaemia, primary amenorrhoea and absence of secondary sex characteristics. Partial 17-OHD is an even rarer subtype of 17-OHD, with subtler symptoms. There are few reports concerning partial 17-OHD, especially in 46,XX patients. We reported a case of a 46,XX patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). We also conducted a literature review to summarise the clinical, hormonal and genetic characteristics of fourteen 46,XX probands with partial 17-OHD. From the literature review, we found that: Most 46,XX patients with partial 17-OHD presented with partial pubic hair, breast development, oligomenorrhea or secondary amenorrhoea, normotension, and/or normokalemia. All 46,XX patients with partial 17-OHD presented with elevated serum progesterone. However, the relationship between in vitro enzyme activities of the 17-hydroxylase and/or17,20-lyase and clinical severity is still unclear. The current study can help early detection and diagnosis of partial 17-OHD. [ABSTRACT FROM AUTHOR]

Two Iranian patients with purine nucleoside phosphorylase (PNP) deficiency are described in terms of their clinical and molecular evaluations. PNP deficiency is a rare form of combined immunodeficiency with a profound cellular defect. Patients with PNP deficiency suffer from variable recurrent infections, hypouricemia, and neurological manifestations. Furthermore, patient 1 developed mild cortical atrophy, and patient 2 presented developmental delay, general muscular hypotonia, and food allergy. The two unrelated patients with developed autoimmune hemolytic anemia and T cells lymphopenia and eosinophilia were referred to Immunology, Asthma and Allergy Research Institute (IAARI) in 2019. After taking blood and DNA extraction, genetic analysis of patient 1 was performed by PCR and direct sequencing and whole exome sequencing was applied for patient 2 and the result was confirmed by direct sequencing in the patient and his parents. The genetic result showed two novel variants in exon 3 (c.246_285 + 9del) and exon 5 (c.569G > T) PNP (NM_000270.4) in the patients, respectively. These variants are considered likely pathogenic based on the American College of Medical Genetics and Genomics (ACMG) guideline. PNP deficiency has a poor prognosis; therefore, early diagnosis would be vital to receive hematopoietic stem cell transplantation (HSCT) as a prominent and successful treatment. [ABSTRACT FROM AUTHOR]

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug-resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensive resistance (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides the analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definitions. Sub-lineage 4.3 (52%) was the most frequent genotype, and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected twenty novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. A cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug resistance prediction, presenting the best accuracy values for five of the nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) or genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil and the genetic and clinical data correlations and demonstrated its utility for surveillance efforts regarding the spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates.

Aim: 17 α-hydroxylase/17,20-lyase deficiency (17-OHD) is an extremely rare autosomal recessive disorder that typically causes hypertension, hypokalaemia, primary amenorrhoea, and the absence of secondary sex characteristics in 46,XX individuals. Partial 17-OHD is even rarer than complete 17-OHD and is prone to missed diagnosis due to its subtler symptoms. The aim of this study was to help early detection and diagnosis of partial 17-OHD. Methods: We present a case of a 41-year-old female (46,XX) patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). This patient experienced hypertension, hypokalaemia and adrenal hyperplasia, but did not present with primary amenorrhoea or absence of secondary sex characteristics. Initially, she was misdiagnosed and underwent right and left adrenalectomy, but the procedures were ineffective. Afterward, she received a one-month treatment of 0.5 mg dexamethasone, which greatly relieved her symptoms. Additionally, we reviewed reports of thirteen other patients with partial 17-OHD in 46,XX individuals from the literature, totalling fourteen probands. Results: We found that primary amenorrhoea, hypertension, hypokalaemia, and ovarian cysts accounted for 15.4%, 42.9%, 38.5%, and 72.7% of these patients, respectively. In contrast, elevated serum progesterone was present in all patients. Conclusion: Based on our literature review, the absence of primary amenorrhoea, hypertension or hypokalaemia cannot rule out suspicion for 17-OHD in 46,XX individuals. However, an elevation in serum progesterone levels is a highly sensitive indicator for diagnosing 17-OHD.

Introduction: Wilson’s disease is an autosomal recessive disorder caused by ATP7B pathogenic mutations. The hallmark of this disorder mainly consists of liver involvement, neurologic dysfunction and psychiatric features. In addition, the kidneys can also be affected by excessive copper deposition. Methods: A total of 34 patients clinically diagnosed with WD were recruited. They underwent ATP7B gene sequencing and clinical data of symptoms, examination, and treatment were collected. Moreover, renal pathology information was also investigated. Results: We identified 25 potentially pathogenic ATP7B variants (16 missense, 5 frameshift, 3 splicing variants and 1 large deletion mutation) in these 34 WD patients, 5 of which were novel. In our cases, the most frequent variant was c.2333G>T (R778L, 39.06%, exon 8), followed by c.2621C>T (A874V, 10.94%, exon 11) and c.3316G>A (V1106I, 7.81%, exon 11). Furthermore, we described the thinning of the glomerular basement membrane as a rare pathologically damaging feature of Wilson’s disease for the first time. Additionally, two patients who received liver transplant were observed with good prognosis in present study. Discussion: Our work expanded the spectrum of ATP7B variants and presented rare renal pathological feature in WD patients, which may facilitate the development of early diagnosis, counseling, treatment regimens of WD. [ABSTRACT FROM AUTHOR]

Pathogenic variants in IMPDH1 are associated with autosomal dominant retinitis pigmentosa 10 (RP10), and Leber congenital amaurosis 11. This case report of a 13-year-old girl with Down's syndrome and keratoglobus is aimed at linking the novel variant IMPDH1 c.134A>G, p.(Tyr45Cys), a variant of uncertain significance, to a clinical phenotype and to provide grounds for the objective assignment of its benign features. RP10 is characterized by the early onset and rapid progression of ocular symptoms, beginning with nyctalopia in childhood, accompanied by typical RP fundus changes. As evidenced via thorough clinical examination and testing, none of the RP10 characteristics were present in our patient. On the contrary, our patient who was heterozygous for IMPDH1 c.134A>G, p.(Tyr45Cys) showed no signs of peripheral retinal dystrophy, and did not manifest any disease characteristics typical of the IMPDH1 gene mutation. Consequently, we conclude that the variant did not contribute to the phenotype. According to standards and guidelines for the interpretation of sequence variants, IMPDH1 c.134A>G, p.(Tyr45Cys) revealed likely benign features. [ABSTRACT FROM AUTHOR]

Myotonia congenita (MC) is a rare genetic disease caused by mutations in the skeletal muscle chloride channel gene (CLCN1), encoding the voltage-gated chloride channel ClC-1 in skeletal muscle. Our study reported the clinical and molecular characteristics of six patients with MC and systematically review the literature on Chinese people. We retrospectively analyzed demographics, clinical features, family history, creatine kinase (CK), electromyography (EMG), treatment, and genotype data of our patients and reviewed the clinical data and CLCN1 mutations in literature. The median ages at examination and onset were 26.5 years (range 11–50 years) and 6.5 years (range 1.5–11 years), respectively, in our patients, and 21 years (range 3.5–65 years, n = 45) and 9 years (range 0.5–26 years, n = 50), respectively, in literature. Similar to previous reports, myotonia involved limb, lids, masticatory, and trunk muscles to varying degrees. Warm-up phenomenon (5/6), percussion myotonia (3/5), and grip myotonia (6/6) were common. Menstruation triggered myotonia in females, not observed in Chinese patients before. The proportion of abnormal CK levels (4/5) was higher than data from literature. Electromyography performed in six patients revealed myotonic changes (100%). Five novel CLCN1 mutations, including a splicing mutation (c.853 + 4A>G), a deletion mutation (c.2010_2014del), and three missense mutations (c.2527C>T, c.1727C>T, c.2017 G > C), were identified. The c.892 G > A (p.A298T) mutation was the most frequent mutation in the Chinese population. Our study expanded the clinical and genetic spectrum of patients with MC in the China. The MC phenotype in Chinese people is not different from that found in the West, while the genotype is different.

Copyright of Clinical Neuroscience / Ideggyógyászati Szemle is the property of LifeTime Media Kft. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Buccal mucosa cancer has an aggressive nature as it rapidly grows and penetrates with high recurrence rate. Strikingly, carcinoma of buccal mucosa is the most common cancer of oral cavity in India. Recently, telomerase and telomere biology have been implicated in the pathogenesis and progression in various cancers via regulation of telomere maintenance by telomerase expression which is controlled by telomerase reverse transcriptase (TERT) promoter. Strikingly, h-TERT promoter mutations have been incriminated in regulation of telomerase gene expression. Here, we present a 35 years old male with intense coughing, short breathlessness and fever since 15 days, was admitted to the pulmonary unit. He was a chronic smoker and gutka user. The cytopathological analysis of gastric aspirate revealed buccal mucosa carcinoma of IV stage. We identified h-TERT promoter mutations in isolated genomic DNA from whole blood using DNA sequencer. Genetic analysis disclosed that h-TERT promoter region was highly mutated in this patient. Identified mutations include C.-248 del G, C.-272 del G, C.-279 del G, C.-331 del G, C.-349 del G, C.-351 del C, C.-360 G > A, C.-362 T > A, C.-371 del T and C.-372 del T. Further, all identified mutations were subjected to predict the pathologic functional consequences using bioinformatics tools viz TFsitescan and CiiiDER which showed either loss or gain of transcription factors binding sites in h-TERT promoter. This is a unique case in which total 9 mutations were observed in h-TERT promoter in a single case. In conclusion, all together these mutations in h-TERT promoter may alter the epigenetics and subsequently the tenacity of binding transcription factors which are of functional significance. [ABSTRACT FROM AUTHOR]

Citrin deficiency (CD) is an autosomal recessive disease caused by mutations of the SLC25A13 gene, plasma bile acid profiles detected by liquid chromatography-tandem mass spectrometry (LC-MS/MS) could be an efficient approach for early diagnosis of intrahepatic cholestasis. The aim of this study was to investigate the genetic testing and clinical characteristics of a series of patients with CD, and to analyse plasma bile acid profiles in CD patients. We retrospectively analysed data from 14 patients (12 males and 2 females, age 1–18 months, mean 3.6 months) with CD between 2015 and 2021, including demographics, biochemical parameters, genetic test results, treatment, and clinical outcomes. In addition, 30 cases (15 males and 15 females, age 1–20 months, mean 3.8 months) with idiopathic cholestasis (IC) served as a control group. Plasma 15 bile acid profiles were compared between the CD and IC groups. Eight different mutations of the SLC25A13 gene were detected in the 14 patients diagnosed with CD, of which three novel variants of the SLC25A13 gene were investigated, the c.1043C>T (p.P348L) in exon11, the c.1216dupG (p.A406 Gfs*13) in exon12 and the c.135G>C (p.L45F) in exon3. More than half of the patients with CD had prolonged neonatal jaundice, which was associated with significantly higher alpha-fetoprotein (AFP) levels, hyperlactatemia and hypoglycemia. The majority of patients were ultimately self-limited. Only one patient developed liver failure and died at the age of 1 year due to abnormal coagulation function. In addition, the levels of glycochenodeoxycholic acid (GCDCA), taurocholate (TCA), and taurochenodeoxycholic acid (TCDCA) were significantly increased in the CD group compared with those in the IC group. Three novel variants of the SLC25A13 gene were identified for the first time, providing a reliable molecular reference and expanding the SLC25A13 gene spectrum in patients with CD. Plasma bile acid profiles could be a potential biomarker for non-invasive early diagnosis of patients with intrahepatic cholestasis caused by CD. [ABSTRACT FROM AUTHOR]

Cleidocranial dysplasia (CCD) is an autosomal dominant skeletal dysplasia characterized by persistent open skull sutures with bulging calvaria, hypoplasia, or aplasia of clavicles permitting abnormal opposition of the shoulders; wide public symphysis; short middle phalanx of the fifth fingers; and vertebral, craniofacial, and dental anomalies. It is a rare disease, with a prevalence of 1–9/1,000,000, high penetrance, and variable expression. The gene responsible for CCD is the Runt-related transcription factor 2 (RUNX2) gene. We characterize the clinical, genetic, and bioinformatic results of four CCD cases: two cases within Mexican families with six affected members, nine asymptomatic individuals, and two sporadic cases with CCD, with one hundred healthy controls. Genomic DNA analyses of the RUNX2 gene were performed for Sanger sequencing. Bioinformatics tools were used to predict the function, stability, and structural changes of the mutated RUNX2 proteins. Three novel heterozygous mutations (c.651_652delTA; c.538_539delinsCA; c.662T>A) and a previously reported mutation (c.674G>A) were detected. In silico analysis showed that all mutations had functional, stability-related, and structural alterations in the RUNX2 protein. Our results show novel mutations that enrich the pool of RUNX2 gene mutations with CCD. Moreover, the proband 1 presented clinical data not previously reported that could represent an expanded phenotype of severe expression.

The fall armyworm (FAW), Spodoptera frugiperda, is a worldwide agricultural pest that invaded China in 2018, and has developed resistance to multiple insecticides. The evolution of insecticide resistance is facilitated by mutations of target genes responsible for conferring resistance. In this study, amplicon sequencing analyzed 21 sites in six resistance genes. In addition to known mutations, unknown variants were also found, including novel variants: F290C (ace-1 gene, 0.1% frequency), I1040T/V (CHSA gene, 0.1% frequency), A309T (GluCl gene, 0.1% frequency), and I4790T/V (RyR gene, 0.1% frequency). Additionally, molecular docking was employed to investigate the impact of the aforementioned new mutations on insecticide binding to proteins. The analyses indicated that the binding abilities were reduced, similar to the resistance mutations that were reported, implying these novel mutations may confer transitional resistance. This study may provide a foundation for understanding the functions of these novel mutations in the evolutionary processes that drive the emergence of insecticide resistance in this invasive species.

Background: Androgens and androgen receptor (AR) are critical regulators of the masculinization process in male sexual development. The absence of a functioning AR results in the development of the androgen insensitivity syndrome (AIS), a rare disorder of sexual development (DSD) characterized by the external genitalia feminization, gynecomastia, and impaired spermatogenesis. Objective: To determine the AR gene mutations associated with male DSD in four unrelated Vietnamese patients. Methods: To detect the disease-causing mutations, whole exome sequencing (WES) was performed on four patients diagnosed with AIS. Sanger sequencing was then used for validation of the identified mutations. Finally, 12 web-based tools, three-dimensional protein modeling software, and the guidelines issued by the American College of Medical Genetics and Genomics were used to assess the potential pathogenicity of these mutations. Results: Four distinct novel mutations, namely c.1834T > A (p.Cys612Ser), c.2122 C > G (p.Leu708Val), c.2630T > G (p.Phe877Cys), and c.2641 C > A (p.Leu881Met) in the AR gene, were identified in four AIS patients using WES. The in silico analysis results revealed that the Cys612, Leu708, Phe877, and Leu881 sites are important for an appropriate response to androgens of the AR, and mutation at these sites can have adverse effects on the AR functions, androgen–AR interaction, and AR signaling pathway. Conclusions: WES and in silico analyses strongly suggested that four novel AR mutations are pathogenic and have led to the development of AIS in the four Vietnamese patients under consideration. [ABSTRACT FROM AUTHOR]

BackgroundNeonatal sclerosing cholangitis (NSC) is a rare and severe autosomal recessive inherited liver disease with mutations in DCDC2, commonly requiring liver transplantation (LT) for decompensated biliary cirrhosis in childhood.MethodsThe information of four Chinese patients with NSC caused by mutations in DCDC2 from Children's Hospital of Fudan University were gathered. The four patients' clinicopathological and molecular features were summarized by clinical data, liver biopsy, immunohistochemical, and molecular genetic analysis.ResultsAll patients presented with jaundice, hepatosplenomegaly, hyperbilirubinemia and bile embolism, and high serum γ-glutamyl transferase activity (GGT). Liver biopsies revealed varying degrees of bile duct hyperplasia, portal-tract inflammation, and/or fibrosis. Whole-exome sequencing (WES) found novel heterozygous variants of c.1024-1G > T /p.? and c.544G > A /p. Gly182Arg in the DCDC2.ConclusionThis study expands the genetic spectrum of DCDC2 in NSC.

Lung cancer is a severe and the leading cause of cancer related deaths worldwide. The recurrent h-TERT promoter mutations have been implicated in various cancer types. Thus, the present study is extended to analyze h-TERT promoter mutations from the North Indian lung carcinoma patients. Total 20 histopathologically and clinically confirmed cases of lung cancer were enrolled in this study. The genomic DNA was extracted from venous blood and subjected to amplification using appropriate h-TERT promoter primers. Amplified PCR products were subjected for DNA Sanger sequencing for the identification of novel h-TERT mutations. Further, these identified h-TERT promoter mutations were analysed for the prediction of pathophysiological consequences using bioinformatics tools such as Tfsitescan and CIIDER. The average age of patients was 45 ± 8 years which was categorized in early onset of lung cancer with predominance of male patients by 5.6 fold. Interestingly, h-TERT promoter mutations were observed highly frequent in lung cancer. Identified mutations include c. G272A, c. T122A, c. C150A, c. 123 del C, c. C123T, c. G105A, c. 107 Ins A, c. 276 del C corresponding to −168 G>A, −18 T>A, −46 C>A, −19 del C, −19 C>T, −1 G>A, −3 Ins A, −172 del C respectively from the translation start site in the promoter of the telomerase reverse transcriptase gene which are the first time reported in germline genome from lung cancer. Strikingly, c. −18 T>A [C.T122A] was found the most prevalent variant with 75% frequency. Notwithstanding, other mutations viz c. -G168A [c. G272A] and c. −1 G>A [c. G105A] were found to be at 35% and 15% frequency respectively whilst the rest of the mutations were present at 10% and 5% frequency. Additionally, bioinformatics analysis revealed that these mutations can lead to either loss or gain of various transcription factor binding sites in the h-TERT promoter region. Henceforth, these mutations may play a pivotal role in h-TERT gene expression. Taken together, these identified novel promoter mutations may alter the epigenetics and subsequently various transcription factor binding sites which are of great functional significance. Thereby, it is plausible that these germline mutations may involve either as predisposing factor or direct participation in the pathophysiology of lung cancer through entangled molecular mechanisms. [ABSTRACT FROM AUTHOR]

Hygienic behavior (HB) is a crucial biological mechanism in honeybees that is associated with disease resistance. This study aimed to investigate the effect of the SNP18 sequence and environmental factors on the HB of honey bees, using a total of 14 colonies and 148 bee samples from seven different bee breeds. Association analysis revealed that colonies with Italian hybrids (IH) or young queens statistically (p < 0.01) exhibited high hygienic behavior (HHB). HB increased by 71.6% when the number of frames in the colony, representing colony power (CP), increased by one (p < 0.05). In restriction fragment length polymorphism (RFLP) analysis, novel mutations in the MlyI polymorphism of the SNP18 sequence were firstly found in Apis mellifera. In addition, the restriction fragments of the novel variants of the SNP18 HHB and SNP18 low hygienic behavior (LHB) lines were determined by sequencing. In this study, several important findings emerged: Due to one-base differences in the restriction fragment, this sequence could not be genotyped by RFLP. Honeybees could be homozygous (HHB or LHB) or heterozygous (HHB and LHB) for the SNP18. SNP18 sequence could be located in different regions of the chromosome and could only be determined by genome sequencing. Finally, since genotypes cannot be clearly determined, no specific allele or genotype can be recommended for HB selection in beekeeping. Therefore, additional research is required to assess discovered novel variants for genetic selection of HHB for ecological beekeeping, healthy products and sustainability., (© 2024 Wiley Periodicals LLC.)

Aim. This study aims to model the mutant structures of PSEN2 protein associated with Alzheimer's disease by comparative modeling using computational tools. Materials and Methods. In the present study, we have retrieved the sequence of the protein from UniProt and a list of mutations that were predicted to have deleterious effects on PSEN2 protein from Alzforum database and performed modeling of the mutant structures using Phyre 2, Swiss Model and trRosetta Results. Ten mutant structures were modeled by Comparative modeling, threading and ab-initio methods using three web servers. Conclusion. Thus, we have modeled the mutant structures by inducing each of these mutations G212V, I149T, L143H, L238P, P436L, R163C, R284G, S175C, S175F and T430M in the PSEN2 protein using three different molecular modeling web tools used in our study. These mutant structures can further be focused upon for characterization and molecular docking studies in order to find a potential cure for EOAD. [ABSTRACT FROM AUTHOR]

Background and Objective: Pakistan has witnessed a dramatic change in the increasing prevalence and emergence of HIV subtypes for more than two decades. Pakistani population is increasingly engaged in high-risk practices, and the prescribed drugs are potentially causing resistance. There are chances that these resistant strains are beginning to circulate from high-risk to the general population. Methods: The study was conducted at the section of Molecular Pathology Lab of Dow Diagnostic and Research Laboratory, Dow University of Health Sciences (DUHS) Karachi. In this study, we analyzed gene sequences of HIV for drug resistance and molecular epidemiology., along with amino acid sequence variability. Furthermore, we undertook phylogenetic analysis for possible geographic linkages of Pakistani HIV strains. Results: Our results demonstrate that A1 is the leading HIV subtype circulating in the country, whereas other emerging subtypes and recombinant forms, including subtype B, CRF02_AG, CRF10_CD CRF35_AD, and CRF11_cpx were also observed. Our sequences cluster with the Middle East, African, and a few European sequences according to geographical distribution. These sequences showed high-level resistance per drug resistance pattern, with 62.5% of patients exhibiting resistance to NNRTI drugs and 60% mutation at E138A and K103N, respectively, against NNRTI drugs. About 75% sequences showed resistance mutation at M184V against NRTI drugs. The antiretroviral drugs are now causing H-LR to the patients with no effect. Our results also revealed that certain regions of RT exhibited high sequence variability, especially at Amino Acids positions p.119, p.130, p.157, p.164. Conclusion: We hereby report major novel mutations and several minor mutations that may have a drastic change in the drug resistance pattern. [ABSTRACT FROM AUTHOR]

This review collates information on the onset of COVID-19, SARS-CoV-2 genome architecture, emergence of novel viral lineages that drove multiple waves of infection around the world and standard and fast track development of vaccines. With the passage of time, the continuously evolving SARS-CoV-2 has acquired an expanded mutational landscape. The functional characterization of spike protein mutations, the primary target of diagnostics, therapeutics and vaccines has revealed increased transmission, pathogenesis and immune escape potential in the variant lineages of the virus. The incurred mutations have also resulted in substantial viral neutralization escape to vaccines, monoclonal, polyclonal and convalescent antibodies presently in use. The present situation suggests the need for development of precise next-generation vaccines and therapeutics by targeting the more conservative genomic viral regions for providing adequate protection. [ABSTRACT FROM AUTHOR]

Background: Intrahepatic cholestasis of pregnancy (ICP) is associated with a high incidence of fetal morbidity and mortality. Therefore, revealing the mechanisms involved in ICP and its association with fetal complications is very important. Methods: Here, we used a whole-exome sequencing (WES) approach to detect novel mutations of organic anion transporting polypeptide (OTAP) genes, ATPbinding cassette transporter (ABC) genes, and receptor genes associated with ICP in 249 individuals and 1,029 local control individuals. Two available tools, SIFT and PolyPhen-2, were used to predict protein damage. Protein structuremodeling and comparison between the reference and modified protein structures were conducted by SWISS-MODEL and Chimera 1.14rc software, respectively. Results: A total of 5,583 mutations were identified in 82 genes related to bile acid transporters and receptors, of which 62 were novel mutations. These novel mutations were absent in the 1,029 control individuals and three databases, including the 1,000 Genome Project (1000G_ALL), Exome Aggregation Consortium (ExAC), and Single-Nucleotide Polymorphism Database (dbSNP). We classified the 62 novel loci into two groups (damaging and probably damaging) according to the results of SIFT and PolyPhen-2. Out of the 62 novel mutations, 24 were detected in the damaging group. Of these, five novel possibly pathogenic variants were identified that were located in known functional genes, including ABCB4 (Ile377Asn), ABCB11 (Ala588Pro), ABCC2 (Ile681Lys and Met688Thr), and NR1H4 (Tyr149Ter). Moreover, compared to the wild-type protein structure, ABCC2 Ile681Lys and Met688Thr protein structures showed a slight change in the chemical bond lengths of ATP-ligand binding amino acid side chains. The combined 32 clinical data points indicate that the mutation group had a significantly (p = 0.04) lower level of Cl ions than the wildtype group. Particularly, patients with the 24 novel mutations had higher average values of alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP), total bile acids (TBA), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) than patients with the 38 novel mutations in the probably damaging group and the local control individuals. Conclusion: The present study provides new insights into the genetic architecture of ICP involving these novel mutations. [ABSTRACT FROM AUTHOR]

Background: Next‐generation sequencing (NGS)‐based method is being used broadly for genetic testing especially for clinically and genetically heterogeneous disorders, such as inherited retinal degenerations (IRDs) but still not routinely used for molecular diagnostics in Bulgaria. Consequently, the purpose of this study was to evaluate the effectiveness of a molecular diagnostic approach, based on targeted NGS for the identification of the disease‐causing mutations in 16 Bulgarian patients with different IRDs. Methods: We applied a customized NGS panel, including 125 genes associated with retinal and other eye diseases to the patients with hereditary retinopathies. Results: Systematic filtering approach coupled with copy number variation analysis and segregation study lead to the identification of 16 pathogenic and likely pathogenic variants in 12/16 (75%) of IRD patients, 2 of which novel (12.5%): ABCA4‐c.668delA (p.K223Rfs18) and RР1‐c.2015dupA (p.K673Efs*25). Mutations in the ABCA4, PRPH2, USH2A, BEST1, RР1, CDHR1, and RHO genes were detected reaching a diagnostic yield between 42.9% for Retinitis pigmentosa cases and 100% for macular degeneration, Usher syndrome, and cone‐rod dystrophy patients. Conclusion: Our results confirm the usefulness of targeted NGS approach based on frequently mutated genes as a comprehensive and successful genetic diagnostic tool for IRDs with significant impact on patients counseling. [ABSTRACT FROM AUTHOR]

Introduction: GNE myopathy is an autosomal recessive distal myopathy caused by a biallelic mutation in UDP-N-acetylglucosamine 2-epomerase/N-acetylmannosamine kinase. In this study, we discuss the clinical features, pathological characteristics, genetic profiles, and atypical clinical manifestations of 22 Chinese GNE patients.Materials and Methods: Retrospective analysis was performed for GNE myopathy patients at our institute between 2005 and 2021. Histopathological analysis and gene testing were done according to standard protocols.Results: Molecular analysis revealed 14-reported and 7 novel mutations, including c.125G > A (p.P42Q), c.226G > A (p.V76I), c.970C > G (p.H324D), c.155A > G (p.D52G), c.1055G > A (p.R352H), c.1064G > A (p.G355E), and c.491 T > C (p.I164T) in GNE. D207V was the most frequent mutation showing an allele frequency of 25%. A total of 21 patients presented classic clinical manifestation, and only 1 patient had signs of proximal muscle weakness. A patient containing p.V603L and p.R160X mutations showed idiopathic thrombocytopenia and distal weakness. There were 4 female patients who experienced rapid deterioration after pregnancy.Discussion: Our study revealed 7 novel mutations in GNE, where p.D207V was shown as a potential hotspot mutation in Chinese patients. Idiopathic thrombocytopenia should be a concern in GNE myopathy patients. Twenty-seven percent of female patients experienced rapid deterioration during pregnancy or after delivery. [ABSTRACT FROM AUTHOR]

BackgroundIn this study, we evaluated the clinical characteristics, prognosis, and gene mutations of five children with citrullinemia type I (CTLN1) diagnosed in our department and identified two novel ASS1 gene mutations.MethodsWe examined the clinical characteristics, prognosis, and gene mutations of the five children through data collection, tandem mass spectrometry, and whole-exon sequencing. MutationTaster, regSNP-intron, and SWISS-MODEL were used for bioinformatic analysis to evaluate the two novel gene mutations. We analyzed differences in blood ammonia and citrulline levels based on clinical phenotypes. Finally, we reviewed the medical literature describing Chinese children with CTLN1.ResultsASS1 C773 + 6T > G and c.848 delA as well as c.952_953 del insTT and c.133G > A have not been previously reported in the Human Gene Mutation Database. Using MutationTaster and regSNP-intron, we predicted that these mutations affected protein function. The 3D structure obtained using SWISS-MODEL supported this prediction. Through comparative analysis showed that the ammonia level of the neonatal type was markedly higher than that of other types, whereas citrulline levels did not differ between groups.ConclusionWe identified two novel mutations that cause disease. The blood ammonia level of neonatal form citrullinemia was markedly higher than that of other types. The genotype-phenotype association in Chinese patients remains unclear and should be further evaluated in genetic studies of larger sample sizes.

Abstract Background Next‐generation sequencing (NGS)‐based method is being used broadly for genetic testing especially for clinically and genetically heterogeneous disorders, such as inherited retinal degenerations (IRDs) but still not routinely used for molecular diagnostics in Bulgaria. Consequently, the purpose of this study was to evaluate the effectiveness of a molecular diagnostic approach, based on targeted NGS for the identification of the disease‐causing mutations in 16 Bulgarian patients with different IRDs. Methods We applied a customized NGS panel, including 125 genes associated with retinal and other eye diseases to the patients with hereditary retinopathies. Results Systematic filtering approach coupled with copy number variation analysis and segregation study lead to the identification of 16 pathogenic and likely pathogenic variants in 12/16 (75%) of IRD patients, 2 of which novel (12.5%): ABCA4‐c.668delA (p.K223Rfs18) and RР1‐c.2015dupA (p.K673Efs*25). Mutations in the ABCA4, PRPH2, USH2A, BEST1, RР1, CDHR1, and RHO genes were detected reaching a diagnostic yield between 42.9% for Retinitis pigmentosa cases and 100% for macular degeneration, Usher syndrome, and cone‐rod dystrophy patients. Conclusion Our results confirm the usefulness of targeted NGS approach based on frequently mutated genes as a comprehensive and successful genetic diagnostic tool for IRDs with significant impact on patients counseling.

Abstract Background Lymphatic malformations (LMs) are benign congenital malformations that stem from the abnormal development of the lymphatic vessels during early embryogenesis. Somatic PIK3CA gene mutations are conventional cause leading to LMs. Both macrocystic and microcystic LMs arise due to lymphatic endothelial cell-autonomous defects, depending on the time in development at which PIK3CA gene mutation occurs. Recent study finds a PIK3CA mutation in 79% of LMs. However, discovering new genetic events in this disease is crucial to identify the molecular mechanism of the pathogenesis and further develop new targeted therapies. Results Here, we initially performed whole-exome sequencing in six children with LMs to find a new causal gene. Somatic mutations in PIK3CA (c.1633G > A [p. E545K] and PIK3CD (c.1997T > C [p.L666P]) were discovered in two different individuals. In vitro functional studies were conducted to demonstrate the pathogenicity of the novel mutation c.1997T > C in PIK3CD. We found that L666P promoted the cell proliferation and migration of human umbilical vein endothelial cells (HUVECs) and induced hyperactivation of the mTOR pathway. These findings indicate that the PIK3CD mutation affects downstream signalling in endothelial cells, which may impair normal lymphangiogenesis. Conclusions This study reveals a novel candidate gene associated with the development of LMs, which is consistent with previous researches. These findings in our study may offer a novel gene target for developing therapies, which acts in tight interaction with the previously known PIK3CA.

Abstract Background Hereditary retinopathy is a significant cause of blindness worldwide. Despite the discovery of many mutations in various retinopathies, a large number of patients remain genetically undiagnosed. Targeted next-generation sequencing of the human genome is a suitable approach for the molecular diagnosis of retinopathy. Methods We describe a cohort of 211 families from central China with various forms of retinopathy; 95 patients were investigated using multigene panel sequencing, and the other 116 with suspected Leber hereditary optic neuropathy (LHON) were tested by Sanger sequencing. The detected variation of targeted sequencing was verified by PCR-based Sanger sequencing. We performed a comprehensive analysis of the cases using sequencing data and ophthalmologic examination information. Results Potential causal mutations were identified in the majority of families with retinopathy (57.9% of 95 families) and suspected LHON (21.6% of 116 families). There were 68 variants of a certain significance distributed in 31 known disease-causing genes in the 95 families; 37 of the variants are novel and have not been reported to be related to hereditary retinopathy. The NGS panel solution provided a 45.3% potential diagnostic rate for retinopathy families, with candidate gene mutations of undefined pathogenicity revealed in another 12.6%of the families. Conclusion Our study uncovered novel mutations and phenotypic aspects of retinopathy and demonstrated the genetic and clinical heterogeneity of related conditions. The findings show the detection rate of pathogenic variants in patients with hereditary retinopathy in central China as well as the diversity and gene distribution of these variants. The significance of molecular genetic testing for patients with hereditary retinopathy is also highlighted.

Introduction: Spinocerebellar ataxia type 14 (SCA14) is a dominantly inherited neurological disorder characterized by slowly progressive cerebellar ataxia. SCA14 is caused by mutations in PRKCG, a gene encoding protein kinase C gamma (PKCγ), a master regulator of Purkinje cells development. Methods: We performed next-generation sequencing targeted resequencing panel encompassing 273 ataxia genes in 358 patients with genetically undiagnosed ataxia. Results: We identified fourteen patients in ten families harboring nine pathogenic heterozygous variants in PRKCG, seven of which were novel. We encountered four patients with not previously described phenotypes: one with episodic ataxia, one with a spastic paraparesis dominating her clinical manifestations, and two children with an unusually severe phenotype. Conclusions: Our study broadens the genetic and clinical spectrum of SCA14. [ABSTRACT FROM AUTHOR]

Abstract Background Fluoroquinolone agents, such as enrofloxacin and marbofloxacin, are commonly used for pseudomonal infection in veterinary medicine. However, the rate of resistance to fluoroquinolones is rapidly increasing, according to multiple studies in various countries. Point mutations in the quinolone resistance-determining region (QRDR) are closely related to the increased fluoroquinolone resistance of Pseudomonas aeruginosa. The aim of this study was to investigate current antimicrobial susceptibility and fluoroquinolone resistance in P. aeruginosa strains isolated from dogs. The presence of point mutations in the QRDR was confirmed by gyrA and parC polymerase chain reaction and nucleotide sequencing analysis. Results A total of 84 nonduplicated P. aeruginosa strains were obtained from 228 healthy dogs (healthy group) and 260 dogs with clinical signs (infected group). Among these isolates, 38 strains from the healthy group were detected in several sample types, whereas 46 strains from the infected group were obtained mostly from dogs’ ears with otitis externa (41/260, 15.8%). All strains were resistant to nalidixic acid, while some were also resistant to enrofloxacin (23/84, 27.4%), marbofloxacin (17/84, 20.2%), levofloxacin (12/84, 14.3%), or ciprofloxacin (11/84, 13.1%). Enrofloxacin resistance was significantly higher in strains from the infected group than in those from the healthy group (p

Introduction: Juvenile polyposis syndrome (JPS), a rare polyposis syndrome in childhood, is characterized by multiple diffuse hamartomatous polyps in the gastrointestinal tract (GI) with an estimated incidence of one in 50,000 to 100,000 live births. Although a juvenile polyp is a non-cancerous lesion, affected individuals have an increased risk of GI malignancy. JPS is a disease related to loss-of-function mutations in BMPR1A and SMAD4 involved in the biological maintenance of cellular growth. Pathogenic mutations in those genes have been identified in approximately 50–60% of JPS cases. Presentation: Our report describes two JPS cases with loss-of-function mutations of BMPR1A identified by a high-throughput nucleotide sequencing. Both cases had a similar clinical manifestation, symptomatic lower GI bleeding. Both patients underwent a total colectomy after histological confirmation. Consequently, Family members who had had genetic confirmation of these mutations were invited to be screened by enteroscopy. Conclusion: JPS is a hereditary disease caused by dominantly inherited loss-of-function of the BMPR1A and SMAD4 genes. Identifying loss-of-function mutations in particular genes allows early screening, diagnosis, and prevention of malignancy among the index cases and their families. High-throughput genome sequencing is a current molecular approach for improving the precision of mutation detection and minimizing time to diagnosis.

MEN1 is a rare syndrome caused by mutations in the MEN1 gene. We describe a clinical case of MEN1 syndrome associated with a recently discovered pathogenic mutation of MEN1 gene. A 32-year-old man with a history of osteopenia, nephrolithiasis, hypercalcemia and hypophosphatemia, impaired fasting glucose, and asthenia was admitted to our outpatient unit. Primary hyperparathyroidism, sustained by three hyperplastic parathyroid glands, was diagnosed. Prolactin- and GH-secreting adenomas were ruled out. After undergoing subtotal parathyroidectomy, the patient was diagnosed with non-functioning pituitary adenoma, three pancreatic lesions, and Cushing syndrome sustained by left adrenal adenoma. The patient underwent left adrenal surgery; somatostatin analogue lanreotide was started for the pancreatic lesions; the pituitary adenoma, being small and non-secreting, was not treated. A genetic test was performed to confirm the diagnosis of MEN1 syndrome, finding an association with a recently discovered mutation: the (NM&#95;130799.2):c.758delC (p.Ser253Cysfs * 28) in exon 4., Competing Interests: The authors declare that they have no conflict of interest regarding the publication of this article., (© The Author(s) 2024. Published by Oxford University Press.)

This study has investigated a total of 51 Acinetobacter baumannii isolates for the prevalence of resistant determinants in tigecycline susceptible and non-susceptible clinical isolates of A. baumannii. Antimicrobial susceptibility testing revealed 74% of isolates were tigecycline resistant. Mutations in RND-efflux pump regulatory genes and the expression of efflux pump genes were measured in tigecycline resistant isolates. There was a strong co-relation between the bla NDM-1 and armA wherein majority of the isolates that are positive for bla NDM-1 have also harbored armA. Compared with TSAB (tigecycline susceptible A. baumannii), TNAB (tigecycline non-susceptible A. baumannii) isolates show increased distribution of bla NDM-1 (P = 0.048), bla IMP-1 (P < 0.0001) and bla OXA-51 (P = 0.0029) carbapenemase genes. The variants of RND-efflux pump regulatory genes due to amino-acid mutations in adeS (F12S, K84E, W61R, N268H and Q299R) and adeL (G21R and Q262R) were identified in tigecycline resistant isolates as well as ISAba1 mediated disruption of adeN were observed causing overexpression of adeIJK efflux pump. Additionally, mutations in adeRS were also associated with increased expression of adeABC efflux pump. Besides, TNAB isolates showed significantly (P < 0.0001) higher ability of biofilm formation as compared to TSAB isolates. The tigecycline resistance due to mutations in contemporary A. baumannii isolates having a higher ability to form biofilm may pose therapeutic difficulties. [ABSTRACT FROM AUTHOR]