Search

Your search keyword '"mutational spectrum"' showing total 241 results

Search Constraints

Start Over You searched for: Descriptor "mutational spectrum" Remove constraint Descriptor: "mutational spectrum"
241 results on '"mutational spectrum"'

Search Results

1. Frequency and spectrum of mutations in human sperm measured using duplex sequencing correlate with trio-based de novo mutation analyses

2. Mutational spectrum in patients with dominant non-syndromic hearing loss in Austria.

3. Somatic mutation rates scale with time not growth rate in long-lived tropical trees

4. A lung-specific mutational signature enables inference of viral and bacterial respiratory niche.

5. Clinical features and mutational spectrum of Chinese patients with primary hyperoxaluria type 2.

6. Identification of Genetic Variants in Exon 4 of TP53 in Lung Carcinoma and in Silico Prediction of Their Significance.

7. Recurrent genetic variants and prioritization of variants of uncertain clinical significance associated with hereditary breast and ovarian cancer in families from the Region of Murcia

9. Leigh Syndrome Spectrum: A Portuguese Population Cohort in an Evolutionary Genetic Era.

10. T Residues Preceded by Runs of G Are Hotspots of T→G Mutation in Bacteria.

11. Evolution of the SARS-CoV-2 Mutational Spectrum.

12. Screening and mutation analysis of phenylalanine hydroxylase deficiency in newborns from Jiangxi province.

13. The mutational spectrum of SARS-CoV-2 genomic and antigenomic RNA.

14. Somatic mutation rates scale with time not growth rate in long-lived tropical trees.

15. Mutation Analysis of F11 Gene in Patients with FXI Deficiency in Russia.

16. Patterns of within-host genetic diversity in SARS-CoV-2

17. Clinical and Genetic Characteristics of 153 Chinese Patients With X-Linked Hypophosphatemia

18. Application of duplex sequencing to evaluate mutagenicity of aristolochic acid and methapyrilene in Fisher 344 rats.

19. The effect of age on the acquisition and selection of cancer driver mutations in sun-exposed normal skin.

20. Case Report: Pediatric Recurrent Acute Liver Failure Caused by Neuroblastoma Amplified Sequence (NBAS) Gene Mutations

21. Spectrum of PAH gene mutations and genotype-phenotype correlation in patients with phenylalanine hydroxylase deficiency from Shanxi province.

22. Environmental and genetic influence on the rate and spectrum of spontaneous mutations in Escherichia coli .

23. Bedrock radioactivity influences the rate and spectrum of mutation

24. Addition of triple negativity of breast cancer as an indicator for germline mutations in predisposing genes increases sensitivity of clinical selection criteria

25. Temperature responses of mutation rate and mutational spectrum in an Escherichia coli strain and the correlation with metabolic rate

26. Clinical spectrum and genetic landscape for hereditary spastic paraplegias in China

27. Clinical and Biological Implications of Mutational Spectrum in Acute Myeloid Leukemia of FAB Subtypes M0 and M1

28. CFTR gene variants, epidemiology and molecular pathology.

29. SERPING1 mutation update: Mutation spectrum and C1 Inhibitor phenotypes.

31. Whole-Exome Sequencing of Syndromic Adrenocortical Carcinoma Reveals Distinct Mutational Profile From Sporadic ACC.

32. Whole-genome high-fidelity sequencing: A novel approach to detecting and characterization of mutagenicity in vivo.

33. Espectro de variantes do gene NF1 em Portugal e implementação de uma abordagem baseada em RNA

34. Succinic Semialdehyde Dehydrogenase Deficiency: In Vitro and In Silico Characterization of a Novel Pathogenic Missense Variant and Analysis of the Mutational Spectrum of ALDH5A1

35. Molecular analysis of cystic fibrosis patients in Hungary: An update to the mutational spectrum

36. A putative antiviral role of plant cytidine deaminases [version 2; referees: 2 approved]

37. A putative antiviral role of plant cytidine deaminases [version 1; referees: 2 approved]

38. Addition of triple negativity of breast cancer as an indicator for germline mutations in predisposing genes increases sensitivity of clinical selection criteria.

39. Clinical and Biological Implications of Mutational Spectrum in Acute Myeloid Leukemia of FAB Subtypes M0 and M1.

40. Genetic mutations in non-syndromic deafness patients in Hainan Province have a different mutational spectrum compared to patients from Mainland China.

41. Mutational spectrum of the phenylalanine hydroxylase gene in patients with phenylketonuria in the central region of China.

42. Biological Evaluation of DNA Biomarkers in a Chemically Defined and Site-Specific Manner

43. Understanding the Impact of Aberrant Splicing in Coagulation Factor V Deficiency

46. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 -20 bp), and c.315+2T>G ( IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

47. Spectrum of genetic variants of BRCA1 and BRCA2 in a German single center study.

48. Favipiravir can evoke lethal mutagenesis and extinction of foot-and-mouth disease virus.

49. 3-Methylcrotonyl-CoA carboxylase deficiency: Mutational spectrum derived from comprehensive newborn screening.

Catalog

Books, media, physical & digital resources