Search

The Ironwood tree (Casuarina equisetifolia) holds a significant ecological role in Guam where a decline in Ironwood trees was first documented in 2002. Studies have linked the Ironwood tree decline (IWTD) to bacteria from the Ralstonia solanacearum complex and wetwood bacteria, specifically Klebsiella oxytoca and Klebsiella variicola. Presence of termites was first found to be associated with IWTD in 2010; however, the role of termites in IWTD is still not clear. The Asian subterranean termite, Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae) frequently attacks Ironwood trees. As workers of this soil-dwelling species of the lower termites harbor a diverse microbial community in their bodies, we examined whether C. gestroi workers carry IWTD-associated bacteria and could, therefore, act as vectors. We described the bacterial community in C. gestroi workers using 16S rRNA gene sequencing and tested the impact of factors related to the location and health of the Ironwood tree the termites were collected from on termite bacterial diversity. Feeding assays were performed to assess if workers show preference in consumption depending on the amount of Ralstonia and wetwood bacteria in the food source. Health of Ironwood trees and level of site management impacted the bacterial composition of C. gestroi termite workers attacking the trees. Although C. gestroi workers equally consumed food sources with high and low Ralstonia and wetwood bacteria load in lab experiments, Ralstonia and other IWTD-related bacteria were not detected in considerable amounts in termite workers collected from trees. Thus, C. gestroi workers are not a vector for bacteria associated with IWTD in Guam. [ABSTRACT FROM AUTHOR]

Understanding the environmental drivers of microbial H 2 metabolisms is crucial for evaluating the risks for geological hydrogen storage. This study investigates how mineralogy and temperature affect H 2 consumption kinetics and metabolic activity of a microbial consortium containing methanogens, homoacetogens and sulfate reducers, incubated at 25, 34 and 40 °C under H 2 /CO 2 (80/20, v/v; 2 bars) with different rock powders (basalt, calcite, gypsum, and sandstone). The presence of gypsum favors sulfate reduction over methanogenesis and homoacetogenesis, especially at 25 °C. Methanogenesis is dominant at 34 and 40 °C with all sulfate-free mineralogies. At 25 °C, homoacetogenic bacteria are favored over methanogens and acetate production varies with the mineralogy. This suggests interactions of the microbial community with the rock powders, which may serve as a surface to form biofilms. These metabolic shifts are associated with radical changes in microbial populations, highlighting that ecosystems plasticity towards H 2 also depends on the mineralogical composition of the reservoir. • Both temperature and mineralogy affect H 2 consumption kinetics. • Gypsum powder favors sulfate reduction over methanogenesis and homoacetogenesis. • Low temperature favors homoacetogenesis over methanogenesis. • Proportions of methanogenesis and homoacetogenesis vary with the substrate mineralogy. • Metabolic shifts are associated with radical changes in microbial populations. [ABSTRACT FROM AUTHOR]

The Ironwood tree (Casuarina equisetifolia) holds a significant ecological role in Guam where a decline in Ironwood trees was first documented in 2002. Studies have linked the Ironwood tree decline (IWTD) to bacteria from the Ralstonia solanacearum complex and wetwood bacteria, specifically Klebsiella oxytoca and Klebsiella variicola. Presence of termites was first found to be associated with IWTD in 2010; however, the role of termites in IWTD is still not clear. The Asian subterranean termite, Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae) frequently attacks Ironwood trees. As workers of this soil-dwelling species of the lower termites harbor a diverse microbial community in their bodies, we examined whether C. gestroi workers carry IWTD-associated bacteria and could, therefore, act as vectors. We described the bacterial community in C. gestroi workers using 16S rRNA gene sequencing and tested the impact of factors related to the location and health of the Ironwood tree the termites were collected from on termite bacterial diversity. Feeding assays were performed to assess if workers show preference in consumption depending on the amount of Ralstonia and wetwood bacteria in the food source. Health of Ironwood trees and level of site management impacted the bacterial composition of C. gestroi termite workers attacking the trees. Although C. gestroi workers equally consumed food sources with high and low Ralstonia and wetwood bacteria load in lab experiments, Ralstonia and other IWTD-related bacteria were not detected in considerable amounts in termite workers collected from trees. Thus, C. gestroi workers are not a vector for bacteria associated with IWTD in Guam.

This study addresses the challenge of optimizing powdered water kefir's fermentation and preservation processes to enhance its physical-chemical, microbiological, and technological characteristics. The main objective was to determine the best fermentation conditions and evaluate the efficacy of different drying methods. The optimal fermentation conditions were 5 % kefir grains, 10 % brown sugar, and an incubation temperature of 25 °C. Remarkably, the microbiological analysis revealed high abundances of Zymomonas mobilis (grains: 94.31 % and beverage: 91.68 %), Sporolactobacillus spathodeae (grains: 3.00 % and beverage: 5.42 %), and Liquorilactobacillus satsumensis (grains: 1.47 % and beverage: 0.62 %) among bacteria, and Lachancea fermentati (grains: 95.54 % and beverage: 67.53 %), Wickerhamomyces anomalus (grains: 3.00 % and beverage: 26.77 %) among fungi. The study innovatively demonstrates that lyophilization preserves the viability of these microorganisms, making it a promising method for producing stable, probiotic-rich powdered kefir. Although spray drying resulted in a logarithmic reduction of 3 logs CFU/g, it maintained sufficient microorganism counts, proving its viability as an alternative drying method. These methods retain the ideal physical-chemical properties and expand the accessibility and practical applications of water kefir. This research underscores the potential for powdered water kefir to deliver health benefits conveniently and versatilely, paving the way for broader industrial and academic applications.

Abstract Background Pinus koraiensis cone essential oil (PEO) contains functional compounds such as monoterpene hydrocarbons, and the administration of PEO reduced methane (CH4) emissions during growing phase of goats. However, the mode of action of PEO driven CH4 reduction is not known, especially how the administration of PEO can affect rumen microbiota and host metabolism in goats during the fattening phase. This study aimed to elucidate the potential microbial and host responses PEO supplementation in goats using metataxonomics (prokaryotes and protozoa) and metabolomics (rumen fluid and serum). Results Ten fattening Korean native goats were divided into two dietary groups: control (CON; basal diet without additives) and PEO (basal diet + 1.5 g/d of PEO) with a 2 × 2 crossover design and the treatment lasted for 11 weeks. Administration of PEO reduced CH4 concentrations in the exhaled gas from eructation by 12.0–13.6% (P

Background: Pinus koraiensis cone essential oil (PEO) contains functional compounds such as monoterpene hydrocarbons, and the administration of PEO reduced methane (CH4) emissions during growing phase of goats. However, the mode of action of PEO driven CH4 reduction is not known, especially how the administration of PEO can affect rumen microbiota and host metabolism in goats during the fattening phase. This study aimed to elucidate the potential microbial and host responses PEO supplementation in goats using metataxonomics (prokaryotes and protozoa) and metabolomics (rumen fluid and serum). Results: Ten fattening Korean native goats were divided into two dietary groups: control (CON; basal diet without additives) and PEO (basal diet + 1.5 g/d of PEO) with a 2 × 2 crossover design and the treatment lasted for 11 weeks. Administration of PEO reduced CH4 concentrations in the exhaled gas from eructation by 12.0–13.6% (P < 0.05). Although the microbial composition of prokaryotes (bacteria and archaea) and protozoa in the rumen was not altered after PEO administration. MaAsLin2 analysis revealed that the abundance of Selenomonas, Christensenellaceae R-7 group, and Anaerovibrio were enriched in the rumen of PEO supplemented goats (Q < 0.1). Co-occurrence network analysis revealed that Lachnospiraceae AC2044 group and Anaerovibrio were the keystone taxa in the CON and PEO groups, respectively. Methane metabolism (P < 0.05) was enriched in the CON group, whereas metabolism of sulfur (P < 0.001) and propionate (P < 0.1) were enriched in the PEO group based on microbial predicted functions. After PEO administration, the abundance of 11 rumen and 4 serum metabolites increased, whereas that of 25 rumen and 14 serum metabolites decreased (P < 0.1). Random forest analysis identified eight ruminal metabolites that were altered after PEO administration, among which four were associated with propionate production, with predictive accuracy ranging from 0.75 to 0.88. Additionally, we found that serum sarcosine (serum metabolite) was positively correlated with CH4 emission parameters and abundance of Methanobrevibacter in the rumen (|r|≥ 0.5, P < 0.05). Conclusions: This study revealed that PEO administration reduced CH4 emission from of fattening goats with altered microbial interactions and metabolites in the rumen and host. Importantly, PEO administration affected utilizes various mechanisms such as formate, sulfur, methylated amines metabolism, and propionate production, collectively leading to CH4 reduction. The knowledge is important for future management strategies to maintain animal production and health while mitigate CH4 emission. [ABSTRACT FROM AUTHOR]

Abstract Background and aims The gut microbiota is implicated in the pathogenesis of colorectal cancer (CRC). We aimed to map the CRC mucosal microbiota and metabolome and define the influence of the tumoral microbiota on oncological outcomes. Methods A multicentre, prospective observational study was conducted of CRC patients undergoing primary surgical resection in the UK (n = 74) and Czech Republic (n = 61). Analysis was performed using metataxonomics, ultra-performance liquid chromatography-mass spectrometry (UPLC-MS), targeted bacterial qPCR and tumour exome sequencing. Hierarchical clustering accounting for clinical and oncological covariates was performed to identify clusters of bacteria and metabolites linked to CRC. Cox proportional hazards regression was used to ascertain clusters associated with disease-free survival over median follow-up of 50 months. Results Thirteen mucosal microbiota clusters were identified, of which five were significantly different between tumour and paired normal mucosa. Cluster 7, containing the pathobionts Fusobacterium nucleatum and Granulicatella adiacens, was strongly associated with CRC (P FDR = 0.0002). Additionally, tumoral dominance of cluster 7 independently predicted favourable disease-free survival (adjusted p = 0.031). Cluster 1, containing Faecalibacterium prausnitzii and Ruminococcus gnavus, was negatively associated with cancer (P FDR = 0.0009), and abundance was independently predictive of worse disease-free survival (adjusted p = 0.0009). UPLC-MS analysis revealed two major metabolic (Met) clusters. Met 1, composed of medium chain (MCFA), long-chain (LCFA) and very long-chain (VLCFA) fatty acid species, ceramides and lysophospholipids, was negatively associated with CRC (P FDR = 2.61 × 10−11); Met 2, composed of phosphatidylcholine species, nucleosides and amino acids, was strongly associated with CRC (P FDR = 1.30 × 10−12), but metabolite clusters were not associated with disease-free survival (p = 0.358). An association was identified between Met 1 and DNA mismatch-repair deficiency (p = 0.005). FBXW7 mutations were only found in cancers predominant in microbiota cluster 7. Conclusions Networks of pathobionts in the tumour mucosal niche are associated with tumour mutation and metabolic subtypes and predict favourable outcome following CRC resection. Video Abstract

ABSTRACTBackground A growing body of evidence demonstrates a different bacterial composition in the oral cavity of patients with oral lichen planus (OLP).Patients and methods Buccal swab samples were collected from affected and non-affected sites of six patients with reticular OLP and the healthy oral mucosa of six control subjects. 16S rRNA gene MiSeq sequencing and mass spectrometry-based proteomics were utilised to identify the metataxonomic and metaproteomic profiles of the oral microbiome in both groups.Results From the metataxonomic analysis, the most abundant species in the three subgroups were Streptococcus oralis and Pseudomonas aeruginosa, accounting for up to 70% of the total population. Principal Coordinates Analysis showed differential clustering of samples from the healthy and OLP groups. ANCOM-BC compositional analysis revealed multiple species (including P. aeruginosa and several species of Veillonella, Prevotella, Streptococcus and Neisseria) significantly over-represented in the control group and several (including Granulicatella elegans, Gemella haemolysans and G. parahaemolysans) in patients with OLP. The metaproteomic data were generally congruent and revealed that several Gemella haemolysans-belonging peptidases and other proteins with inflammatory and virulence potential were present in OLP lesions.Conclusion Our data suggest that several bacterial species are associated with OLP. Future studies with larger cohorts should be conducted to determine their role in the aetiology of OLP and evaluate their potential as disease biomarkers.

The Lactobacillaceae are lactic acid bacteria harnessed to deliver important outcomes across numerous industries, and their unambiguous, species-level identification from mixed community environments is an important endeavor. Amplicon-based metataxonomics using short-read sequencing of partial 16S rRNA gene regions is widely used to support this, however, the high genetic similarity among Lactobacillaceae species restricts our ability to confidently describe these communities even at genus level. Long-read sequencing (LRS) of the whole 16S rRNA gene or the near complete rRNA operon (16S-ITS-23S) has the potential to improve this. We explored species ambiguity amongst Lactobacillaceae using in-silico tool RibDif2, which identified allele overlap when various partial and complete 16S rRNA gene and 16S-ITS-23S rRNA regions were amplified. We subsequently implemented LRS by MinION™ to compare the capacity of V3–V4, 16S and 16S-ITS-23S rRNA amplicons to accurately describe the diversity of a 20-species Lactobacillaceae mock community in practice. In-silico analysis identified more instances of allele/species overlap with V3–V4 amplicons (n = 43) compared to the 16S rRNA gene (n = 11) and partial (n = up to 15) or complete (n = 0) 16S-ITS-23S rRNA amplicons. With subsequent LRS of a DNA mock community, 80% of target species were identified using V3–V4 amplicons whilst the 16S rRNA gene and 16S-ITS-23S rRNA region amplicons resulted in 95 and 100% of target species being identified. A considerable reduction in false-positive identifications was also seen with 16S rRNA gene (n = 3) and 16S-ITS-23S rRNA region (n = 9) amplicons compared with V3–V4 amplicons (n = 43). Whilst the target species affected by allele overlap in V3–V4 and 16S rRNA gene sequenced mock communities were predicted by RibDif2, unpredicted species ambiguity was observed in 16S-ITS-23S rRNA sequenced communities. Considering the average nucleotide identity (ANI) between ambiguous species (~97%) and the basecall accuracy of our MinION™ sequencing protocol (96.4%), the misassignment of reads between closely related taxa is to be expected. With basecall accuracy exceeding 99% for recent MinION™ releases, the increased species-level differentiating power promised by longer amplicons like the 16S-ITS-23S rRNA region, may soon be fully realized.

Intestinal parasites continue to pose a significant threat to human health worldwide, particularly among children. Contaminated water and soil serve as major transmission vehicles for these parasites and intestinal protists are among the most prevalent parasites in both developed and developing nations. Traditionally, parasites have been studied using human or animal fecal samples, while studying them in environmental samples has been challenging due to technical limitations. However, advancements in Next-Generation Sequencing (NGS) and bioinformatic approaches now enable the detection of parasite DNA in environmental samples. In this study, we applied a metataxonomic and phylogenetic strategy to detect and classify DNA of protists present in sewage sludge from two major cities in Colombia: Medellin and Cali. We successfully detected several human pathogenic parasites including Giardia intestinalis, Entamoeba histolytica, and Blastocystis sp., among other protists, in all sludge samples examined. We also investigated the entry and exit of parasite DNA from the San Fernando wastewater treatment plant (WWTP). We observed a higher number of parasite DNA sequences in the plant's influent wastewater, but we also detected the discharge of DNA from pathogenic parasites in both effluent waters and biosolids.

ABSTRACTAge-related gut microbes and urine metabolites were investigated in 568 healthy individuals using metataxonomics and metabolomics. The richness and evenness of the fecal microbiota significantly increased with age, and the abundance of 16 genera differed between the young and old groups. Additionally, 17 urine metabolites contributed to the differences between the young and old groups. Among the microbes that differed by age, Bacteroides and Prevotella 9 were confirmed to be correlated with some urine metabolites. The machine learning algorithm eXtreme gradient boosting (XGBoost) was shown to produce the best performing age predictors, with a mean absolute error of 5.48 years. The accuracy of the model improved to 4.93 years with the inclusion of urine metabolite data. This study shows that the gut microbiota and urine metabolic profiles can be used to predict the age of healthy individuals with relatively good accuracy.

Kombucha is a fermented tea with a combination of yeast and bacteria. Kombucha teas may have a variable microbiota based on geographic origin and cultural conditions. The microbial flora of kombucha has been studied with culture-dependent methods. But, the improvement of the metataxonomic approach has broadened our perspective on fermented foods. In this study, a kombucha mother was procured from an artisanal supplier in Türkiye. High-throughput new-generation sequencing (16S rRNA and Internal Transcribed Spacer (ITS)) was carried out to investigate the microbial communities of kombucha after 7 days of fermentation in both liquid tea (L) and pellicle (P). Microbial counts, pH (4.42 ± 0.01 and 3.50 ± 0.02), and TA% (0.26 ± 0.02 and 0.60 ± 0.04) were also detected on the first and 7th days of fermentation. According to metataxonomic results, the dominant bacteria were Komagataeibacter obediens (%21.13), an acetic acid-producing bacteria, and the dominant fungal genus was Pichia kudriavzevii (64.35%) in L while Romboutsia sp. CE17 was the dominant bacteria (7%) and Pichia kudriavzevii was also the dominant yeast in P. This study also revealed different species which were not common in kombucha including propionic acid and butyric acid-producing bacteria such as Anaerotignum propionicum and Butyrivibrio fibrisolvens, a butyrivibriocin producing bacteria. Accordingly, different yeast species were detected such as Tetrapisispora phaffii and Ogataea polimorpha. [ABSTRACT FROM AUTHOR]

Background: Menstrual cups (MCs) are increasingly used to collect cervicovaginal secretions to characterise vaginal mucosal immunology, in conjunction with high vaginal swabs (HVS) for metataxonomics, particularly in HIV transmission studies. We hypothesised that both methods of collecting bacterial biomass are equivalent for 16S rRNA gene sequencing. Material and Methods: Cervicovaginal fluid (CVF) samples from 16 pregnant women with HIV-1 (PWWH) were included to represent the major vaginal bacterial community state types (CST I-V). Women underwent sampling during the second trimester by liquid amies HVS followed by a MC (Soft disc™) and samples were stored at -80°C. Bacterial cell pellets obtained from swab elution and MC (500 µL, 1 in 10 dilution) were resuspended in 120 µL PBS for DNA extraction. Bacterial 16S rRNA gene sequencing was performed using V1-V2 primers and were analysed using MOTHUR. Paired total DNA, bacterial load, amplicon read counts, diversity matrices and bacterial taxa were compared by sampling method using MicrobiomeAnalyst, SPSS and R. Results: The total DNA eluted from one aliquot of diluted CVF from an MC was similar to that of a HVS (993ng and 609ng, p=0.18); the mean bacterial loads were also comparable for both methods (MC: 8.0 log10 16S rRNA gene copies versus HVS: 7.9 log10 16S rRNA gene copies, p=0.27). The mean number of sequence reads generated from MC samples was lower than from HVS (MC: 12730; HVS:14830, p=0.05). The a-diversity metrices were similar for both techniques; MC Species Observed: 41 (range 12-96) versus HVS: 47 (range 16-96), p=0.15; MC Inverse Simpson Index: 1.98 (range 1.0-4.0) versus HVS: 0.48 (range 1.0-4.4), p=0.22). The three most abundant species observed were: Lactobacillus iners, Lactobacillus crispatus and Gardnerella vaginalis. Hierarchical clustering of relative abundance data showed that samples obtained using different techniques in an individual clustered in the same CST group. Conclusion: These data demonstrate that despite sampling slightly different areas of the lower genital tract, there was no difference in bacterial load or composition between methods. Both are suitable for characterisation of vaginal microbiota in PWWH. The MC offers advantages, including a higher volume of sample available for DNA extraction and complimentary assays. [ABSTRACT FROM AUTHOR]

Background and aims: The gut microbiota is implicated in the pathogenesis of colorectal cancer (CRC). We aimed to map the CRC mucosal microbiota and metabolome and define the influence of the tumoral microbiota on oncological outcomes. Methods: A multicentre, prospective observational study was conducted of CRC patients undergoing primary surgical resection in the UK (n = 74) and Czech Republic (n = 61). Analysis was performed using metataxonomics, ultra-performance liquid chromatography-mass spectrometry (UPLC-MS), targeted bacterial qPCR and tumour exome sequencing. Hierarchical clustering accounting for clinical and oncological covariates was performed to identify clusters of bacteria and metabolites linked to CRC. Cox proportional hazards regression was used to ascertain clusters associated with disease-free survival over median follow-up of 50 months. Results: Thirteen mucosal microbiota clusters were identified, of which five were significantly different between tumour and paired normal mucosa. Cluster 7, containing the pathobionts Fusobacterium nucleatum and Granulicatella adiacens, was strongly associated with CRC (PFDR = 0.0002). Additionally, tumoral dominance of cluster 7 independently predicted favourable disease-free survival (adjusted p = 0.031). Cluster 1, containing Faecalibacterium prausnitzii and Ruminococcus gnavus, was negatively associated with cancer (PFDR = 0.0009), and abundance was independently predictive of worse disease-free survival (adjusted p = 0.0009). UPLC-MS analysis revealed two major metabolic (Met) clusters. Met 1, composed of medium chain (MCFA), long-chain (LCFA) and very long-chain (VLCFA) fatty acid species, ceramides and lysophospholipids, was negatively associated with CRC (PFDR = 2.61 × 10−11); Met 2, composed of phosphatidylcholine species, nucleosides and amino acids, was strongly associated with CRC (PFDR = 1.30 × 10−12), but metabolite clusters were not associated with disease-free survival (p = 0.358). An association was identified between Met 1 and DNA mismatch-repair deficiency (p = 0.005). FBXW7 mutations were only found in cancers predominant in microbiota cluster 7. Conclusions: Networks of pathobionts in the tumour mucosal niche are associated with tumour mutation and metabolic subtypes and predict favourable outcome following CRC resection. E9vQ1bxk-JdT4E6GMYGhRX Video Abstract [ABSTRACT FROM AUTHOR]

Metatranscriptomics is a promising technique for the characterization of active members of microbial populations and their functions. Only a subset of the functional potential of the gut microbiota is expressed and many functions are transcribed only by few organisms when broadly present, but corresponding information for many other habitats is lacking. Transcriptional activity may predict bacterial growth and death; undertranscription relative to the DNA abundance indicates loss of the taxa, while overtranscription precedes future growth. Metatranscriptomics has revealed medically relevant expression signatures as exemplified by signatures associated with preterm labor and risk for developing asthma. Metatranscriptomics has in proof-of-concept studies provided a higher diagnostic yield than metagenomics for detecting infectious diseases, but results should be validated. Metatranscriptomics has revolutionized our ability to explore and understand transcriptional programs in microbial communities. Moreover, it has enabled us to gain deeper and more specific insight into the microbial activities in human gut, respiratory, oral, and vaginal communities. Perhaps the most important contribution of metatranscriptomics arises, however, from the analyses of disease-associated communities. We review the advantages and disadvantages of metatranscriptomics analyses in understanding human health and disease. We focus on human tissues low in microbial biomass and conditions associated with dysbiotic microbiota. We conclude that a more widespread use of metatranscriptomics and increased knowledge on microbe activities will uncover critical interactions between microbes and host in human health and provide diagnostic basis for culturing-independent, direct functional pathogen identification. [ABSTRACT FROM AUTHOR]

ABSTRACT The lacustrine systems of La Brava and La Punta, located in the Tilopozo sector in the extreme south of Salar de Atacama, are pristine high-altitude Andean lakes found along the central Andes of South America. This shallow ecosystem suffers from permanent evaporation, leading to falling water levels, causing it to recede or disappear during the dry season. This dynamic causes physicochemical changes in lakes, such as low nutrient availability, pH change, and dissolved metals, which can influence the composition of the microbial community. In this study, we used a metataxonomic approach (16S rRNA hypervariable regions V3 to V4) to characterize the sedimentary microbiota of these lakes. To understand how the water column affects and is structured in the microbiota of these lakes, we combined the analysis of the persistence of the water column through satellite images and physicochemical characterization. Our results show a significant difference in abiotic factors and microbiota composition between La Punta and La Brava lakes. In addition, microbiota analysis revealed compositional changes in the ecological disaggregation (main and isolated bodies) and antagonistic changes in the abundance of certain taxa between lakes. These findings are an invaluable resource for understanding the microbiological diversity of high Andean lakes using a multidisciplinary approach that evaluates the microbiota behavior in response to abiotic factors. IMPORTANCE In this study, we analyzed the persistence of the water column through satellite images and physicochemical characterization to investigate the composition and diversity in High Andean Lake Systems in a hyperarid environment. In addition to the persistence of the water column, this approach can be used to analyze changes in the morphology of saline accumulations and persistence of snow or ice; for example, for establishing variable plant cover over time and evaluating the microbiota associated with soils with seasonal changes in plants. This makes it an ideal approach to search for novel extremophilic microorganisms with unique properties. In our case, it was used to study microorganisms capable of resisting desiccation and water restriction for a considerable period and adapting to survive in ecological niches, such as those with high UV irradiation, extreme drought, and high salt concentration.

ABSTRACT Rarely has the vast diversity of bacteria on Earth been profiled, particularly on inaccessible plateaus. These uncultured microbes, which are also known as “microbial dark matter,” may play crucial roles in maintaining the ecosystem and are linked to human health, regarding pathogenicity and prebioticity. The plateau pika (Ochotona curzoniae) is a small burrowing steppe lagomorph that is endemic to the Qinghai-Tibetan Plateau and is a keystone species in the maintenance of ecological balance. We used a combination of full-length 16S rRNA amplicon sequencing, shotgun metagenomics, and metabolomics to elucidate the species-level community structure and the metabolic potential of the gut microbiota of the plateau pika. Using a full-length 16S rRNA metataxonomic approach, we clustered 618 (166 ± 35 per sample) operational phylogenetic units (OPUs) from 105 plateau pika samples and assigned them to 215 known species, 226 potentially new species, and 177 higher hierarchical taxa. Notably, 39 abundant OPUs (over 60% total relative abundance) are found in over 90% of the samples, thereby representing a “core microbiota.” They are all classified as novel microbial lineages, from the class to the species level. Using metagenomic reads, we independently assembled and binned 109 high-quality, species-level genome bins (SGBs). Then, a precise taxonomic assignment was performed to clarify the phylogenetic consistency of the SGBs and the 16S rRNA amplicons. Thus, the majority of the core microbes possess their genomes. SGBs belonging to the genus Treponema, the families Muribaculaceae, Lachnospiraceae, and Oscillospiraceae, and the order Eubacteriales are abundant in the metagenomic samples. In addition, multiple CAZymes are detected in these SGBs, indicating their efficient utilization of plant biomass. As the most widely connected metabolite with the core microbiota, tryptophan may relate to host environmental adaptation. Our investigation allows for a greater comprehension of the composition and functional capacity of the gut microbiota of the plateau pika. IMPORTANCE The great majority of microbial species remain uncultured, severely limiting their taxonomic characterization and biological understanding. The plateau pika (Ochotona curzoniae) is a small burrowing steppe lagomorph that is endemic to the Qinghai-Tibetan Plateau and is considered to be the keystone species in the maintenance of ecological stability. We comprehensively investigated the gut microbiota of the plateau pika via a multiomics endeavor. Combining full-length 16S rRNA metataxonomics, shotgun metagenomics, and metabolomics, we elucidated the species-level taxonomic assignment of the core uncultured intestinal microbiota of the plateau pika and revealed their correlation to host nutritional metabolism and adaptation. Our findings provide insights into the microbial diversity and biological significance of alpine animals.

BackgroundMenstrual cups (MCs) are increasingly used to collect cervicovaginal secretions to characterise vaginal mucosal immunology, in conjunction with high vaginal swabs (HVS) for metataxonomics, particularly in HIV transmission studies. We hypothesised that both methods of collecting bacterial biomass are equivalent for 16S rRNA gene sequencing.Material and MethodsCervicovaginal fluid (CVF) samples from 16 pregnant women with HIV-1 (PWWH) were included to represent the major vaginal bacterial community state types (CST I-V). Women underwent sampling during the second trimester by liquid amies HVS followed by a MC (Soft disc™) and samples were stored at -80°C. Bacterial cell pellets obtained from swab elution and MC (500 µL, 1 in 10 dilution) were resuspended in 120 µL PBS for DNA extraction. Bacterial 16S rRNA gene sequencing was performed using V1-V2 primers and were analysed using MOTHUR. Paired total DNA, bacterial load, amplicon read counts, diversity matrices and bacterial taxa were compared by sampling method using MicrobiomeAnalyst, SPSS and R.ResultsThe total DNA eluted from one aliquot of diluted CVF from an MC was similar to that of a HVS (993ng and 609ng, p=0.18); the mean bacterial loads were also comparable for both methods (MC: 8.0 log10 16S rRNA gene copies versus HVS: 7.9 log10 16S rRNA gene copies, p=0.27). The mean number of sequence reads generated from MC samples was lower than from HVS (MC: 12730; HVS:14830, p=0.05). The α-diversity metrices were similar for both techniques; MC Species Observed: 41 (range 12-96) versus HVS: 47 (range 16-96), p=0.15; MC Inverse Simpson Index: 1.98 (range 1.0-4.0) versus HVS: 0.48 (range 1.0-4.4), p=0.22). The three most abundant species observed were: Lactobacillus iners, Lactobacillus crispatus and Gardnerella vaginalis. Hierarchical clustering of relative abundance data showed that samples obtained using different techniques in an individual clustered in the same CST group.ConclusionThese data demonstrate that despite sampling slightly different areas of the lower genital tract, there was no difference in bacterial load or composition between methods. Both are suitable for characterisation of vaginal microbiota in PWWH. The MC offers advantages, including a higher volume of sample available for DNA extraction and complimentary assays.

Dry fermented sausage innovation trends are linked to consumer preferences for clean label and sodium-reduced foods. This study aims to evaluate the effect of the formulation and production process temperature on the dynamics of bacterial communities in fuet-type dry fermented sausages using metataxonomics. Six fuet batches were manufactured, including formulations without and with the addition of nitrifying salts (replaced or not by pork liver auto-hydrolysate as a colouring agent), processed at 3 to 12 °C, and a partial replacement of NaCl by KCl, processed at 12 °C. Fermentation was performed spontaneously or by a starter culture. Physicochemical characterisation and culture-dependent and independent bacterial analyses were performed at day 0, 4 and 12, at the end of ripening (aw < 0.90) and after storage. Temperature was the most important factor determining the change in pH, aw and lactic acid bacteria levels while the presence of a starter culture promoted a pH decrease. Metataxonomic analysis showed that low temperature processes and the absence of nitrifying salts allowed the growth of spoilage-related species, while sausages submitted to a mild temperature containing a starter culture and nitrifying salts showed less bacterial diversity. Liver auto-hydrolysate added putative probiotic species to the product. This study provides valuable information to manufacturers who want to innovate safely. [ABSTRACT FROM AUTHOR]

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

This research investigated the application of in-situ biological hydrogen methanation within a continuous stirred tank reactor (CSTR) system under mesophilic conditions, with sewage sludge used as the substrate. Two CSTRs with an effective capacity of 5 L were installed and loaded with inoculum sludge with a volatile solid (VS) concentration of 1.2–1.5 %. They were fed mixed waste sludge with an organic loading rate (OLR) of 1.5 g VS/L and an average sludge retention time (SRT) of 19 days under mesophilic conditions at 37 °C. One of the reactors operated as a control, while the other was injected with H 2 through a microceramic membrane diffuser with a H 2 :CO 2 ratio of 4:1. The results of this study revealed that the addition of H 2 and the recirculation of residual hydrogen in biogas led to a substantial increase in the production of methane from 157 L/kg VS to 275 L/kg VS. Increasing the methane content in biogas from 52 % to 78 % yielded an impressive 42.8 % higher methane production rate. Metataxonomic analysis of the microbial community via high-throughput sequencing techniques revealed that the dominant acetoclastic and hydrogenotrophic methanogens were Methanosaeta and Methanoregula , respectively, with greater abundances of both groups in the experimental bioreactor. The dynamics of their activity in both bioreactors were analyzed via qPCR, and the functional genes encoding methyl-coenzyme M reductase (mcrA gene) and hydrogenase Ni-Fe presented comparable changes between RI and RII. By optimizing key operational parameters and closely examining the dynamics of the microbial community, this approach can contribute significantly to sustainable bioenergy solutions while minimizing environmental impact. [Display omitted] • Study on in-situ hydrogen methanation in mesophilic CSTRs using sewage sludge as a substrate. • Methane yield increased by 75 %,from 157 to 275 L/kgVS, with CH 4 content rising from 52 % to 78 %. • H₂ addition and recirculation increased methane production by 42.8 %. • Methanosaeta and Methanoregula were dominant methanogens, linked to higher methane output. [ABSTRACT FROM AUTHOR]

Gills and gut are the two primary osmoregulatory organs in fish. Recently, studies have expanded beyond the osmoregulatory mechanisms of these organs to explore the microbiota communities inhabiting them. It is now known that microbial communities in both organs shift in response to osmotic stress. However, there are limited studies identifying the major contributors and co-occurrence among these microbiota in both organs under seawater and freshwater transfer conditions. The current data mining report performed a bioinformatics analysis on two previous published datasets from our group, aiming to provide insights into host-bacteria relationships under osmotic stress. We divided the samples into four groups: control seawater gills (LSW); control seawater gut (TSW); freshwater transfer gills (LFW); and freshwater transfer gut (TFW). Our results showed that LSW had higher diversities, richness, and evenness compared to TSW. However, both the LFW and LSW did not show any significant differences after the freshwater transfer experiment. We further applied co-occurrence network analysis and, for the first time, reported on the interactions of taxa shaping the community structure in these two organs. Moreover, we identified enriched ectoine biosynthesis in seawater samples, suggesting its potential role in seawater environments. Increased mRNA expression levels of Na + /K + -atpase , and cftr , were observed in gills after 6 h of ectoine treatment. These findings provide a foundation for future studies on host-bacteria interactions under osmotic stress. [Display omitted] • New microbiota data in gills and gut of medaka under osmotic stress • Microbiota in seawater gills exhibit higher diversities than in the gut. • LefSe cladogram analysis identified that the major contributors in gut are opportunistic pathogenic bacteria. • Co-occurrence network analysis identified hub taxa in the gills and gut under seawater and freshwater transfer conditions. • Ecotine induces mRNA expression levels of ion transporters in gills. [ABSTRACT FROM AUTHOR]

In this paper, we consider the development of reliable tools to assess the water quality and state of aquatic ecosystems in dynamic conditions a crucial need to address. One of such tools could be devised by monitoring the taxonomic structure of reservoirs’ microbiomes. Microbial taxa’s ecological and metabolic characteristics suggest their essential roles in maintaining the water ecosystem’s environmental equilibrium. The study aimed to explainthe role of diversity and seasonal variability of the microbial communities in the ecosystem stability on the example of Goczałkowice Reservoir (Poland). The structure of the reservoir microbiome was studied using bioinformatics and modeling techniques. Water was sampled periodically in July & November 2010, and April 2011 at four representative sites. The abundance and relative fraction of the limnetic taxonomic units were determined in respectto the physicochemical indices. Significant seasonal variations in the number of operational taxonomic units (OTU)were observed within the reservoir basin’s main body but not at the main tributary’s mouth. The highest valuesof the correlation coefficients between OTU and physicochemical variables were obtained for Burkholderiales,Pseudoanabenales, Rickettsiales, Roseiflexales, Methylophilales, Actinomycetales, and Cryptophyta. Thesemicroorganisms are proposed as indicators of environmental conditions and water quality. Metataxonomic analyses of the fresh water microbiome in the reservoir, showed that microorganisms constitute conservative communities that undergo seasonal and local changes regarding the relative participation of the identified taxa. Therefore, we propose that monitoring those variations could provide a reliable measure of the state of aquatic ecosystems.

Edible mushrooms contain biologically active compounds with antioxidant, antimicrobial, immunomodulatory and anticancer properties. The link between their anticancer and immunomodulatory properties with their possible prebiotic activity on gut micro-organisms has been the subject of intense research over the last decade. Lyophilized Pleurotus eryngii (PE) mushrooms, selected due to their strong lactogenic effect and anti-genotoxic, immunomodulatory properties, underwent in vitro static batch fermentation for 24 h by fecal microbiota from eight elderly apparently healthy volunteers (>65 years old). The fermentation-induced changes in fecal microbiota communities were examined using Next Generation Sequencing of the hypervariable regions of the 16S rRNA gene. Primary processing and analysis were conducted using the Ion Reporter Suite. Changes in the global metabolic profile were assessed by 1H NMR spectroscopy, and metabolites were assigned by 2D NMR spectroscopy and the MetaboMiner platform. PLS-DA analysis of both metataxonomic and metabolomic data showed a significant cluster separation of PE fermented samples relative to controls. DEseq2 analysis showed that the abundance of families such as Lactobacillaceae and Bifidobacteriaceae were increased in PE samples. Accordingly, in metabolomics, more than twenty metabolites including SCFAs, essential amino acids, and neurotransmitters discriminate PE samples from the respective controls, further validating the metataxonomic findings. [ABSTRACT FROM AUTHOR]

Background: A growing body of evidence demonstrates a different bacterial composition in the oral cavity of patients with oral lichen planus (OLP). Patients and methods: Buccal swab samples were collected from affected and non-affected sites of six patients with reticular OLP and the healthy oral mucosa of six control subjects. 16S rRNA gene MiSeq sequencing and mass spectrometry-based proteomics were utilised to identify the metataxonomic and metaproteomic profiles of the oral microbiome in both groups. Results: From the metataxonomic analysis, the most abundant species in the three subgroups were Streptococcus oralis and Pseudomonas aeruginosa, accounting for up to 70% of the total population. Principal Coordinates Analysis showed differential clustering of samples from the healthy and OLP groups. ANCOM-BC compositional analysis revealed multiple species (including P. aeruginosa and several species of Veillonella, Prevotella, Streptococcus and Neisseria) significantly over-represented in the control group and several (including Granulicatella elegans, Gemella haemolysans and G. parahaemolysans) in patients with OLP. The metaproteomic data were generally congruent and revealed that several Gemella haemolysans-belonging peptidases and other proteins with inflammatory and virulence potential were present in OLP lesions. Conclusion: Our data suggest that several bacterial species are associated with OLP. Future studies with larger cohorts should be conducted to determine their role in the aetiology of OLP and evaluate their potential as disease biomarkers. [ABSTRACT FROM AUTHOR]

Kopanisti is a Greek PDO cheese, which is traditionally produced by the addition of an amount of over-mature Kopanisti, called Mana Kopanisti, to initiate cheese ripening. The aim of this study was the production of four types of Kopanisti cheese (A–D) using pasteurized cow milk, and a combination of the following starters/adjuncts in order to test their ability to be used in Kopanisti cheese production: A: Lactococcus lactis subsp. lactis and Lacticaseibacillus paracasei, B: L. lactis and Lc. paracasei/Mana Kopanisti, C: L. lactis and Lc. paracasei/Ligilactobacillus acidipiscis and Loigolactobacillus rennini, D: Lig. acidipiscis and Loig. rennini. Throughout production and ripening, classical microbiological, metataxonomics and physicochemical analyses were employed, while the final products (Day 35) were subjected to sensory analysis as well. Most interestingly, beta-diversity analysis of the metataxonomics data revealed the clusters constructed among the Kopanisti types based on the different inoculation schemes. On day 35, Kopanisti A–C types clustered together due to their similar 16S microbiota, while Kopanisti D was highly differentiated. On the contrary, ITS data clustered Kopanisti B and C together, while Kopanisti A and D were grouped seperately. Finally, based on the sensory evaluation, Kopanisti C appeared to have the most suitable bacteria cocktail for the Kopanisti cheese production. Therefore, not only were the conventional starters used, but also the Lig. acidipiscis and Loig. rennini strains could be used in a standardized Kopanisti cheese production that could lead to final products of high quality and safety. [ABSTRACT FROM AUTHOR]

Elderly was the most affected population during the first COVID-19 and those living in nursing homes represented the most vulnerable group, with high mortality rates, until vaccines became available. In a previous article, we presented an open-label trial showing the beneficial effect of the strain Ligilactobacillus salivarius CECT 30632 (previously known as L. salivarius MP101) on the functional and nutritional status, and on the nasal and fecal inflammatory profiles of elderly residing in a nursing home highly affected by the pandemic. The objective of this post-hoc analysis was to elucidate if there were changes in the nasal and fecal bacteriomes of a subset of these patients as a result of the administration of the strain for 4 months and, also, its impact on their fecal fatty acids profiles. Culture-based methods showed that, while L. salivarius (species level) could not be detected in any of the fecal samples at day 0, L. salivarius CECT 30632 (strain level) was present in all the recruited people at day 120. Paradoxically, the increase in the L. salivarius counts was not reflected in changes in the metataxonomic analysis of the nasal and fecal samples or in changes in the fatty acid profiles in the fecal samples of the recruited people. Overall, our results indicate that L. salivarius CECT 30632 colonized, at least temporarily, the intestinal tract of the recruited elderly and may have contributed to improvements in their functional, nutritional, and immunological status, without changing the general structure of their nasal and fecal bacteriomes when assessed at the genus level. They also suggest the ability of low abundance bacteria to train immunity. [ABSTRACT FROM AUTHOR]

Background: Post-mortem microbial communities are increasingly investigated as proxy evidence for a variety of factors of interest in forensic science. The reported predictive power of the microbial community to determine aspects of the individual’s post-mortem history (e.g., the postmortem interval) varies substantially among published research. This observed variation is partially driven by the local environment or the individual themselves. In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach. Materials and methods: In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach. Results: We found that season, temperature at the sampling site, BMI, and sex had a significant effect on the post-mortem microbiome, the presence of insects has a homogenizing influence on the total bacterial community, and that community consistency from repeat sampling decreases as the decomposition process progresses. Moreover, we demonstrate the importance of temperature at the site of sampling on the abundance of important diagnostic taxa. Conclusion: The results of this study suggest that while the bacterial community or specific bacterial species may prove to be useful for forensic applications, a clearer understanding of the mechanisms underpinning microbial decomposition will greatly increase the utility of microbial evidence in forensic casework. [ABSTRACT FROM AUTHOR]

The Ironwood tree ( Casuarina equisetifolia ) holds a significant ecological role in Guam where a decline in Ironwood trees was first documented in 2002. Studies have linked the Ironwood tree decline (IWTD) to bacteria from the Ralstonia solanacearum complex and wetwood bacteria, specifically Klebsiella oxytoca and Klebsiella variicola . Presence of termites was first found to be associated with IWTD in 2010; however, the role of termites in IWTD is still not clear. The Asian subterranean termite, Coptotermes gestroi (Wasmann) (Blattodea: Rhinotermitidae) frequently attacks Ironwood trees. As workers of this soil-dwelling species of the lower termites harbor a diverse microbial community in their bodies, we examined whether C. gestroi workers carry IWTD-associated bacteria and could, therefore, act as vectors. We described the bacterial community in C. gestroi workers using 16S rRNA gene sequencing and tested the impact of factors related to the location and health of the Ironwood tree the termites were collected from on termite bacterial diversity. Feeding assays were performed to assess if workers show preference in consumption depending on the amount of Ralstonia and wetwood bacteria in the food source. Health of Ironwood trees and level of site management impacted the bacterial composition of C. gestroi termite workers attacking the trees. Although C. gestroi workers equally consumed food sources with high and low Ralstonia and wetwood bacteria load in lab experiments, Ralstonia and other IWTD-related bacteria were not detected in considerable amounts in termite workers collected from trees. Thus, C. gestroi workers are not a vector for bacteria associated with IWTD in Guam., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Setia, Chen, Schlub and Husseneder.)

This study examines the impact of the complex microbiota from long-term fermented kimchi, used as a backslop, on fermentation dynamics. The fermentation was conducted with autoclaved (group A) and non-autoclaved (NA) starter cultures. Bacterial and fungal communities were analyzed with 16S rRNA gene V4 and ITS2 region, respectively, and metabolites were profiled using gas chromatography-mass spectrometry. In the group NA, Levilactobacillus dominated at 64.3 % by day 5, while Pediococcus reached 57.4 % by day 50. Principal coordinate analysis showed that bacterial communities in both the starter culture and samples of the group NA became similar by the end of the fermentation (day 100); however, no significant differences were found in fungal community. Principal component analysis revealed distinct metabolite profiles, explaining 68.7 % of variability on PC1, with each group clustered separately by day 100. These results suggest that inoculating with microbiota from long-term fermentation can rapidly produce foods with desirable characteristics., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 Elsevier Ltd. All rights reserved.)

The ruminant-microorganism symbiosis is unique by providing high-quality food from fibrous materials but also contributes to the production of one of the most potent greenhouse gases-methane. Mitigating methanogenesis in ruminants has been a focus of interest in the past decades. One of the promising strategies to combat methane production is the use of feed supplements, such as seaweeds, that might mitigate methanogenesis via microbiome modulation and direct chemical inhibition. We conducted in vitro investigations of the effect of three seaweeds ( Ascophyllum nodosum , Asparagopsis taxiformis , and Fucus vesiculosus ) harvested at different locations (Iceland, Scotland, and Portugal) on methane production. We applied metataxonomics (16S rRNA gene amplicons) and metagenomics (shotgun) methods to uncover the interplay between the microbiome's taxonomical and functional states, methanogenesis rates, and seaweed supplementations. Methane concentration was reduced by A. nodosum and F. vesiculosus , both harvested in Scotland and A. taxiformis , with the greatest effect of the latter. A. taxiformis acted through the reduction of archaea-to-bacteria ratios but not eukaryotes-to-bacteria. Moreover, A. taxiformis application was accompanied by shifts in both taxonomic and functional profiles of the microbial communities, decreasing not only archaeal ratios but also abundances of methanogenesis-associated functions. Methanobrevibacter "SGMT" ( M. smithii, M. gottschalkii, M. millerae or M. thaueri ; high methane yield) to "RO" ( M. ruminantium and M. olleyae ; low methane yield) clades ratios were also decreased, indicating that A. taxiformis application favored Methanobrevibacter species that produce less methane. Most of the functions directly involved in methanogenesis were less abundant, while the abundances of the small subset of functions that participate in methane assimilation were increased., Importance: The application of A. taxiformis significantly reduced methane production in vitro . We showed that this reduction was linked to changes in microbial function profiles, the decline in the overall archaeal community counts, and shifts in ratios of Methanobrevibacter "SGMT" and "RO" clades. A. nodosum and F. vesiculosus , obtained from Scotland, also decreased methane concentration in the total gas, while the same seaweed species from Iceland did not., Competing Interests: The authors declare no conflict of interest.

Abstract Background Vaginal microbiota (VMB) composition is altered in women with cervical intra-epithelial neoplasia (CIN) compared to healthy controls and is associated with disease progression. However, the impact of CIN excision on the VMB and innate immunity is not known. This observational study aims to explore the impact of CIN excision on the VMB, antimicrobial peptides (AMP) and proinflammatory cytokines. Methods We sampled 103 non-pregnant, premenopausal women at the time of excisional treatment for CIN and at their 6-month follow-up visit. A further 39 untreated controls with normal cytology were also sampled. We used metataxonomics to group vaginal swab samples into community state types (CSTs) and ELISA to quantify cytokine and AMP levels in matched vaginal secretions. Analyses were performed to compare the bacterial composition and immune analyte levels before and after CIN excision and in healthy controls. Results Women with CIN had significantly higher rates of Lactobacillus species depletion pre-treatment compared to healthy controls (CST IV 21/103, 20% vs 1/39, 3%, p = 0.0081). Excision did not change the VMB composition, with CST IV remaining significantly more prevalent after excision compared to untreated, healthy controls (CST IV 19/103, 20% vs 1/39, 3%, p = 0.0142). Prevotella bivia and Sneathia amnii were significantly higher in samples before treatment compared to untreated controls, and Prevotella bivia remained significantly higher amongst the treated, with less Lactobacillus crispatus compared to untreated controls. IL-1β and IL-8 remained significantly elevated pre- (p < 0.0001 and p = 0.0014, respectively) and post-treatment (p < 0.0001 and p = 0.0035, respectively) compared to untreated controls. Levels of human beta-defensin-1 and secretory leukocyte protease inhibitor were both significantly reduced following CIN excision (p < 0.0001); however, their levels remained lower than controls post-treatment. Conclusions Women with CIN have an increased prevalence of Lactobacillus sp. depletion, high-diversity VMB composition, and higher levels of proinflammatory cytokines and AMPs compared to normal controls. Surgical excision of the disease reduces levels of vaginal AMPs but does not alter VMB composition or cytokine levels. These findings suggest that women with CIN have an inherent predisposition to a high-diversity proinflammatory environment that is not corrected by disease excision. The failure to re-establish a Lactobacillus-enriched CST may explain why women remain at high risk of pre-invasive and invasive disease recurrence.

Elderly was the most affected population during the first COVID-19 and those living in nursing homes represented the most vulnerable group, with high mortality rates, until vaccines became available. In a previous article, we presented an open-label trial showing the beneficial effect of the strain Ligilactobacillus salivarius CECT 30632 (previously known as L. salivarius MP101) on the functional and nutritional status, and on the nasal and fecal inflammatory profiles of elderly residing in a nursing home highly affected by the pandemic. The objective of this post-hoc analysis was to elucidate if there were changes in the nasal and fecal bacteriomes of a subset of these patients as a result of the administration of the strain for 4 months and, also, its impact on their fecal fatty acids profiles. Culture-based methods showed that, while L. salivarius (species level) could not be detected in any of the fecal samples at day 0, L. salivarius CECT 30632 (strain level) was present in all the recruited people at day 120. Paradoxically, the increase in the L. salivarius counts was not reflected in changes in the metataxonomic analysis of the nasal and fecal samples or in changes in the fatty acid profiles in the fecal samples of the recruited people. Overall, our results indicate that L. salivarius CECT 30632 colonized, at least temporarily, the intestinal tract of the recruited elderly and may have contributed to improvements in their functional, nutritional, and immunological status, without changing the general structure of their nasal and fecal bacteriomes when assessed at the genus level. They also suggest the ability of low abundance bacteria to train immunity.

BackgroundPost-mortem microbial communities are increasingly investigated as proxy evidence for a variety of factors of interest in forensic science. The reported predictive power of the microbial community to determine aspects of the individual’s post-mortem history (e.g., the post-mortem interval) varies substantially among published research. This observed variation is partially driven by the local environment or the individual themselves. In the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach.Materials and methodsIn the current study, we investigated the impact of BMI, sex, insect activity, season, repeat sampling, decomposition time, and temperature on the microbial community sampled from donated human remains in San Marcos, TX using a high-throughput gene-fragment metabarcoding approach.ResultsWe found that season, temperature at the sampling site, BMI, and sex had a significant effect on the post-mortem microbiome, the presence of insects has a homogenizing influence on the total bacterial community, and that community consistency from repeat sampling decreases as the decomposition process progresses. Moreover, we demonstrate the importance of temperature at the site of sampling on the abundance of important diagnostic taxa.ConclusionThe results of this study suggest that while the bacterial community or specific bacterial species may prove to be useful for forensic applications, a clearer understanding of the mechanisms underpinning microbial decomposition will greatly increase the utility of microbial evidence in forensic casework.

ABSTRACT Bats have attracted global attention because of their zoonotic association with severe acute respiratory syndrome coronavirus (SARS-CoV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Previous and ongoing studies have predominantly focused on bat-borne viruses; however, the prevalence or abundance of bat-borne pathogenic bacteria and their potential public health significance have largely been neglected. For the first time, this study used both metataxonomics (16S rRNA marker gene sequencing) and culturomics (traditional culture methods) to systematically evaluate the potential public health significance of bat fecal pathogenic bacteria. To this end, fecal samples were obtained from five bat species across different locations in China, and their microbiota composition was analyzed. The results revealed that the bat microbiome was most commonly dominated by Proteobacteria, while the strictly anaerobic phylum Bacteroidetes occupied 35.3% of the relative abundance in Rousettus spp. and 36.3% in Hipposideros spp., but less than 2.7% in the other three bat species (Taphozous spp., Rhinolophus spp., and Myotis spp.). We detected 480 species-level phylotypes (SLPs) with PacBio sequencing, including 89 known species, 330 potentially new species, and 61 potentially higher taxa. In addition, a total of 325 species were identified by culturomics, and these were classified into 242 named species and 83 potentially novel species. Of note, 32 of the 89 (36.0%) known species revealed by PacBio sequencing were found to be pathogenic bacteria, and 69 of the 242 (28.5%) known species isolated by culturomics were harmful to people, animals, or plants. Additionally, nearly 40 potential novel species which may be potential bacterial pathogens were identified. IMPORTANCE Bats are one of the most diverse and widely distributed groups of mammals living in close proximity to humans. In recent years, bat-borne viruses and the viral zoonotic diseases associated with bats have been studied in great detail. However, the prevalence and abundance of pathogenic bacteria in bats have been largely ignored. This study used high-throughput sequencing techniques (metataxonomics) in combination with traditional culture methods (culturomics) to analyze the bacterial flora in bat feces from different species of bats in China, revealing that bats are natural hosts of pathogenic bacteria and carry many unknown bacteria. The results of this study can be used as guidance for future investigations of bacterial pathogens in bats.

Bacterial pathogens in the domestic environment present a risk to residents, particularly among susceptible populations. However, the impact of consumer demographic characteristics and food handling methods on kitchen microbiomes is not fully understood. The domestic kitchen bacterial communities of ten predominantly low-income families in Houston, TX, were assessed in conjunction with a cross-sectional food safety survey to evaluate differences in household and surface-specific microbiomes and bacterial foodborne pathogen presence. Three kitchen surfaces within each household, including the sink drain, the refrigerator handle, and the counter, were environmentally sampled and metataxonomically evaluated via targeted 16S rRNA sequencing. Disposable dish sponges were also acquired and examined. Results indicated that alpha diversity did not vary by the households, sampling locations, or demographic characteristics evaluated. Significant differences in beta diversity were observed among the bacterial communities of five pairs of households and between refrigerator handle and disposable dish sponge microbiomes. A total of 89 unique bacterial foodborne pathogens were identified across surface types. Each household contained at least one contaminated surface, and the most common bacterial foodborne pathogens identified were Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae. All parents reported washing their hands before meal preparation, washing fresh fruits and vegetables, and washing cutting boards with soap after use to prepare raw animal proteins. Gaps in food safety behaviors identified included a lack of serious concern for food contamination with germs and inappropriate handwashing, food handling, and cleaning behaviors. The number of unique bacterial foodborne pathogens identified within households was significantly higher among households whose respondent parent reported that they did not consider food contamination with germs to be a serious food safety problem (median: 41.0 species) compared to households whose respondent parent did consider food contamination to be a serious food safety problem (median: 3.0 species; p value=0.0218). These results demonstrate that domestic kitchen taxonomic abundance profiles vary according to household and surface type. Data suggest that low-income consumers may be at risk of foodborne pathogen exposure from contaminated home kitchen surfaces, and that food safety attitudes may directly contribute to this hazard. [ABSTRACT FROM AUTHOR]

Citrus is the most cultivated fruit crop worldwide. The modern citrus industry needs new bioproducts to overcome phytopathological threats, tolerate stresses and increase yield and quality. Mutualistic microbes from roots significantly impact host physiology and health and are a potentially beneficial resource. The bacterial microbiome can be surveyed to select potentially host-beneficial microbes. To achieve this goal, a prevalent "core-citrus" bacterial microbiome was obtained by picking those operational taxonomic units (OTUs) shared among samples within and across two Citrus rootstock genotypes grown in the same soil for more than 20 years. A sub-selection of main OTUs from the defined "core-citrus" microbiome was made based on abundance, host-enriched versus bulk soil, and rhizosphere-indicator species. In parallel, an extensive census of the cultivable microbiota was performed to collect a large number of bacterial citrus isolates. Metataxonomic data were linked to cultured microbes, matching 16S rRNA gene sequences from bacterial isolates with those counterpart OTU reference sequences from the selected bacterial "core-citrus" microbiome. This approach allowed selection of potentially host-beneficial bacteria to mine for agricultural probiotics in future biotechnological applications required for the citrus industry. [Display omitted] • Bacterial citrus microbiomes described using uncultured and cultured approaches. • The untapped diversity of host-associated bacteria as a source of benefits. • A collection of potentially beneficial bacteria for citrus is now available. • These bacteria could provide future agricultural probiotics required for the citrus industry. [ABSTRACT FROM AUTHOR]

Objectives: To characterize the healthy ocular surface microbiota at the species level, including cultured and uncultured taxa. Methods: We integrated the metataxonomic method with culturomics and genome sequencing analysis of selected isolated strains to better illustrate the taxonomic structure of the ocular surface microbiota. The metataxonomics used the full-length 16S rRNA gene sequences and the operational phylogenetic unit strategy, which can precisely identify the cultured and uncultured or potentially new taxa to species level based on the phylogenetic tree constructed. Results: We detected 1,731 operational phylogenetic units (OPUs) in 196 healthy eyes from128 people, affiliated to 796 cultured species, 784 potentially new species, and 151 potentially new higher taxa. The microbiota for each eye had 49.17 ± 35.66 OPUs. Of the 796 cultured species, 170 (21.36%) had previously caused clinical infections. Based on where they were initially isolated, the ocular surface microbiota mainly came from human body sites (34.55%), the environment (36.93%), plants (9.05%), animals (4.90%), and others; 428 strains were isolated from 20 eyes, affiliated to 42 species, and had come from the environment (33.33%) and the skin (16.67%). Of these, 47.62% had previously caused clinical infections. Genome analysis of 73 isolators revealed that 68.5% of them carried antibiotic resistance genes. The most frequently isolated genera, namely Staphylococcus, Streptococcus, and Moraxella, had an average of 5.30, four, and three resistance genes per strain, respectively. Discussion: The study found that the ocular surface microbiota mainly came from the environment, plants, animals, food, and human body sites such as the skin, oral cavity, upper respiratory tract, etc. No core member of ocular surface microbiota was detected at the species level. The human eyes were invaded and colonized by bacteria from the exposed environment, some of which were capable of causing infections in humans and carried antibiotic resistance genes. Preventive measures should be developed to protect our eyes from danger. [ABSTRACT FROM AUTHOR]

Potable water supply and sanitization inrural areas in developing countries are still inadequate. The main risk associated with unsafe drinking water is the infection with pathogenic microorganisms. Objective: In this study, we investigate the bacterial diversity and the potentially pathogenic bacteria in water samples from diffe-rent points of distribution in three rural villages from the Andean region of Colombia. Methods: Illumina libraries for water samples were prepared and sequenced using 300 bp paired-end MiSeq protocol, the bioinformatic analyses were performed with Mothur pipeline and the phyloseq package in Rstudio. Results: The mi-crobial community composition showed statistically significant differences according to the village and the sample origin. Alpha, Beta, and Gammaproteobacteria were the dominant class detected in all water samples. The most relevant pathogenic genera detected in the surface were Legionella, Mycobacterium, Yersinia, Burkholderia, and Rickettsia. In the tap water samples, potential pathogens like Streptococcus, Staphylococcus, Corynebacterium, Nocardia, and Escherichia/Shige-lla were detected.

ABSTRACT Salar de Atacama is located approximately 55 km south of San Pedro de Atacama in the Antofagasta region, Chile. The high UV irradiation and salt concentration and extreme drought make Salar de Atacama an ideal site to search for novel soil microorganisms with unique properties. Here, we used a metataxonomic approach (16S rRNA V3-V4) to identify and characterize the soil microbiota associated with different surface azonal vegetation formations, including strict hygrophiles (Baccharis juncea, Juncus balticus, and Schoenoplectus americanus), transitional hygrophiles (Distichlis spicata, Lycium humile, and Tessaria absinthioides), and their various combinations. We detected compositional differences among the soil surface microbiota associated with each plant formation in the sampling area. There were changes in soil microbial phylogenetic diversity from the strict to the transitional hygrophiles. Moreover, we found alterations in the abundance of bacterial phyla and genera. Halobacteriota and Actinobacteriota might have facilitated water uptake by the transitional hygrophiles. Our findings helped to elucidate the microbiota of Salar de Atacama and associate them with the strict and transitional hygrophiles indigenous to the region. These findings could be highly relevant to future research on the symbiotic relationships between microbiota and salt-tolerant plants in the face of climate change-induced desertification. IMPORTANCE The study of the composition and diversity of the wetland soil microbiota associated with hygrophilous plants in a desert ecosystem of the high Puna in northern Chile makes it an ideal approach to search for novel extremophilic microorganisms with unique properties. These microorganisms are adapted to survive in ecological niches, such as those with high UV irradiation, extreme drought, and high salt concentration; they can be applied in various fields, such as biotechnology and astrobiology, and industries, including the pharmaceutical, food, agricultural, biofuel, cosmetic, and textile industries. These microorganisms can also be used for ecological conservation and restoration. Extreme ecosystems are a unique biological resource and biodiversity hot spots that play a crucial role in maintaining environmental sustainability. The findings could be highly relevant to future research on the symbiotic relationships between microbiota and extreme-environment-tolerant plants in the face of climate change-induced desertification.

Bacterial pathogens in the domestic environment present a risk to residents, particularly among susceptible populations. However, the impact of consumer demographic characteristics and food handling methods on kitchen microbiomes is not fully understood. The domestic kitchen bacterial communities of ten predominantly low-income families in Houston, TX, were assessed in conjunction with a cross-sectional food safety survey to evaluate differences in household and surface-specific microbiomes and bacterial foodborne pathogen presence. Three kitchen surfaces within each household, including the sink drain, the refrigerator handle, and the counter, were environmentally sampled and metataxonomically evaluated via targeted 16S rRNA sequencing. Disposable dish sponges were also acquired and examined. Results indicated that alpha diversity did not vary by the households, sampling locations, or demographic characteristics evaluated. Significant differences in beta diversity were observed among the bacterial communities of five pairs of households and between refrigerator handle and disposable dish sponge microbiomes. A total of 89 unique bacterial foodborne pathogens were identified across surface types. Each household contained at least one contaminated surface, and the most common bacterial foodborne pathogens identified were Escherichia coli, Staphylococcus aureus, and Klebsiella pneumoniae. All parents reported washing their hands before meal preparation, washing fresh fruits and vegetables, and washing cutting boards with soap after use to prepare raw animal proteins. Gaps in food safety behaviors identified included a lack of serious concern for food contamination with germs and inappropriate handwashing, food handling, and cleaning behaviors. The number of unique bacterial foodborne pathogens identified within households was significantly higher among households whose respondent parent reported that they did not consider food contamination with germs to be a serious food safety problem (median: 41.0 species) compared to households whose respondent parent did consider food contamination to be a serious food safety problem (median: 3.0 species; p value = 0.0218). These results demonstrate that domestic kitchen taxonomic abundance profiles vary according to household and surface type. Data suggest that low-income consumers may be at risk of foodborne pathogen exposure from contaminated home kitchen surfaces, and that food safety attitudes may directly contribute to this hazard.

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety. [ABSTRACT FROM AUTHOR]

The study of microbial communities or microbiotas in animals and environments is important because of their impact in a broad range of industrial applications, diseases and ecological roles. High throughput sequencing (HTS) is the best strategy to characterize microbial composition and function. Microbial profiles can be obtained either by shotgun sequencing of genomes, or through amplicon sequencing of target genes (e.g., 16S rRNA for bacteria and ITS for fungi). Here, we compared both HTS approaches at assessing taxonomic and functional diversity of bacterial and fungal communities during vermicomposting of white grape marc. We applied specific HTS workflows to the same 12 microcosms, with and without earthworms, sampled at two distinct phases of the vermicomposting process occurring at 21 and 63 days. Metataxonomic profiles were inferred in DADA2, with bacterial metabolic pathways predicted via PICRUSt2. Metagenomic taxonomic profiles were inferred in PathoScope, while bacterial functional profiles were inferred in Humann2. Microbial profiles inferred by metagenomics and metataxonomics showed similarities and differences in composition, structure, and metabolic function at different taxonomic levels. Microbial composition and abundance estimated by both HTS approaches agreed reasonably well at the phylum level, but larger discrepancies were observed at lower taxonomic ranks. Shotgun HTS identified ~1.8 times more bacterial genera than 16S rRNA HTS, while ITS HTS identified two times more fungal genera than shotgun HTS. This is mainly a consequence of the difference in resolution and reference richness between amplicon and genome sequencing approaches and databases, respectively. Our study also revealed great differences and even opposite trends in alpha- and beta-diversity between amplicon and shotgun HTS. Interestingly, amplicon PICRUSt2-imputed functional repertoires overlapped ~50% with shotgun Humann2 profiles. Finally, both approaches indicated that although bacteria and fungi are the main drivers of biochemical decomposition, earthworms also play a key role in plant vermicomposting. In summary, our study highlights the strengths and weaknesses of metagenomics and metataxonomics and provides new insights on the vermicomposting of white grape marc. Since both approaches may target different biological aspects of the communities, combining them will provide a better understanding of the microbiotas under study. [ABSTRACT FROM AUTHOR]