Search

Environmental DNA (eDNA) sampling is an established tool for biodiversity studies. The design of assays to detect species’ DNA in samples underpins this tool. Although much progress has been made to develop validation frameworks for assay performance, an in silico validation framework is sorely missing. A conceptual framework was developed to incorporate the elements of assay design and likely outcomes of assay performance through a step-by-step decision tree evaluating in silico sensitivity and specificity. Using an in silico PCR tool, the sensitivity and specificity of published assays were evaluated to determine the potential ability of an assay to amplify and detect known target and non-target species sequences and place them within the conceptual framework. Results showed that most published assays tested exhibited the potential for Type I and/or Type II errors, with very few assays showing unique species specificity. Results also demonstrate that in silico validation can predict potential problematic non-target species co-amplification. The developed conceptual framework demonstrates the ability to provide a robust and reproducible in silico validation step highlighting key components of the design stage that need to be published to improve transparency, repeatability, reproducibility, and confidence in eDNA sampling.

With impressive density and coding capacity, DNA offers a promising solution for building long-lasting data archival storage systems. In recent implementations, data retrieval such as random access typically relies on a large library of non-interacting PCR primers. While several algorithms automate the primer design process, the capacity and scalability of DNA-based storage systems are still fundamentally limited by the availability of experimentally validated orthogonal primers. In this work, we combine the nested and semi-nested PCR techniques to virtually enforce multidimensional data organization in large DNA storage systems. The strategy effectively pushes the limit of DNA storage capacity and reduces the number of primers needed for efficient random access from very large address space. Specifically, our design requires k * n unique primers to index nk data entries, where k specifies the number of dimensions and n indicates the number of data entries stored in each dimension. We strategically leverage forward/reverse primer pairs from the same or different address layers to virtually specify and maintain data retrievals in the form of rows, columns, tables, and blocks with respect to the original storage pool. This architecture enables various random-access patterns that could be tailored to preserve the underlying data structures and relations (e.g., files and folders) within the storage content. With just one or two rounds of PCR, specific data subsets or individual datum from the large multidimensional storage can be selectively enriched for simple extraction by gel electrophoresis or readout via sequencing.Abstract Figure

The process of molecular identification of species known as DNA barcoding consists on discriminating taxa based on cumulative differences of their DNA sequences and is widely used within animals, including birds. Finding the best genomic tools, such as primers, to reach most of the species within the studied groups and evaluating the coverage breadth and physicochemical properties of primers before testing in the laboratory, can save time and financial resources. Therefore, this work aimed to retrieve the available primers for the COI gene currently used on the molecular identification of birds and evaluate them for its coverage range, physicochemical properties, and performance on in silico PCR. Afterwards, we provide the best primer subsets to cover the highest number of avian sequences and the best individual primers for each bird order in terms of coverage breadth. Thirty-one bird orders had at least one COI sequence to serve as template, 152 primers available for assessing the COI gene were evaluated, and 118 could bind to at least one template sequence. No primer subset alone could cover all template sequences; however, when combining two subsets, the complete coverage of avian COI sequences analyzed was achieved. We were able to find optimal primer subsets for more specific taxonomic groups or for analysis involving the complete avian group, in order to guide researchers in the process of choosing the best primer set for each individual barcoding goal.

Background The techniques of amplifying genetic materials have enabled the extensive study of several biological activities outside the biological milieu of living systems. More recently, this approach has been extended to amplify population of genes, from evolutionarily related gene family for detection and evaluation of microbial consortial with several unique potentialities (e.g., enzymatic degradability). Conceivably, primer mixtures containing substitutions of different bases at specific sites (degenerate primers) have enabled the amplification of these genes in PCR reaction. However, the degenerate primer design problem (DPD) is a constraint to designing this kind of primer. To date, different algorithms now exist to solve various versions of DPD problem, many of which, only few addresses and satisfy the criteria to design primers that can extensively cover high through-put sequences while striking the balance between specificity and efficiency. The highly degenerate primer (HYDEN) design software program primarily addresses this variant of DPD problem termed “maximum coverage-degenerate primer design (MC-DPD)” and its heuristics have been substantiated for optimal efficiency from significant successes in PCR. In spite of the premium presented for designing degenerate primers, literature search has indicated relatively little use of its heuristics. This has been thought to result from the complexity of the program since it is run only by command-line, hence limiting its accessibility. To solve this problem, researchers have optionally considered the manual design of degenerate primers or design through software programs that provides accessibility through a graphical user interface (GUI). Realizing this, we have attempted in this study to provide a user-friendly approach for researchers with little or no background in bioinformatics to design degenerate primers using HYDEN Results Virtual Tests of our designed degenerate primer pair through in silico PCR substantiated the correspondence between efficiency and coverage with the target sequences as pre-defined by the initial HYDEN output, thereby validating the potentials of HYDEN to effectively solve the MC-DPD problem. Additionally, the designed primer-pair mechanistically amplified all sequences used as a positive control with no amplification observed in the negative controls. Conclusion In this study, we provided a turnkey protocol to simplify the design of degenerate primers using the heuristics of the HYDEN software program.

Seafood-borne outbreaks caused by Vibrio cholerae have led to the increased need for food safety risk assessment of marine products. An in silico investigation about the potential of virulence gene of V. cholerae, rtxA, as a DNA biomarker of the toxigenic bacterium has been carried out. The aim of this study was to use the bacterial DNA biomarker sequence as a tool to facilitate early rapid detection of cholera infection. Five specific pairs of primers were designed from the rtxA open reading frame DNA of V. cholerae O1 biovar El Tor str. N16961 genomic DNA using Primer3Plus. Next, in silico Polymerase Chain Reaction (PCR) assay was carried out using the newly designed primers and 25 genomic DNA of vibrio spp. retrieved from the in silico database. One of the five designed pairs of primers, RtxAOF-RtxAOR: ‘5-CGCAAAACAGTTTCAGCCGA-3’ and 5’-AGGTTGGTCTTTTGTGGCCA-3’, could result in single DNA amplicon sized 518 bp only from V. cholerae species. No amplicon bands were produced from 17 other vibrio genomes studied using similar RtxAF-RtxAR primers. A further check showed that the amplicon was indeed part of the rtxA gene of V. cholerae. Based on this in silico study, rtxA gene appeared to be a DNA biomarker of V. cholerae, which is potential to facilitate rapid diagnosis of the virulence bacterium using in silico PCR assay.

Streptococcus iniae has been notorious as a serious tilapia fish pathogen leading to many disease outbreaks in warm water marine aquaculture. An in silico investigation about the potential of virulence genes of S. iniae, sagC and sagD, as biomarkers of the bacterial species, has been carried out. The aim was to determine bacterial biomarkers, which are important to facilitate early rapid diagnosis of S. iniae streptococcal infection in fish and also in humans. First, specific primers were designed from sagC and sagD genes of S. iniae SF1 genomic DNA using Primer3Plus. Next, in silico PCR (Polymerase Chain Reaction) analysis was carried out using the newly designed primers and 117 genomic DNA of streptococci (all species) retrieved from the database. Primers designed from sagC and sagD genes (SagCF: ‘5- TGCTGACCTCCTAAAAGGGC -3’ and SagCR: ‘5- CTATGCGGCGGGTTTAAGGT -3’ as well as SagDF: 5’- GCCAATCCAATCCTGTCATGC -3’ and SagDR: 5’- TGCAGCTTCCATAACCCCTC -3’) could result in a single band of each matching to 558-bp and 590-bp PCR products only from S. iniae. From 116 other streptococcal genomes studied using similar primers have resulted in no amplicon bands. A further check showed that the amplicons were truly part of sagC and sagD genes of S. iniae. These results showed that sagC and sagD genes appeared to be biomarkers of S. iniae, which are potential to be used to facilitate rapid diagnostic of the pathogenic bacterium.

The FastPCR software as an integrated tools environment for PCR primer and probe design and for prediction of oligonucleotide properties. The software provides comprehensive tools for designing primers for most PCR and perspective applications, including standard, multiplex, long-distance, inverse, real-time with TaqMan probe, Xtreme Chain Reaction (XCR), group-specific, overlap-extension PCR for multi-fragment assembling cloning, and isothermal amplification (Loop-mediated Isothermal Amplification). A programme is available to design specific oligonucleotide sets for long sequence assembly by ligase chain reaction and to design multiplexed of overlapping and non-overlapping DNA amplicons that tile across a region(s) of interest for targeted next-generation sequencing, competitive allele specific PCR (KASP) based genotyping assay for single nucleotide polymorphisms and insertions and deletions at specific loci, among other features. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. FastPCR includes various bioinformatics tools for analysis and searching of sequences, restriction I-II-III type enzyme endonuclease analysis and pattern searching. The program also supports the assembly of a set of contiguous sequences, consensus sequence generation, and sequence similarity and conservancy analysis. FastPCR performs efficient and complete detection of various repeat types with visual display. FastPCR allows for sequence file batch processing that is essential for automation. The software is available for download at https://primerdigital.com/fastpcr.html and online version at https://primerdigital.com/tools/pcr.html.

MotivationDNA metabarcoding is a commonly applied technique used to infer the species composition of environmental samples. These samples can comprise hundreds of organisms that can be closely or very distantly related in the taxonomic tree of life. DNA metabarcoding combines polymerase chain reaction (PCR) and next-generation sequencing (NGS), whereby a short, homologous sequence of DNA is amplified and sequenced from all members of the community. Sequences are then taxonomically identified based on their match to a reference database. Ideally, each species of interest would have a unique DNA barcode. This short, variable sequence needs to be flanked by relatively conserved regions that can be used as primer binding sites. Appropriate PCR primer pairs would match to a broad evolutionary range of taxa, such that we only need a few to achieve high taxonomic coverage. At the same time however, the DNA barcodes between primer pairs should be different to allow us to distinguish between species to improve resolution. This poses an interesting optimization problem. More specifically: Given a set of references ℛ = {R1, R2, …, Rm}, the problem is to find a primer set P balancing both: high taxonomic coverage and high resolution. This goal can be captured by filtering for frequent primers and ranking by coverage or variation, i.e. the number of unique barcodes. Here we present the software PriSeT, an offline primer discovery tool that is capable of processing large libraries and is robust against mislabeled or low quality references. It tackles the computationally expensive steps with linear runtime filters and efficient encodings.ResultsWe first evaluated PriSeT on references (mostly 18S rRNA genes) from 19 clades covering eukaryotic organisms that are typical for freshwater plankton samples. PriSeT recovered several published primer sets as well as additional, more chemically suitable primer sets. For these new sets, we compared frequency, taxon coverage, and amplicon variation with published primer sets. For 11 clades we found de novo primer pairs that cover more taxa than the published ones, and for six clades de novo primers resulted in greater sequence (i.e., DNA barcode) variation. We also applied PriSeT to 19 SARS-CoV-2 genomes and computed 114 new primer pairs with the additional constraint that the sequences have no co-occurrences in other taxa. These primer sets would be suitable for empirical testing.Availabilityhttps://github.com/mariehoffmann/PriSeTContactmarie.hoffmann@fu-berlin.de

AAB are Gram-negative, obligate aerobic, rod-shaped bacteria that produce acetic acid from various alcohols or monosaccharides. They play a multifaceted role in the vinegar, dairy, and wine industry. Currently, the detection of AAB involves laborious and time-consuming culture methods (>3–5 days). To develop a low-cost, easy to use, and reliable assay for the detection of AAB in food products, we designed a novel real-time PCR primer set, K-AAB, targeting the 16S rRNA genes of all known AAB species (46 species across 11 genera). In in silico PCR analysis, all 46 AAB species tested positive, whereas all (34 out of 34) closely related microorganisms tested negative. In inclusivity and exclusivity analyses, the real-time PCR assay showed positive results with 16 AAB species, with a melting temperature of all amplicons of 81.5 °C, whereas negative results were observed in 20 species of unrelated food microorganisms. These results indicated 100% sensitivity and specificity of the assay. Furthermore, the novel K-AAB primer-based assay enabled linear detection of AAB in the range of 101–105 colony-forming units (CFU) per reaction in yogurt and vinegar. The novel assay was successfully applied for the screening of food samples naturally harboring AAB, which was accomplished within 2 h. These findings demonstrate that the novel method can be used for effective and sensitive screening for the presence of AAB in food products, either to detect AAB contaminants or explore the presence of novel functional strains.

The American bullfrog (Rana catesbeiana) is one of the most damaging invasive species worldwide. Recently developed environmental DNA (eDNA)-based methods have proven to be promising tools to detect aquatic invasive species at low abundance. To develop an eDNA-based assay for bullfrog monitoring, we designed a primer and probe set that targeted the bullfrog DNA and compared its species specificity in in silico PCR and in vitro quantitative PCR. We demonstrated that our primers successfully amplified the bullfrog DNA, but not DNA of native anuran species in the Beijing area, in silico and in vitro. Additionally, in silico PCR identified only a small number of potentially amplifiable species occurring in North America. In contrast, a previously reported primer pair that specifically targeted the bullfrog in France amplified the DNA of a wide range of teleost fish and amphibians in silico and a common native species in vitro. We also compared three commonly used eDNA extraction methods—the phenol–chloroform–isoamyl alcohol (PCI) method, cetyltrimethylammonium bromide (CTAB)-based extraction, and Qiagen’s DNeasy blood and tissue kit—for their efficiency in recovering bullfrog eDNA from laboratory aquariums. The CTAB method showed a significantly higher extraction efficacy than the PCI method or the DNeasy kit and considerably outperformed the other methods in terms of time efficiency and costs. Our study provides a useful primer set and extraction protocol for eDNA-based active surveillance of bullfrog invasions over a potentially wide geographical range, which has important implications for the management of this invasive species.

Effective and accurate primer design is an increasingly important skill as the use of PCR-based diagnostics in clinical and environmental settings is on the rise. While universal primer sets have been successfully designed for highly conserved core genes such as 16S rRNA and characteristic genes such as dsrAB and dnaJ, primer sets for mobile, accessory genes such as multidrug resistance efflux pumps (MDREP) have not been explored. Here, we describe an approach to create universal primer sets for select MDREP genes chosen from five superfamilies (SMR, MFS, MATE, ABC and RND) identified in a model community of six members (Acetobacterium woodii, Bacillus subtilis, Desulfovibrio vulgaris, Geoalkalibacter subterraneus, Pseudomonas putida and Thauera aromatica). Using sequence alignments and in silico PCR analyses, a new approach for creating universal primers sets targeting mobile, non-conserved genes has been developed and compared to more traditional approaches used for highly conserved genes. A discussion of the potential shortfalls of the primer sets designed this way are described. The approach described here can be adapted to any unique gene set and aid in creating a wider, more robust library of primer sets to detect less conserved genes and improve the field of PCR-based screening research.IMPORTANCE Increasing use of molecular detection methods, specifically PCR and qPCR, requires utmost confidence in the results while minimizing false positives and negatives due to poor primer designs. Frequently, these detection methods are focused on conserved, core genes which limits their applications. These screening methods are being used in various industries for specific genetic targets or key organisms such as viral or infectious strains, or characteristic genes indicating the presence of key metabolic processes. The significance of this work is to improve primer design approaches to broaden the scope of detectable genes. The use of the techniques explored here will improve detection of non-conserved genes through unique primer design approaches. Additionally, the approaches here highlight additional, important information which can be gleaned during the in silico phase of primer design which will improve our gene annotations based on percent identities.

International audience; Through the development of environmental DNA (eDNA) metabarcoding, in situ monitoring of organisms is becoming easier and promises a revolution in our approaches to detect changes in biodiversity over space and time. A cornerstone of eDNA approach is the development of primer pairs that allow amplifying the DNA of specific taxonomic groups, which is then used to link the DNA sequence to taxonomic identification. Here, we propose a framework for comparing primer pairs regarding (a) their capacity to bind and amplify a broad coverage of species within the target clade using in silico PCR, (b) their capacity to not only discriminate between species but also genera or families, and (c) their in situ specificity and efficiency across a variety of environments. As a case study, we focus on two mitochondrial 12S primer pairs, MiFish-U and teleo, which were designed to amplify fishes. We found that the performance of in silico PCRs were high for both primer pairs, but teleo amplified more genera acrossActinopterygii, Chondrichthyes, and Petromyzontomorphi than MiFish-U. In contrast, the discriminatory power for species, genera, and families were higher for MiFish-U than teleo, likely associated with the greater length of the amplified DNA fragments. The evaluation of their in situ efficiency showed a higher recovered species richness ,of teleo compared to MiFish-U in tropical and temperate freshwater environments, but that generally both teleo and MiFish-U primers pairs perform well to monitor fish species. Since more species were detected when used together, those primer pairs are best used in combination to increase the ability of species detection.

Retrotransposons are ubiquitous, generally dispersed components of eukaryotic genomes. These properties, together with their "copy and paste" lifecycle that generates insertional polymorphism without need for excision, makes them widely useful as a molecular-genetic tags. Various tagging systems have been developed that exploit the sequence conservation of retrotransposon components, such as those found in their long terminal repeats (LTRs). To detect polymorphisms for retrotransposon insertions, marker systems generally rely on PCR amplification between the termini and some component of flanking genomic DNA. As complements to various "wet lab" protocols for retrotransposon tagging, in silico bioinformatics approaches are useful for predicting likely outcomes from unsequenced accessions on the basis of reference genomes. In this chapter, we describe protocols for in silico retrotransposon-based fingerprinting techniques using the FastPCR software as an integrated tools environment for in silico PCR primer design and analysis.

Recent increase of Harmful Algal Blooms (HAB) causes world-wide ecological, economical, and health issues, and more attention is paid to frequent coastal monitoring for the early detection of HAB species to prevent or reduce such impacts. Use of molecular tools in addition to traditional microscopy-based observation has become one of the promising methodologies for coastal monitoring. However, as ribosomal RNA (rRNA) genes are commonly targeted in molecular studies, variability in the rRNA gene copy number within and between species must be considered to provide quantitative information in quantitative PCR (qPCR), digital PCR (dPCR), and metabarcoding analyses. Currently, this information is only available for a limited number of species. The present study utilized a dPCR technology to quantify copy numbers of rRNA genes per single cell in 16 phytoplankton species, the majority of which are toxin-producers, using a newly developed universal primer set accompanied by a labeled probe with a fluorophore and a double-quencher. In silico PCR using the newly developed primers allowed the detection of taxa from 8 supergroups, demonstrating universality and broad coverage of the primer set. Chelex buffer was found to be suitable for DNA extraction to obtain DNA fragments with suitable size to avoid underestimation of the copy numbers. The study successfully demonstrated the first comparison of absolute quantification of 18S rRNA copy numbers per cell from 16 phytoplankton species by the dPCR technology.

Clostridioides difficile is a cause of health care-associated infections. The epidemiological study of C. difficile infection (CDI) traditionally involves PCR ribotyping. However, ribotyping will be increasingly replaced by whole genome sequencing (WGS). This implies that WGS types need correlation with classical ribotypes (RTs) in order to perform retrospective clinical studies. Here, we selected genomes of hyper-virulent C. difficile strains of RT001, RT017, RT027, RT078, and RT106 to try and identify new discriminatory markers using in silico ribotyping PCR and De Bruijn graph-based Genome Wide Association Studies (DBGWAS). First, in silico ribotyping PCR was performed using reference primer sequences and 30 C. difficile genomes of the five different RTs identified above. Second, discriminatory genomic markers were sought with DBGWAS using a set of 160 independent C. difficile genomes (14 ribotypes). RT-specific genetic polymorphisms were annotated and validated for their specificity and sensitivity against a larger dataset of 2425 C. difficile genomes covering 132 different RTs. In silico PCR ribotyping was unsuccessful due to non-specific or missing theoretical RT PCR fragments. More successfully, DBGWAS discovered a total of 47 new markers (13 in RT017, 12 in RT078, 9 in RT106, 7 in RT027, and 6 in RT001) with minimum q-values of 0 to 7.40 &times, 10&minus, 5, indicating excellent marker selectivity. The specificity and sensitivity of individual markers ranged between 0.92 and 1.0 but increased to 1 by combining two markers, hence providing undisputed RT identification based on a single genome sequence. Markers were scattered throughout the C. difficile genome in intra- and intergenic regions. We propose here a set of new genomic polymorphisms that efficiently identify five hyper-virulent RTs utilizing WGS data only. Further studies need to show whether this initial proof-of-principle observation can be extended to all 600 existing RTs.

Clostridioides difficile is a cause of health care-associated infections. The epidemiological study of C. difficile infection (CDI) traditionally involves PCR ribotyping. However, ribotyping will be increasingly replaced by whole genome sequencing (WGS). This implies that WGS types need correlation with classical ribotypes (RTs) in order to perform retrospective clinical studies. Here, we selected genomes of hyper-virulent C. difficile strains of RT001, RT017, RT027, RT078, and RT106 to try and identify new discriminatory markers using in silico ribotyping PCR and De Bruijn graph-based Genome Wide Association Studies (DBGWAS). First, in silico ribotyping PCR was performed using reference primer sequences and 30 C. difficile genomes of the five different RTs identified above. Second, discriminatory genomic markers were sought with DBGWAS using a set of 160 independent C. difficile genomes (14 ribotypes). RT-specific genetic polymorphisms were annotated and validated for their specificity and sensitivity against a larger dataset of 2425 C. difficile genomes covering 132 different RTs. In silico PCR ribotyping was unsuccessful due to non-specific or missing theoretical RT PCR fragments. More successfully, DBGWAS discovered a total of 47 new markers (13 in RT017, 12 in RT078, 9 in RT106, 7 in RT027, and 6 in RT001) with minimum q-values of 0 to 7.40 × 10−5, indicating excellent marker selectivity. The specificity and sensitivity of individual markers ranged between 0.92 and 1.0 but increased to 1 by combining two markers, hence providing undisputed RT identification based on a single genome sequence. Markers were scattered throughout the C. difficile genome in intra- and intergenic regions. We propose here a set of new genomic polymorphisms that efficiently identify five hyper-virulent RTs utilizing WGS data only. Further studies need to show whether this initial proof-of-principle observation can be extended to all 600 existing RTs.

Many environmental and biomedical biomonitoring and detection studies aim to explore the presence of specific organisms or gene functionalities in microbiome samples. In such cases, when the study hypotheses can be answered with the exploration of a small number of genes, a targeted PCR-approach is appropriate. However, due to the complexity of environmental microbial communities, the design of specific primers is challenging and can lead to non-specific results. We designed PhyloPrimer, the first user-friendly platform to semi-automate the design of taxon-specific oligos (i.e., PCR primers) for a gene of interest. The main strength of PhyloPrimer is the ability to retrieve and align GenBank gene sequences matching the user’s input, and to explore their relationships through an online dynamic tree. PhyloPrimer then designs oligos specific to the gene sequences selected from the tree and uses the tree non-selected sequences to look for and maximize oligo differences between targeted and non-targeted sequences, therefore increasing oligo taxon-specificity (positive/negative consensus approach). Designed oligos are then checked for the presence of secondary structure with the nearest-neighbor (NN) calculation and the presence of off-target matches with in silico PCR tests, also processing oligos with degenerate bases. Whilst the main function of PhyloPrimer is the design of taxon-specific oligos (down to the species level), the software can also be used for designing oligos to target a gene without any taxonomic specificity, for designing oligos from preselected sequences and for checking predesigned oligos. We validated the pipeline on four commercially available microbial mock communities using PhyloPrimer to design genus- and species-specific primers for the detection of Streptococcus species in the mock communities. The software performed well on these mock microbial communities and can be found at https://www.cerealsdb.uk.net/cerealgenomics/phyloprimer.

Along with progress in sequencing technology and accumulating knowledge of genome and gene sequences, molecular breeding techniques have been developed for predicting the genetic potential of individual genotypes and for selecting superior individuals. For Japanese cedar (Cryptomeria japonica (L.f.) D.Don), which is the most common coniferous species in Japanese forestry, we constructed a custom primer panel for target amplicon sequencing in order to simultaneously determine 3034 informative single nucleotide polymorphisms (SNPs). We performed primary evaluation of the custom primer panel with actual sequencing and in silico PCR. Genotyped SNPs had a distribution over almost the entire region of the C. japonica linkage map and verified the high reproducibility of genotype calls compared to SNPs obtained by genotyping arrays. Genotyping was performed for 576 individuals of the F1 population, and genomic prediction models were constructed for growth and wood property-related traits using the genotypes. Amplicon sequencing with the custom primer panel enables efficient obtaining genotype data in order to perform genomic prediction, manage clones, and advance forest tree breeding.

Effective and accurate primer design is an increasingly important skill as the use of PCR-based diagnostics in clinical and environmental settings is on the rise. While universal primer sets have been successfully designed for highly conserved core genes such as 16S rRNA and characteristic genes such as dsrAB and dnaJ, primer sets for mobile, accessory genes such as multidrug resistance efflux pumps (MDREP) have not been explored. Here, we describe an approach to create universal primer sets for select MDREP genes chosen from five superfamilies (SMR, MFS, MATE, ABC and RND) identified in a model community of six members (Acetobacterium woodii, Bacillus subtilis, Desulfovibrio vulgaris, Geoalkalibacter subterraneus, Pseudomonas putida and Thauera aromatica). Using sequence alignments and in silico PCR analyses, a new approach for creating universal primers sets targeting mobile, non-conserved genes has been developed and compared to more traditional approaches used for highly conserved genes. A discussion of the potential shortfalls of the primer sets designed this way are described. The approach described here can be adapted to any unique gene set and aid in creating a wider, more robust library of primer sets to detect less conserved genes and improve the field of PCR-based screening research.ImportanceIncreasing use of molecular detection methods, specifically PCR and qPCR, requires utmost confidence in the results while minimizing false positives and negatives due to poor primer designs. Frequently, these detection methods are focused on conserved, core genes which limits their applications. These screening methods are being used in various industries for specific genetic targets or key organisms such as viral or infectious strains, or characteristic genes indicating the presence of key metabolic processes. The significance of this work is to improve primer design approaches to broaden the scope of detectable genes. The use of the techniques explored here will improve detection of non-conserved genes through unique primer design approaches. Additionally, the approaches here highlight additional, important information which can be gleaned during the in silico phase of primer design which will improve our gene annotations based on sequence homologies.

Detection of Salmonella bacteria based on their virulence genes is among essential steps in the eradication of clinical infection by bacteria. In this study, two pair of primers, PhoPF-PhoPR: 5’- CCGCGCAGGAAAAACTCAAA-3’ and 5’-ATCTGTTCCAGCATCACCGG -3’ as well as PhoQF-PhoQR: 5’-AGAGATGATGCGCGTACTGG-3’ and 5’- CAGACGCCCCATGAGAACAT-3’, had been successfully designed using Primer3Plus to detect the presence of phoP and phoQ genes in Salmonella spp. Using genomic DNA of 44 genomic data of Salmonella spp. as templates, PhoPF-PhoPR could produce 520-bp amplicon, while PhoQF-PhoQR could result in 598-bp amplicon. Results of in silico PCR showed that both pairs of primers PhoPF-PhoPR and PhoQF-PhoQR could detect only Salmonella enterica species, and no Salmonella bongori species could be detected based on phoP and phoQ sequences. Both pairs of PhoPF-PhoPR and PhoQF-PhoQR primers were also able to detect the virulence genes in most of the studied subspecies of Salmonella enterica available in silico database unless Arizona subspecies. As conclusion, based on this in silico study, phoP and phoQ genes appeared to be biomarkers for Salmonella enterica species. Both pairs of primers designed in this study has potential to be used as detection tool to differentiate species Salmonella enterica from Salmonella bongori, and also to distinguish S.enterica subsp. enterica from subsp. Arizonae.Keywords: Gene detection, bacterial virulence, phoP, phoQ, Salmonella spp.